ID: 1182110205

View in Genome Browser
Species Human (GRCh38)
Location 22:27717849-27717871
Sequence TGCCAGGTAAAGGAAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182110201_1182110205 23 Left 1182110201 22:27717803-27717825 CCATCTCAAAAAAGCAAACAAAC 0: 12
1: 576
2: 2057
3: 8064
4: 116999
Right 1182110205 22:27717849-27717871 TGCCAGGTAAAGGAAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182110205 Original CRISPR TGCCAGGTAAAGGAAGTTGG AGG Intergenic
No off target data available for this crispr