ID: 1182106705

View in Genome Browser
Species Human (GRCh38)
Location 22:27694941-27694963
Sequence CAGGTTCCAAATGCCCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182106701_1182106705 7 Left 1182106701 22:27694911-27694933 CCATGAGCCAAGGTGGAAGAGAC No data
Right 1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG No data
1182106702_1182106705 0 Left 1182106702 22:27694918-27694940 CCAAGGTGGAAGAGACCAATAGA No data
Right 1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG No data
1182106700_1182106705 8 Left 1182106700 22:27694910-27694932 CCCATGAGCCAAGGTGGAAGAGA No data
Right 1182106705 22:27694941-27694963 CAGGTTCCAAATGCCCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182106705 Original CRISPR CAGGTTCCAAATGCCCCTCC CGG Intergenic