ID: 1182106702

View in Genome Browser
Species Human (GRCh38)
Location 22:27694918-27694940
Sequence TCTATTGGTCTCTTCCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106702_1182106705 0 Left 1182106702 22:27694918-27694940 CCAAGGTGGAAGAGACCAATAGA No data
Right 1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG No data
1182106702_1182106712 18 Left 1182106702 22:27694918-27694940 CCAAGGTGGAAGAGACCAATAGA No data
Right 1182106712 22:27694959-27694981 CCCGGCTGTCCCTCCTTGGCAGG No data
1182106702_1182106714 24 Left 1182106702 22:27694918-27694940 CCAAGGTGGAAGAGACCAATAGA No data
Right 1182106714 22:27694965-27694987 TGTCCCTCCTTGGCAGGAACTGG No data
1182106702_1182106709 14 Left 1182106702 22:27694918-27694940 CCAAGGTGGAAGAGACCAATAGA No data
Right 1182106709 22:27694955-27694977 CCCTCCCGGCTGTCCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106702 Original CRISPR TCTATTGGTCTCTTCCACCT TGG (reversed) Intergenic