ID: 1182106684

View in Genome Browser
Species Human (GRCh38)
Location 22:27694821-27694843
Sequence CTGAATAAAGAGATGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106677_1182106684 14 Left 1182106677 22:27694784-27694806 CCATCCTGGCCACAAGATCCTAC No data
Right 1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG No data
1182106681_1182106684 5 Left 1182106681 22:27694793-27694815 CCACAAGATCCTACTGGGAAGCA No data
Right 1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG No data
1182106682_1182106684 -4 Left 1182106682 22:27694802-27694824 CCTACTGGGAAGCAAATTTCTGA No data
Right 1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG No data
1182106679_1182106684 10 Left 1182106679 22:27694788-27694810 CCTGGCCACAAGATCCTACTGGG No data
Right 1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106684 Original CRISPR CTGAATAAAGAGATGGAGAC AGG Intergenic
No off target data available for this crispr