ID: 1182111022

View in Genome Browser
Species Human (GRCh38)
Location 22:27723785-27723807
Sequence CTCAGGACTCATCTTCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182111018_1182111022 15 Left 1182111018 22:27723747-27723769 CCTTATCTTCACAGAGTGGGGGA No data
Right 1182111022 22:27723785-27723807 CTCAGGACTCATCTTCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182111022 Original CRISPR CTCAGGACTCATCTTCATGG AGG Intergenic
No off target data available for this crispr