ID: 1182106682

View in Genome Browser
Species Human (GRCh38)
Location 22:27694802-27694824
Sequence TCAGAAATTTGCTTCCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106682_1182106685 -3 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106685 22:27694822-27694844 TGAATAAAGAGATGGAGACAGGG No data
1182106682_1182106687 11 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106687 22:27694836-27694858 GAGACAGGGACCCCAGGTTCTGG No data
1182106682_1182106690 19 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106690 22:27694844-27694866 GACCCCAGGTTCTGGATTTGGGG No data
1182106682_1182106684 -4 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG No data
1182106682_1182106694 26 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106694 22:27694851-27694873 GGTTCTGGATTTGGGGCAGAAGG No data
1182106682_1182106686 5 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106686 22:27694830-27694852 GAGATGGAGACAGGGACCCCAGG No data
1182106682_1182106689 18 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106689 22:27694843-27694865 GGACCCCAGGTTCTGGATTTGGG No data
1182106682_1182106688 17 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106688 22:27694842-27694864 GGGACCCCAGGTTCTGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106682 Original CRISPR TCAGAAATTTGCTTCCCAGT AGG (reversed) Intergenic
No off target data available for this crispr