ID: 1182111792

View in Genome Browser
Species Human (GRCh38)
Location 22:27728952-27728974
Sequence GAGTTTCAACAGCTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182111792_1182111798 17 Left 1182111792 22:27728952-27728974 CCTTTCTCCAGCTGTTGAAACTC No data
Right 1182111798 22:27728992-27729014 ATCTCCATGGCACTTCAGTCAGG No data
1182111792_1182111796 4 Left 1182111792 22:27728952-27728974 CCTTTCTCCAGCTGTTGAAACTC No data
Right 1182111796 22:27728979-27729001 CAAATTTGCAGCCATCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182111792 Original CRISPR GAGTTTCAACAGCTGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr