ID: 1182106700

View in Genome Browser
Species Human (GRCh38)
Location 22:27694910-27694932
Sequence TCTCTTCCACCTTGGCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106700_1182106705 8 Left 1182106700 22:27694910-27694932 CCCATGAGCCAAGGTGGAAGAGA No data
Right 1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG No data
1182106700_1182106712 26 Left 1182106700 22:27694910-27694932 CCCATGAGCCAAGGTGGAAGAGA No data
Right 1182106712 22:27694959-27694981 CCCGGCTGTCCCTCCTTGGCAGG No data
1182106700_1182106709 22 Left 1182106700 22:27694910-27694932 CCCATGAGCCAAGGTGGAAGAGA No data
Right 1182106709 22:27694955-27694977 CCCTCCCGGCTGTCCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106700 Original CRISPR TCTCTTCCACCTTGGCTCAT GGG (reversed) Intergenic