ID: 1182108244

View in Genome Browser
Species Human (GRCh38)
Location 22:27704517-27704539
Sequence CCTGTTTTACAGGCGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182108244_1182108250 -6 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108250 22:27704534-27704556 AACAGGGAATGGCAGAGAATGGG No data
1182108244_1182108251 -5 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108251 22:27704535-27704557 ACAGGGAATGGCAGAGAATGGGG No data
1182108244_1182108257 24 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108257 22:27704564-27704586 CTGGGAGCCGCAGGGCCCCCAGG No data
1182108244_1182108253 6 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108253 22:27704546-27704568 CAGAGAATGGGGACACTCCTGGG No data
1182108244_1182108255 16 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108255 22:27704556-27704578 GGACACTCCTGGGAGCCGCAGGG No data
1182108244_1182108252 5 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108252 22:27704545-27704567 GCAGAGAATGGGGACACTCCTGG No data
1182108244_1182108249 -7 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108249 22:27704533-27704555 AAACAGGGAATGGCAGAGAATGG No data
1182108244_1182108254 15 Left 1182108244 22:27704517-27704539 CCTCACAGCGCCTGTAAAACAGG No data
Right 1182108254 22:27704555-27704577 GGGACACTCCTGGGAGCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182108244 Original CRISPR CCTGTTTTACAGGCGCTGTG AGG (reversed) Intergenic
No off target data available for this crispr