ID: 1182107217

View in Genome Browser
Species Human (GRCh38)
Location 22:27698155-27698177
Sequence AGGCGCCTGCCTCCTGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182107212_1182107217 6 Left 1182107212 22:27698126-27698148 CCCAGGTGAAAGCTGAGCCTGAG No data
Right 1182107217 22:27698155-27698177 AGGCGCCTGCCTCCTGCCCTCGG No data
1182107210_1182107217 30 Left 1182107210 22:27698102-27698124 CCACACAGAAGTCACGAGGCTCA No data
Right 1182107217 22:27698155-27698177 AGGCGCCTGCCTCCTGCCCTCGG No data
1182107213_1182107217 5 Left 1182107213 22:27698127-27698149 CCAGGTGAAAGCTGAGCCTGAGT No data
Right 1182107217 22:27698155-27698177 AGGCGCCTGCCTCCTGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182107217 Original CRISPR AGGCGCCTGCCTCCTGCCCT CGG Intergenic
No off target data available for this crispr