ID: 1182115003

View in Genome Browser
Species Human (GRCh38)
Location 22:27751324-27751346
Sequence CAGTTTCCCCACTGGGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1068
Summary {0: 1, 1: 3, 2: 9, 3: 137, 4: 918}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182114998_1182115003 -10 Left 1182114998 22:27751311-27751333 CCCTGTTGGGCCTCAGTTTCCCC No data
Right 1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG 0: 1
1: 3
2: 9
3: 137
4: 918
1182114994_1182115003 4 Left 1182114994 22:27751297-27751319 CCAAGGGAAGACCTCCCTGTTGG No data
Right 1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG 0: 1
1: 3
2: 9
3: 137
4: 918
1182114989_1182115003 30 Left 1182114989 22:27751271-27751293 CCCCTGATTCATCTGTGAGATCT 0: 1
1: 0
2: 0
3: 10
4: 206
Right 1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG 0: 1
1: 3
2: 9
3: 137
4: 918
1182114991_1182115003 28 Left 1182114991 22:27751273-27751295 CCTGATTCATCTGTGAGATCTCA 0: 1
1: 0
2: 0
3: 26
4: 178
Right 1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG 0: 1
1: 3
2: 9
3: 137
4: 918
1182114997_1182115003 -7 Left 1182114997 22:27751308-27751330 CCTCCCTGTTGGGCCTCAGTTTC No data
Right 1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG 0: 1
1: 3
2: 9
3: 137
4: 918
1182114990_1182115003 29 Left 1182114990 22:27751272-27751294 CCCTGATTCATCTGTGAGATCTC 0: 1
1: 0
2: 0
3: 11
4: 181
Right 1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG 0: 1
1: 3
2: 9
3: 137
4: 918

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182115003 Original CRISPR CAGTTTCCCCACTGGGAAAT AGG Intronic
901093426 1:6659203-6659225 CCATTTCCCCAATGTGAAATAGG - Intronic
901234374 1:7659895-7659917 CAGTTTCCTCACTTGTAAAGTGG - Intronic
901773493 1:11543268-11543290 CACTTTCCTCTCTGAGAAATGGG - Intergenic
901778935 1:11579860-11579882 CAGTTTCCCCATCCGCAAATGGG + Intergenic
901825162 1:11856667-11856689 CAGTTTTCCCATTTGGAAAATGG + Intergenic
902050177 1:13557685-13557707 CAGTTACCTCACTTGTAAATTGG + Intergenic
902140364 1:14348663-14348685 CAGTTTCCCAATTTGGAAAAAGG - Intergenic
902168344 1:14590833-14590855 CAACTTCCTCACTGGGAAAATGG - Intergenic
902376224 1:16031226-16031248 CTGTTTCCCCATCGGGAAAATGG + Intronic
902599810 1:17533197-17533219 CAGTTTCCTCATTGGTAAAATGG + Intergenic
902613651 1:17611726-17611748 CAGCTTCCTCACTGGTAAAGTGG - Intronic
902645698 1:17796476-17796498 CAGTTTCACCTCTGGTAAGTGGG - Intronic
902734127 1:18388823-18388845 CAGTTTTCCCACTACAAAATGGG + Intergenic
902784615 1:18725071-18725093 CAGTTTCCCCATTTGTAAAATGG - Intronic
902786144 1:18733899-18733921 CAGTTTTTCATCTGGGAAATGGG + Intronic
902812001 1:18893249-18893271 CAGTTTCCTCACCTGGAAAATGG + Intronic
902824363 1:18962814-18962836 CAGTTTCCCCTCTGTAAAACGGG + Intergenic
902892173 1:19452326-19452348 CATTGCCCCCACTGGGACATAGG + Intronic
902948960 1:19865913-19865935 CAGTTTCCCCACCCAAAAATGGG - Intergenic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903193598 1:21669513-21669535 CAGTTTCCCCACCTGTAAAATGG - Intergenic
903307282 1:22421982-22422004 CAGTTTCCCCATTAAGAAGTTGG + Intergenic
903346739 1:22689934-22689956 CAGTTTCCCCAGTGTAAAAAGGG - Intergenic
903361123 1:22777950-22777972 CAGTTTCCTCACCTGGAAAATGG - Intronic
903480145 1:23647140-23647162 CAGTTTCCCCATCTGAAAATGGG + Intergenic
903496027 1:23767831-23767853 CAGTTTCCTCATTGGTAAAATGG + Intergenic
903666930 1:25013761-25013783 CAGTTTCTCATCTGTGAAATGGG + Intergenic
903667906 1:25019042-25019064 CAGTTTCCTCATTGGTAAAATGG + Intergenic
903680425 1:25092853-25092875 CAGTTTCCCCTCTGGGCCAAGGG + Intergenic
903739659 1:25551428-25551450 CAGTTTCCTCTCTGTAAAATGGG + Intronic
903890607 1:26567850-26567872 CAGTTTCCTCACTTGTAAAATGG - Intronic
903891418 1:26572840-26572862 CAGTTTCCCTGCTGAGAAATAGG - Intronic
904276606 1:29388903-29388925 CAGTTTCCCATCTGTAAAATGGG + Intergenic
904430779 1:30462718-30462740 CCGTTTCCCCATTGGCAAAGTGG + Intergenic
904492059 1:30867220-30867242 CAGTTTCCTCACTTGTAAAATGG - Intergenic
904533314 1:31182818-31182840 CAGTTTTCCCACTTGGACTTGGG + Intronic
904643183 1:31945734-31945756 CAGTTTCCCCATTTGGCAGTTGG + Intergenic
904788778 1:33002174-33002196 CAGTTTCTCAACTGTAAAATGGG + Intergenic
904799342 1:33081677-33081699 CAGTTTCCCCAATTGTAAATGGG - Exonic
904819251 1:33230179-33230201 CAGTTTCCTCACTTGTAAACTGG + Intergenic
905035357 1:34914609-34914631 CAGTTTCCCCATTTTCAAATGGG + Intronic
905291331 1:36923619-36923641 CAGTTTCCTCACTAGTAAATTGG + Intronic
905306418 1:37021878-37021900 CAGTTTCCCCACTGATACAAAGG + Intronic
905404250 1:37722616-37722638 CAGTTTCTCATCTGAGAAATGGG - Intronic
905434534 1:37947453-37947475 CAGTTTCTCCACCTGGAAAATGG - Intergenic
905477656 1:38240223-38240245 CAGTTTCCCTACTAGTAAAATGG + Intergenic
905481463 1:38264878-38264900 TAGTCTCCTCACTGGGAAATAGG - Intergenic
905811375 1:40915867-40915889 CAGTTTCCTCACTTGAAAAAAGG + Intergenic
906459875 1:46028946-46028968 CTGTTTCCCCACTGGGCCAGGGG - Intronic
906646043 1:47475858-47475880 CAGTTTCTTCCCTGGTAAATGGG + Intergenic
906654215 1:47536080-47536102 CAGTTTCTTCACTGGTAAAATGG - Intergenic
906822749 1:48946525-48946547 CAGTTTCTGCATTGGAAAATGGG + Intronic
907113958 1:51952239-51952261 CTGTTTCCCATCTGTGAAATGGG - Intronic
907141675 1:52191615-52191637 CAGTTTCCCTACTTTCAAATGGG - Intronic
907307392 1:53520893-53520915 CAGTTCCCCATCTGTGAAATGGG + Intronic
907385736 1:54124390-54124412 CAGTTTCCCCTCTACAAAATGGG + Intergenic
907432345 1:54420439-54420461 CAGCTTCTCCCCTGGAAAATGGG - Intergenic
907589552 1:55653188-55653210 CAGTTTCCTCACTTAGAAAATGG + Intergenic
907690577 1:56660745-56660767 CAGTTTGCTCACTTGTAAATAGG + Intronic
907910104 1:58817910-58817932 CAGTTTCCCCACCTGGAAAAAGG + Intergenic
907913576 1:58848561-58848583 CAGTTTCCCCATTGCAAAATGGG - Intergenic
907913951 1:58851970-58851992 CAGTTTCCCCATTTGTAAAATGG - Intergenic
908109040 1:60876388-60876410 CAGCTGCTACACTGGGAAATGGG - Intronic
908166651 1:61465508-61465530 CAGTTTCCCCATTGGTAAGATGG + Intergenic
908297011 1:62722652-62722674 CGGTTTCCCCATTTGTAAATGGG + Intergenic
908939340 1:69412415-69412437 CAGTTTCCTCACTGGGAAATTGG + Intergenic
909043329 1:70679767-70679789 CAGTTTCTCCACTTGTAAAATGG + Intergenic
909293865 1:73919533-73919555 TAGTTTCCCTACTGAGAATTTGG - Intergenic
909439752 1:75684531-75684553 CAATTTCTCCACTTTGAAATTGG - Intergenic
909927719 1:81458481-81458503 GAGATTTCCCACTGGGAAAGTGG - Intronic
910118362 1:83757430-83757452 CAGTTGCCCCTATGGGAAATCGG - Intergenic
910283909 1:85531818-85531840 CTGTTTCCCCAGTTGAAAATGGG - Intronic
910537237 1:88312240-88312262 CAGTTTCCTCAATGGTAAAATGG + Intergenic
910837415 1:91529730-91529752 CAGTTTCCTCATCTGGAAATGGG + Intergenic
911054891 1:93701087-93701109 CTGTTTCCCCACTGTAAAATGGG + Intronic
911441979 1:97938337-97938359 GAGTTTCCTGATTGGGAAATGGG + Intergenic
912173371 1:107127834-107127856 CTGTTTCCCCACTGGAAATCAGG + Intergenic
913279959 1:117176220-117176242 CAGTTTCCCCACATGTAAAAAGG - Intronic
913329769 1:117657514-117657536 CAGTCTCCATACTGGGAGATGGG + Intergenic
913419460 1:118649078-118649100 CAGTTTCCTCATTTGGAAAAGGG - Intergenic
913505143 1:119510005-119510027 CAGTTTCCTCACTGATAAAGTGG + Intronic
913539107 1:119801944-119801966 CTGTTTCCCTACTGGAAAGTGGG - Intronic
914206110 1:145531167-145531189 CTGTTTCCCCAGTTGAAAATGGG + Intergenic
914215687 1:145625910-145625932 CAGTTTCCACACTAGGCACTGGG - Intronic
914467634 1:147946295-147946317 CAGTTTCCACACTAGGCACTAGG - Intronic
915233623 1:154464563-154464585 CAGTTTCTTCACTTGTAAATTGG + Intronic
915348669 1:155211419-155211441 CAGTTTCTCCCCTGTGGAATGGG - Intronic
915351861 1:155232045-155232067 CAGTTTCTCCCCTGTGGAATGGG - Intergenic
916839492 1:168584968-168584990 CTGGTTACCCACTGGGCAATGGG + Intergenic
917495437 1:175536453-175536475 CAGTTTCCTGACTGTAAAATGGG - Intronic
917713130 1:177707731-177707753 CAGTTTCCCCATTGATAAATGGG + Intergenic
917856414 1:179104234-179104256 CAGTTTCCTCACTGTAAAACAGG - Exonic
918512478 1:185326413-185326435 CAGATTGTCTACTGGGAAATTGG + Intergenic
919578674 1:199343325-199343347 TATTTTCCCCATTGGGAAAATGG + Intergenic
919725019 1:200876125-200876147 CATCTTCCCCAGTGGGAGATGGG - Intergenic
919913317 1:202125353-202125375 CAATTTCCTCATTGGTAAATTGG + Intronic
920069513 1:203292153-203292175 CAGTTTACCCACTGGGAGCATGG - Intergenic
920185056 1:204154319-204154341 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
920284191 1:204868081-204868103 CACTTTCCACGCTGGGAAATGGG + Intronic
920543128 1:206794210-206794232 CAGTTTCCCCACCTGCAACTTGG + Intergenic
920652162 1:207845978-207846000 CAGTTTCCTCACTCGAAAATGGG + Intergenic
920934393 1:210417812-210417834 TATTTTCCCCACTGGGAATTTGG - Intronic
921034873 1:211367396-211367418 CAGTTTCCTCATTTGTAAATGGG + Intronic
921100119 1:211921603-211921625 CAGTTTCCTCATTTGTAAATTGG - Intergenic
921720574 1:218466208-218466230 CAGTTTCCCAGCTGGGAAGATGG + Intergenic
921767729 1:218992077-218992099 CAGTTTCCTCACTTGTAAACTGG + Intergenic
922029143 1:221781291-221781313 CAGTTTCCCCAAAGTGAACTGGG - Intergenic
922170061 1:223146621-223146643 CAGTTTCCCCATTGGTAAAATGG - Intergenic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
923036207 1:230286904-230286926 CAGTTTCCCCAGGGGTAAAATGG - Intergenic
923099139 1:230798436-230798458 CAGTTTCCACCCTGCAAAATGGG - Intronic
923202600 1:231726493-231726515 GAATTTCCCCACTGGTAAACTGG - Intronic
923359024 1:233189212-233189234 CAGGTTCACCACTGGAAAACAGG + Intronic
923419266 1:233796600-233796622 CAGTTTCCACAATGAGAAATGGG + Intergenic
923678865 1:236102866-236102888 CAGTTTCCCCTCTTGGCACTAGG + Intergenic
923789479 1:237099854-237099876 CAGTTTCCACATTTGTAAATTGG - Intronic
923823982 1:237478702-237478724 CAGTTTCCCAGCTGTGAAATGGG - Intronic
923992224 1:239451509-239451531 CAGTTTCCCCACTGGTGTACCGG + Intronic
924684722 1:246276982-246277004 CAGTTTCCCATCTGCAAAATGGG + Intronic
1063465996 10:6245002-6245024 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1063753333 10:8977049-8977071 CAGCTTCCACACTGGGAAGCAGG - Intergenic
1063865067 10:10355159-10355181 TAGTTTCCCATCTGAGAAATGGG + Intergenic
1063974531 10:11404820-11404842 CAGTTTCCCCACTGGTACCAGGG + Intergenic
1064596349 10:16949058-16949080 CAGTTTCCTCACTTGGAAAAAGG + Intronic
1065249489 10:23796281-23796303 CAGTTTCCCCATTTGTAAAGTGG + Intronic
1065527359 10:26636743-26636765 CTGCTTCCTCACTGGGAATTTGG + Intergenic
1065875948 10:29997094-29997116 CAGTTACCCCACTGAGAAAAGGG + Intergenic
1066180402 10:32957028-32957050 CAGTTTCTTCACTCGGAAAATGG + Intronic
1067474111 10:46555413-46555435 CTGTATCCCCACTGTGCAATGGG - Exonic
1067854743 10:49782506-49782528 CAGTTTCCCTACTTGGGAATAGG + Intergenic
1067927331 10:50523020-50523042 CACTTTCCCCGCTGTGATATAGG - Intronic
1068305287 10:55200041-55200063 CATTGTCCCCACTGGGGAACTGG + Intronic
1068974918 10:62998329-62998351 CAGGTTCTCCACTTGAAAATGGG - Intergenic
1069622174 10:69844499-69844521 CAGTTTCCCACCTGTAAAATAGG + Intronic
1069707024 10:70465331-70465353 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1069850929 10:71404528-71404550 CAGTTTCACCACTTGTAAAATGG - Intronic
1069861520 10:71474580-71474602 CAGTTTCCTCTCTGGTAAAATGG + Intronic
1069894799 10:71673714-71673736 CAGTTTCCCCATCTGTAAATTGG + Intronic
1069894936 10:71674645-71674667 CAGTTTCCCCATCTGTAAATTGG - Intronic
1070343875 10:75523067-75523089 CAGTTTCCTCACTTGTAAATGGG + Intronic
1070704200 10:78625705-78625727 CAGTTTCCCATCTGAGAAATGGG - Intergenic
1071427279 10:85571588-85571610 ACATGTCCCCACTGGGAAATTGG - Intergenic
1071682752 10:87723417-87723439 CAGTTTCCTCACTGGAAAAATGG - Intronic
1072127822 10:92462745-92462767 CAGTTTCCTCATCTGGAAATTGG + Intronic
1072224953 10:93360396-93360418 CAATTTCCCCACTGTAAAGTGGG + Intronic
1072541339 10:96400474-96400496 CTGTTTCCAAACTGGGAAATGGG - Intronic
1072801996 10:98398629-98398651 CACTTTCCACGATGGGAAATGGG + Intronic
1072848559 10:98860567-98860589 CAGTTTCCCCATCTGTAAATGGG - Intronic
1072994957 10:100235202-100235224 CATTTTCCACACTGGTAAATCGG + Intronic
1074371178 10:112901776-112901798 CAGTTTTCCCAATGGTAAAAGGG + Intergenic
1074489641 10:113927724-113927746 CCGTTTCCTCAATGGTAAATGGG - Intergenic
1074509183 10:114097637-114097659 CAGTTTCCTCACTGGTAAAACGG - Intergenic
1074711089 10:116178165-116178187 CTTTTTCCCAACTGGGAAACTGG + Intronic
1076073723 10:127514746-127514768 CAGTTCCCTCACTGGTAAAAAGG + Intergenic
1076242158 10:128916746-128916768 GAGTTCCCCCTCTGGGCAATGGG + Intergenic
1076274336 10:129183984-129184006 CATTTTCCTCATTGGTAAATTGG - Intergenic
1076353108 10:129832178-129832200 CAGTTTCACCACCTGGAAGTGGG + Intergenic
1076993183 11:286044-286066 CACTTTCCTCACTGGGGAACCGG - Intergenic
1077039040 11:509902-509924 CAGTTCACCCACTGTGGAATTGG + Intergenic
1077299551 11:1840713-1840735 CAGTTTCCCCACTTGTCAAGAGG + Intronic
1077316323 11:1920945-1920967 CAGTTTCCCCACTTGGAGAGTGG + Intronic
1077367679 11:2167692-2167714 CAGTTTCCCCACTGGGATTTGGG + Intronic
1077430663 11:2514402-2514424 TGGTTTCCCCACTGGGACATGGG - Intronic
1077639283 11:3866783-3866805 CAGTTTCCTCACTTGAAAAATGG + Intronic
1077759628 11:5078452-5078474 ACATTTCCCCAATGGGAAATAGG + Intergenic
1077865706 11:6219505-6219527 AAGATTCCCAACTGGGAAGTAGG + Intronic
1078260461 11:9701975-9701997 CAGATTCCCCAATTGGAACTTGG - Intronic
1078320142 11:10327149-10327171 CAGTTTCTCCTCTGAAAAATAGG + Intronic
1078402850 11:11043722-11043744 CAGTTTCCCCATTTGTAAACAGG - Intergenic
1078409760 11:11104749-11104771 CAGTTTCCCCACTGTAAAAGAGG + Intergenic
1078595699 11:12684615-12684637 CAGTTTCCCCATCTGGAAAATGG + Intronic
1078878588 11:15424580-15424602 CAGTTTTGCCACTGGTAAAATGG + Intergenic
1078979030 11:16510846-16510868 CAGTTTACCCACATGGAAAATGG - Intronic
1079089155 11:17468743-17468765 CAGGGTCCACACTGGAAAATGGG + Intronic
1079329733 11:19523419-19523441 CAGTTTCCCTACCTGGAAAATGG + Intronic
1079467567 11:20746048-20746070 CAGTTTCCCCCCTTTTAAATAGG - Intronic
1080026757 11:27623242-27623264 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1080394110 11:31874205-31874227 CAGTTTCCTCACCTGGAAAATGG - Intronic
1080935656 11:36860459-36860481 GAGTCTCCACACTGGGACATAGG - Intergenic
1081219616 11:40444180-40444202 CAGTTTTCCCACTTGCAAAATGG - Intronic
1081323207 11:41716216-41716238 CAGATTCACCACTGGTAACTTGG - Intergenic
1081584163 11:44372706-44372728 CAGTTTCCCATCTGGAAAAATGG + Intergenic
1081760926 11:45575932-45575954 CAGTTTCCCCATTGGTAGAAGGG + Intergenic
1082077022 11:47981801-47981823 CAGTTCCCCATCTGTGAAATGGG - Intronic
1082128905 11:48463676-48463698 CAGTTTCCTCTTTGGTAAATGGG + Intergenic
1082248497 11:49953704-49953726 CAGTTTCCTCTTTGGTAAATGGG - Intergenic
1082562449 11:54634652-54634674 CAGTTTCCTCTTTGGTAAATGGG + Intergenic
1082802174 11:57423180-57423202 CAGTTTCTCCTCTGTGTAATGGG + Intronic
1082892149 11:58151302-58151324 CATTTGCCCCACTGGTAAAAAGG - Intronic
1083896568 11:65622993-65623015 CTGTGTCCCCTCTGAGAAATGGG - Intronic
1084275791 11:68050343-68050365 CAGTTTCCCCTCTGTAAAGTGGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084591028 11:70090460-70090482 CAGTTTCCCCATTTGTAAAATGG + Intronic
1084787112 11:71448729-71448751 CAGTTTCCCCCTCGGCAAATGGG + Intronic
1084958637 11:72704449-72704471 CACCTTCCCCATTGGGAAAGTGG - Intronic
1085157075 11:74305418-74305440 CAGTTTCCTCTCTGTGGAATGGG - Intronic
1085391814 11:76185972-76185994 CAGTTTCCCCATTTGTAAAATGG - Intergenic
1085395074 11:76203084-76203106 CAGTTTCCCCACTTGCACAGTGG - Intronic
1085439822 11:76549705-76549727 CAGTTTCCTCATTTGTAAATGGG + Intronic
1085530182 11:77187822-77187844 CAGTTTCCCCATCAGGAAAGTGG - Intronic
1085600836 11:77854783-77854805 CAGAGTCCCCACTGGGACAGTGG - Intronic
1085783029 11:79426417-79426439 CTGTTGCCCCTCTGGAAAATGGG + Intronic
1085824720 11:79832862-79832884 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1086106828 11:83156585-83156607 CAGCTGCCCCTCTGGGAACTGGG - Intergenic
1086192135 11:84092414-84092436 CAGTTTCCTCACTGGTACATTGG - Intronic
1087019868 11:93591257-93591279 AAATAACCCCACTGGGAAATGGG + Intergenic
1087643201 11:100777538-100777560 CTGTTTCCCAAATGAGAAATAGG + Intronic
1087898948 11:103618956-103618978 CAGTTTCCCACCTGTAAAATAGG - Intergenic
1088335028 11:108694278-108694300 CAGTTTCCTCACCTGAAAATAGG - Intronic
1089121079 11:116135716-116135738 CAGTTTCTTCACTGGAAAAATGG + Intergenic
1089152876 11:116377768-116377790 CAGTTTCCTCACTTGTAAAATGG - Intergenic
1089239258 11:117061471-117061493 CAGTTTCTTCACTGGCAAATTGG + Intronic
1089598538 11:119598389-119598411 CAGTTTCCCCTTTGGTAAAATGG - Intergenic
1089649836 11:119905579-119905601 CAGTTCCCCAACAGGGCAATGGG - Intergenic
1089988416 11:122835214-122835236 CAGTTTCCTCACTTGTAAAATGG - Intergenic
1090239398 11:125171499-125171521 CAGTTACCCCATTTGTAAATTGG + Intronic
1090413866 11:126527541-126527563 CATTTTCCCATCTGGAAAATGGG - Intronic
1090622770 11:128576118-128576140 CAGTTTCCTCTCTGGGCAAAGGG - Intronic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1090931402 11:131300957-131300979 CAGTTTCCTTATTGGGAAATGGG + Intergenic
1090963413 11:131577133-131577155 CAGTTTCCTCATTGGTAAACAGG + Intronic
1091089007 11:132751632-132751654 CAGTTTCCTCATTTGGAAAATGG - Intronic
1091407260 12:216948-216970 CAGTTTCCCGTCTGTAAAATGGG - Intergenic
1091678480 12:2509110-2509132 CCCTTTTCCCACTGGGAGATGGG + Intronic
1091696105 12:2629306-2629328 CCCTTTTCCCACTGGGAGATGGG + Intronic
1091770280 12:3146959-3146981 CAGTTTCCTCATCGGAAAATGGG + Intronic
1092182152 12:6453238-6453260 CAGTGTGCCCCCTTGGAAATCGG - Exonic
1093197154 12:16142929-16142951 AAGGTTCACCTCTGGGAAATGGG + Intergenic
1094160736 12:27387401-27387423 CCTTCTCCCCACTGGGATATGGG + Intronic
1094346897 12:29480300-29480322 CAATTTTCCCATTTGGAAATGGG - Intronic
1094474610 12:30831738-30831760 CACTTTCCCCACTGGGATGGGGG + Intergenic
1095947623 12:47762645-47762667 CAGTTTCCTCACTCGCAAATAGG - Intronic
1096281077 12:50254404-50254426 CAGTTTCCTCACTGTAAAAAAGG - Intronic
1096328309 12:50686101-50686123 CAGTTTCCTCACTTGTAAAATGG - Intronic
1097285026 12:57870456-57870478 CAGTTTCCCCACCAGTAAAATGG + Intergenic
1097721529 12:63026611-63026633 CAGTTTCCCCATTTGTAAAATGG + Intergenic
1097749648 12:63337642-63337664 CAGGTTCCCCTCTGGGACAATGG + Intergenic
1100008021 12:89917667-89917689 CAGTTACCTCACTTGTAAATTGG - Intergenic
1100289157 12:93197718-93197740 CACTTTCCCACCTAGGAAATGGG - Intergenic
1100586427 12:95984648-95984670 CAGTTTCCCCATTGCAAAATGGG + Intronic
1100865478 12:98852646-98852668 CAGTTTCCCCACCTGTAAACAGG - Intronic
1101071910 12:101084602-101084624 CAGTTTCTTCACTGGAAAAAGGG - Intronic
1101284397 12:103295524-103295546 CACTTTCCTCATTGGTAAATGGG + Intronic
1101411020 12:104468380-104468402 CAGTTTCCCCCCTTGTAAAATGG - Intronic
1101421713 12:104556223-104556245 CAGTTTCTCCTCTGTAAAATGGG - Intronic
1101513708 12:105415361-105415383 CAGTTTCCTCTCTGTAAAATGGG + Intergenic
1101584528 12:106073480-106073502 CAGTTTACCCACCAGAAAATGGG + Intronic
1101702977 12:107192893-107192915 CAGTTTTCCCACTGATAAAATGG + Intergenic
1101804564 12:108052131-108052153 AAGTTTCCTCACTGTAAAATGGG - Intergenic
1101820656 12:108181549-108181571 CATTTTCCCAACTTGTAAATGGG - Intronic
1101864923 12:108513792-108513814 CACTTTCCCCACTTGTAAAATGG - Intergenic
1101968212 12:109295049-109295071 CAGTTTCCCACCTGTAAAATGGG + Intronic
1102234122 12:111283583-111283605 CAGTTTCCCCATTAGTAAAAGGG - Intronic
1102306320 12:111807379-111807401 AAGTGTACCCACTGGGAAGTGGG - Intronic
1102410499 12:112713981-112714003 CAGTTTCCCCACCTGTAAAATGG + Intronic
1102413100 12:112737327-112737349 CAGTTTCCCCACTTGTAAAATGG + Intronic
1102458739 12:113087274-113087296 CAGTGTCCCCTCTGTGAAATGGG - Intronic
1102576488 12:113859179-113859201 TAGTTACCCCACAGGGAAGTGGG - Intronic
1102595742 12:113991323-113991345 CAGTTTCTCCACTGGTAAAATGG - Intergenic
1102640672 12:114363741-114363763 CAGTTTCCCCATTGATAAAGTGG + Intronic
1102850036 12:116233691-116233713 CAGTTTTCTCACTGTGAATTAGG - Intronic
1103170879 12:118818719-118818741 CAGTTTCCCTATTTGGAAAACGG + Intergenic
1103196497 12:119048165-119048187 CAGTGTCCCCACTGTAAAATAGG - Intronic
1103226769 12:119294599-119294621 CACTTGCCCCATTGGGAACTGGG - Intergenic
1103236035 12:119373406-119373428 CAGTTTCCTCATTTGCAAATAGG + Intronic
1103407421 12:120686205-120686227 CAGTTTCCCCATCGGAAAAATGG + Intergenic
1103700426 12:122846337-122846359 CAGTTTCCTCACCAGGAAAATGG + Intronic
1103881266 12:124167604-124167626 CAGTTTCCCCAACTGCAAATGGG + Intronic
1103912226 12:124358885-124358907 CATTTTCCCGTCTGTGAAATGGG - Intronic
1103938315 12:124488415-124488437 CAGTTTCTCCTCTTTGAAATGGG + Intronic
1103981865 12:124741977-124741999 CAGTTTCCCCTCTGTGGAATAGG + Intergenic
1104370030 12:128216250-128216272 CAGGTTCCCCTCTGTGAAATGGG + Intergenic
1104728770 12:131093843-131093865 CAGTTTCCCCGCTGTGACATGGG + Intronic
1105435996 13:20378870-20378892 CACGTTCCCCACTGGGACATGGG - Intergenic
1105978693 13:25496507-25496529 CAATTTCCTCACTGGCAAAAAGG + Intronic
1106271866 13:28162372-28162394 CAGTTTCCTCATTGGAAAAGTGG + Intronic
1106676126 13:31960268-31960290 CAGTTTCCTCATTGTGAAATGGG - Intergenic
1107094451 13:36519630-36519652 CCGTTTCCCCACTGAGAAGGTGG + Intergenic
1107378624 13:39831857-39831879 CACTTTCCCCACAGGAAAATGGG + Intergenic
1107704322 13:43084983-43085005 CAGTTTCCTCACTGTAAAACAGG - Intronic
1107734970 13:43389659-43389681 CAGTTTCCTCATTAGAAAATGGG - Intronic
1108305408 13:49127119-49127141 CGGTTCCCCCACTGGGATACTGG + Intronic
1108795950 13:54031417-54031439 CAGTATCTCCTCTGGGAATTGGG - Intergenic
1109939340 13:69339778-69339800 CATTTTTCTCACAGGGAAATAGG - Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1111217082 13:85158464-85158486 ATGTCCCCCCACTGGGAAATGGG - Intergenic
1111709497 13:91793747-91793769 CACCTTCCCCACAGGGCAATGGG + Intronic
1111877155 13:93911712-93911734 CTGTTTCCCCACTTGTAAAATGG + Intronic
1112050329 13:95639157-95639179 CAGTTTCTACTCTGTGAAATGGG - Intronic
1113166327 13:107447620-107447642 CTGCTTCCTCACTGTGAAATGGG - Intronic
1113796130 13:113059716-113059738 CAGCTTCTCCATTGGGAAAGTGG - Intronic
1114408491 14:22478538-22478560 CAGTTTCCTCACTTGTAAAGTGG - Intergenic
1115343535 14:32318118-32318140 TTTTTTCCCCTCTGGGAAATGGG - Intergenic
1117869665 14:60186949-60186971 CTGTTTCCCCAGTGGGAATGCGG - Intergenic
1118266141 14:64296280-64296302 CAATTTCCTCACTGGAAAAGTGG - Intronic
1118455571 14:65943223-65943245 CAGTTTCCCATCTGGAAAATGGG + Intergenic
1118490972 14:66259457-66259479 CAGTTTCCTCCCAGGGAAAATGG + Intergenic
1118704308 14:68466374-68466396 CAGTTTCCCCACCTGTAAAATGG - Intronic
1118729484 14:68656415-68656437 CAGTTACCCCATTGAGAAAAGGG - Intronic
1118732679 14:68679471-68679493 CAGTTTCCCATCTGTAAAATGGG + Intronic
1118794972 14:69134100-69134122 CAGTTTCCTCACTGGCAAAATGG - Intronic
1119182990 14:72616911-72616933 CAGTTTCCCCATCTGGAAAGCGG - Intergenic
1119399580 14:74353368-74353390 CAGTTTCCTCACCTGTAAATTGG + Intronic
1119622237 14:76139610-76139632 CAGTTTCCCATCTGTAAAATGGG + Intergenic
1119740467 14:77010756-77010778 CAGTTTCCCCACAAAGAAAATGG - Intergenic
1119760219 14:77145406-77145428 CAGTTTCCCCATAAGGAAAATGG - Intronic
1119919894 14:78437038-78437060 CAGTTTCCTCATTTGGAAAATGG + Intronic
1120707685 14:87761439-87761461 CAGTGTCCCCACTGGGGCACTGG + Intergenic
1121011797 14:90524227-90524249 CAGTTTCCCCAACGGGGAAGTGG - Intergenic
1121031564 14:90662650-90662672 TAGATTCCCCACTGTAAAATGGG + Intronic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1122217235 14:100212535-100212557 CAGGTTCCCCACTGGTGAAATGG + Intergenic
1122338004 14:101006509-101006531 CTGTTTCCCATCTGTGAAATGGG + Intergenic
1122604189 14:102937606-102937628 CAGTTTCCCCTGTGCGGAATGGG - Intronic
1122892562 14:104739566-104739588 CAGTCTCCCCACCTGCAAATGGG - Intronic
1124401651 15:29353807-29353829 CAGTCTCCCCACTGGTAACATGG - Intronic
1124430087 15:29599580-29599602 CAGTTTCCACATGAGGAAATAGG - Intergenic
1124642023 15:31401674-31401696 CAGTTTCCCCATTTGTAAAATGG - Intronic
1126121966 15:45261355-45261377 CAGTTTCCATACTGTAAAATGGG + Intronic
1126124418 15:45282626-45282648 CTGTTTCCCCAGTGGTAAACAGG + Intergenic
1126172903 15:45708967-45708989 CACTTTCTCCACTGTGAAATGGG - Intergenic
1126786326 15:52180136-52180158 CAGTTTGCCCGCTGGTAAAATGG - Intronic
1127662117 15:61109795-61109817 CAGTTTCCCCATCTGTAAATGGG + Intronic
1128302523 15:66575494-66575516 CAGTTTCCCCACTGGGTACACGG - Intergenic
1128340769 15:66821242-66821264 CAGCTTCCACCCTGGGAAATGGG + Intergenic
1128440001 15:67697972-67697994 CAGTCTCCTCACTGGTCAATGGG - Intronic
1129263490 15:74381966-74381988 CAGTTTGCCAACTGTAAAATGGG - Intergenic
1129264357 15:74386027-74386049 CAGTTGCCCATCTGAGAAATAGG - Intergenic
1129323476 15:74787446-74787468 CAGTTTCCCCATGGGAAAAATGG - Intronic
1129385465 15:75193822-75193844 CAGTTTCCTCATTGAGAAGTGGG - Intergenic
1129469277 15:75741471-75741493 CAGTTTCCTGATTGGGAAAATGG + Intergenic
1129512325 15:76133564-76133586 CAGTTTCCCCACCTGAAAAATGG - Intronic
1129524799 15:76206867-76206889 CAGTTTGTCCTCTAGGAAATGGG + Intronic
1129606810 15:77028973-77028995 CAGTTTCCTCTCTGTGACATGGG - Intronic
1129693996 15:77730323-77730345 CAGTTTTCCCATTGGGTAACAGG - Intronic
1130013434 15:80170038-80170060 CAGTGTCCCCTCTGAAAAATGGG - Intronic
1130156411 15:81354406-81354428 CTGTTTGCCCAGTGTGAAATAGG + Intronic
1130609034 15:85343891-85343913 CACTTTCCTCATTGGAAAATAGG + Intergenic
1130885366 15:88088175-88088197 CAGTTTCCCCACCTGTAAAATGG + Intronic
1131760425 15:95616736-95616758 CATTCTCCCCACAGGGTAATAGG - Intergenic
1132599077 16:765926-765948 CAGTTTACCCACTGGCAAACAGG - Intronic
1132871373 16:2117143-2117165 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1133583547 16:7169613-7169635 CTGTTTCTTCACTGGTAAATGGG - Intronic
1133973222 16:10581420-10581442 CAGTTTCCCCATCTGGAAACTGG + Intergenic
1134131138 16:11651018-11651040 CAGTTTCCCCACCTGGGAAGTGG - Intergenic
1134308509 16:13055201-13055223 CAGTTTCCCCACCTGTAAAATGG - Intronic
1134410595 16:14000472-14000494 GCTTTTCCCAACTGGGAAATGGG - Intergenic
1134412238 16:14012666-14012688 CATTTTCTCATCTGGGAAATGGG - Intergenic
1134455542 16:14392757-14392779 CATTTTCCCCTCTCTGAAATGGG - Intergenic
1134521154 16:14919751-14919773 CAGTTTCCCCATCTGGAAAGGGG + Intronic
1134550417 16:15136221-15136243 CAGTTTCCCCATCTGGAAAGGGG - Intronic
1134694306 16:16211909-16211931 CAGTTTTCCCTCTGTAAAATGGG - Intronic
1134708830 16:16318402-16318424 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134716041 16:16358436-16358458 CAGTTTCCCCATCTGGAAAGGGG + Intergenic
1134822735 16:17259665-17259687 CAGTTTCCCCATCTGGAAATAGG + Intronic
1134892252 16:17851472-17851494 CTGTTTACCCACCTGGAAATGGG + Intergenic
1134950775 16:18350243-18350265 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1134958715 16:18393723-18393745 CAGTTTCCCCATCTGGAAAGGGG - Intergenic
1134977528 16:18582721-18582743 CAGTTTTCCCTCTGTAAAATGGG + Intergenic
1135323582 16:21512415-21512437 CAGTTTCCCCAGCTGTAAATTGG + Intergenic
1135341047 16:21648311-21648333 CAGTTTCCTCATTAGAAAATGGG + Intronic
1135404052 16:22185454-22185476 CTGTTAGCCCACTGGGAACTGGG - Intronic
1135545013 16:23359778-23359800 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1135669641 16:24364128-24364150 CAGTTTCCTCATTGGTAAAGTGG - Intergenic
1135742823 16:24991197-24991219 CATTTCCTCCACTGTGAAATAGG + Intronic
1135905807 16:26510758-26510780 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1135962557 16:27009849-27009871 CGGTTTTGCCACTGGGAAAGTGG + Intergenic
1136060294 16:27721710-27721732 CTGGTTCCCCACTGGGCACTGGG + Intronic
1136089616 16:27909064-27909086 GAGTTTCCCCACCTGAAAATGGG + Intronic
1136156039 16:28382888-28382910 CAGTTTCTCCACTGGGAAAAAGG + Intronic
1136207047 16:28732400-28732422 CAGTTTCTCCACTGGGAAAAAGG - Intronic
1136404278 16:30034831-30034853 CAGATCCCTCACTGGTAAATGGG - Intronic
1136418713 16:30118778-30118800 CAGTTTCCCTACCGGGGAAACGG + Intronic
1136611058 16:31365482-31365504 CAGTTTTCTCACTGGTAAAATGG + Intronic
1137327695 16:47458713-47458735 CTTTTTCCCCACTGCAAAATAGG + Intronic
1137454683 16:48609562-48609584 CAGTTTCCCCATTTGTAAAGTGG - Intronic
1137668486 16:50265884-50265906 CAGTTTCCCCACTGGGATCATGG - Intronic
1137707837 16:50548028-50548050 CAGTTTCCCCACCTGTAAATTGG + Intergenic
1137719548 16:50620032-50620054 CAGTTTCCCCATCTGGAAAATGG + Intronic
1138250900 16:55501161-55501183 CAGTTTCCACACTTGGGAAAAGG - Intronic
1138441344 16:57036824-57036846 CGGTTTCCCCTCTGTAAAATGGG + Intronic
1138728970 16:59173685-59173707 CTGTTTCCCCACTGTGAGCTGGG - Intergenic
1138731684 16:59202121-59202143 CAGTTTCTCATCTGTGAAATGGG - Intergenic
1139209112 16:65058794-65058816 CAGTTTCCTCACTATAAAATGGG + Intronic
1139494716 16:67308003-67308025 CAGGTTCCTCACTGGCAAAGTGG + Intronic
1139706414 16:68743852-68743874 CAGTTTCCCCACCTGTAAAATGG + Intronic
1140519989 16:75572612-75572634 CAGTTTCTCCACTGGAGAAGTGG + Intronic
1141127123 16:81408717-81408739 CAGTTTCCCCACCTGAAAAATGG - Intergenic
1141284192 16:82655794-82655816 CAGTTTCCCCATTGTTAAAATGG - Intronic
1141350418 16:83289733-83289755 CAGTTTTCTCACTTTGAAATGGG + Intronic
1141353187 16:83317843-83317865 CAGTTTCCCCACTTGGGAGTGGG - Intronic
1141353211 16:83318044-83318066 CAGTTTTCCCTCTGTGAAGTAGG + Intronic
1141573336 16:84948005-84948027 CAGTTTCCCCCTTTGTAAATGGG - Intergenic
1141668631 16:85479843-85479865 CAGTTTCCCCACTCTGTACTAGG - Intergenic
1141672953 16:85502425-85502447 CAGTTTCCCCATTGGTAAAATGG - Intergenic
1141688967 16:85585949-85585971 CAGTTCCCTCACTTGTAAATGGG + Intergenic
1142035787 16:87861503-87861525 CAGTTTCCCCAGCTGTAAATTGG + Intronic
1142125700 16:88409230-88409252 CAGTTTCCCCACCTGCAAAGAGG + Intergenic
1142230417 16:88897615-88897637 CAGTTTCCCCACCTGTAAAATGG - Intronic
1142470961 17:163037-163059 CAGGTTCCCCACTGTGGAAAGGG + Intronic
1142486579 17:251394-251416 CAGTTTCCCCACCTGAAAAGTGG - Intronic
1142910251 17:3083217-3083239 CAGTTTCTACAGTGGGAAAAGGG - Intergenic
1143001219 17:3796459-3796481 CCGTCTCCCCTCTGGGACATGGG + Intronic
1143028403 17:3954010-3954032 CAGTTTCCCTTCTGTGAAGTGGG - Intronic
1143030510 17:3964573-3964595 CAGTTTCCCCTCTGCAGAATGGG - Intergenic
1143032985 17:3978020-3978042 CAGTTTTCTCACTGTGAAGTGGG + Intergenic
1143248377 17:5504264-5504286 CAGTTTCCTCATTGGAACATTGG - Intronic
1143475391 17:7200212-7200234 TTGTTTCCCTACTGGGAACTTGG - Intronic
1143897884 17:10150967-10150989 CAGTTTCCCCACCTGTAAAATGG + Intronic
1144136329 17:12298506-12298528 CAGTTTCCTCATTGGCAAAATGG + Intergenic
1144254412 17:13452186-13452208 CAGTTTCCCAACTAGGAGAATGG + Intergenic
1144774392 17:17777735-17777757 CAGTTTCCCCACTGGCACAGTGG - Intronic
1144961400 17:19046093-19046115 CAGTTTCCCCACTGGAGCAATGG - Intronic
1144973760 17:19128431-19128453 CAGTTTCCCCACTGGAGCAATGG + Intronic
1145899897 17:28483731-28483753 CAGTTTCCTCATCTGGAAATGGG - Intronic
1146298889 17:31672792-31672814 CAGTTTCCTCACCTGAAAATCGG + Intergenic
1146506679 17:33411801-33411823 CAGCTTCCTCATTGTGAAATTGG + Intronic
1146551702 17:33785994-33786016 CAGTTTCCACACTGGGAGAATGG - Intronic
1146567071 17:33922699-33922721 CAGTTTTCACAGTGGAAAATGGG - Intronic
1146920481 17:36706855-36706877 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1146931729 17:36782655-36782677 CAGTTTCCCCACATGCAAAAGGG + Intergenic
1147165801 17:38592591-38592613 CAGTTTCCCCAATGGCAAAATGG + Intronic
1147245221 17:39115789-39115811 CAGTTTCCCCACTGAGAAAATGG - Intronic
1147248905 17:39140737-39140759 CCCTGACCCCACTGGGAAATAGG - Intronic
1147561318 17:41511124-41511146 CAGTTTCCCCACTTTTCAATTGG - Intergenic
1147568427 17:41552038-41552060 CAGTTTCCCATCTGGGAAGCTGG + Intergenic
1148123789 17:45226576-45226598 CAGTTTCCCATTTGTGAAATAGG + Intronic
1148328213 17:46796409-46796431 CAGTTTCCCCACTGAGATAGGGG - Intronic
1148542851 17:48493697-48493719 CAGTTTCCATACTGGGAGAAGGG - Intergenic
1148644679 17:49212645-49212667 CAGCTTCCTCACTGTGAAGTGGG - Intronic
1149010872 17:51854916-51854938 CATTTTCTCCTCTGTGAAATTGG - Intronic
1149033968 17:52114431-52114453 CAGTTTGCCCAGTTGTAAATGGG + Intronic
1149138007 17:53393592-53393614 CAGCTTTCCCTCTGGGAATTTGG - Intergenic
1149579533 17:57739650-57739672 CTGTTTTCCCACTTGCAAATTGG - Intergenic
1149876218 17:60235797-60235819 CAGGTTCCCCACAGGTAAAATGG + Intronic
1150007369 17:61478183-61478205 CAGTTTCCACATTTGTAAATGGG - Intronic
1150007698 17:61479806-61479828 CAGTTTCCACATTTGTAAATGGG - Intronic
1150535637 17:66036665-66036687 CAGTTGCCCTACTGGTAAACTGG + Intronic
1150702056 17:67456074-67456096 CAGTTTCCTCACTTGTAAAATGG - Intronic
1151336798 17:73444628-73444650 CAGTTTCCCCATCTGTAAATTGG - Intronic
1151431003 17:74063169-74063191 CAGTTTTCTCACCTGGAAATGGG + Intergenic
1151638335 17:75368995-75369017 CAATTTCCTCACTGGAAAAATGG - Intronic
1151901820 17:77020995-77021017 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1151956741 17:77383880-77383902 CAGTTTCCCATCTGTGCAATGGG + Intronic
1152389281 17:79993108-79993130 CAGTTTCCCCTCTGCACAATGGG - Intronic
1152700866 17:81818385-81818407 CTGTTTCCTCACTTGTAAATTGG + Intergenic
1152741938 17:82022276-82022298 CAGTTTCTCCACTGGCAGGTGGG + Intronic
1153000633 18:452327-452349 CAGTTTCCTCACTGATAAAATGG + Intronic
1153969385 18:10211774-10211796 CAGTTTTCCCACTGCGGAAGAGG + Intergenic
1154044950 18:10895650-10895672 CAGTTTAACACCTGGGAAATGGG + Intronic
1154290288 18:13100896-13100918 CAGTTTCCCCATTTGTAAAATGG + Intronic
1155068992 18:22296572-22296594 CATCTTCCACACTGAGAAATAGG + Intergenic
1155216464 18:23647755-23647777 CAGTTTTCCCACTGTGATGTAGG + Intronic
1155244735 18:23896599-23896621 CTATTTCCCCTCAGGGAAATAGG - Intronic
1156016358 18:32551343-32551365 CAGTTTCTTCACTGTAAAATGGG + Intergenic
1156019369 18:32582008-32582030 CAGTTTCCCCAGAGGTAAAATGG - Intergenic
1156830463 18:41485199-41485221 CAGTTTACCCACTTGTAAAATGG - Intergenic
1156894779 18:42233272-42233294 CAGTTTCCTCAGTTGTAAATTGG + Intergenic
1156985410 18:43345220-43345242 CACTTTCAACACTGGGAATTAGG + Intergenic
1157480972 18:48053589-48053611 CAGTTTCCCTACTTGAAAAATGG - Intronic
1157488824 18:48108152-48108174 CAGTTTCCTCCCTGTAAAATAGG - Intronic
1157491530 18:48127127-48127149 CAGTTTCCCCATTTGCAAAATGG - Intronic
1157496911 18:48162697-48162719 AAGTTCCCCCACAGGAAAATAGG + Intronic
1157817361 18:50739569-50739591 CAGTTTCCTCATTGGTAAAATGG - Intergenic
1157847908 18:51020656-51020678 CAGTTTCATCACTTGTAAATTGG + Intronic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1158410311 18:57199366-57199388 CAGTTTCCTCTCTTGGAAAATGG + Intergenic
1159430268 18:68342881-68342903 CAATTTCCTCCCTTGGAAATTGG - Intergenic
1160691227 19:461368-461390 CAGTTTCCCCACTAGGAAATAGG - Intergenic
1160691261 19:461489-461511 CAGTTTCCCCACTAAGAAATAGG - Intergenic
1160875250 19:1293798-1293820 CAGTTTCCCCACTAGGGATCCGG - Intronic
1160915407 19:1494157-1494179 CAGTTTCCCCCTTGGTAAGTGGG - Intronic
1160943620 19:1631176-1631198 CAGTTTCCCCACTGTGGGAAAGG - Intronic
1161196627 19:2990029-2990051 CAGTTTCCCCACCTGGACACAGG + Intronic
1161201224 19:3015873-3015895 AAGCTTCCCATCTGGGAAATGGG + Intronic
1161225600 19:3143795-3143817 GAGTTTCCCCACATGGAAACAGG + Intronic
1161428980 19:4219860-4219882 CAGTTTCCCTTCTGGAAAATGGG - Intronic
1161437502 19:4272714-4272736 CTGTTTCCTCATTGGGGAATGGG - Intergenic
1161625114 19:5322016-5322038 CAGTTTACCCAAATGGAAATGGG - Intronic
1161643024 19:5436148-5436170 CAGTTTTCCCTGTGTGAAATGGG - Intergenic
1161662997 19:5558796-5558818 CAGTTTCCCAACCTGGAAAATGG + Intergenic
1161702556 19:5803564-5803586 CAGTTTCCCCACTTGTAACAGGG - Intergenic
1162138480 19:8570898-8570920 CAGTTTCCTCATTCGGAAAATGG + Intronic
1162312689 19:9916480-9916502 CAGTTTCCTCACCTGGAAATAGG - Intronic
1162380814 19:10330635-10330657 CAGTTTCCTCATTGGTAAAATGG - Intronic
1162389290 19:10379678-10379700 CAGTTTCCCCATCTGGAAAAGGG + Exonic
1162397933 19:10428666-10428688 CAGTTTCCCCAGTTGTAAAATGG - Intronic
1162522383 19:11189312-11189334 CAGTTTCCTCATTTGCAAATCGG - Intronic
1162532690 19:11245030-11245052 CAGTTTCCCCATCTGGAAAATGG + Intronic
1162731925 19:12723473-12723495 CAGTTTCCCCACTTGTCAAATGG + Intronic
1162835322 19:13313190-13313212 CAGTTTCCCCTCTGTTAAAAAGG + Intronic
1162851623 19:13435455-13435477 CAGTTTCCCCATCTGAAAATTGG - Intronic
1162921123 19:13903793-13903815 CAGTTTCCCCTTTTGTAAATTGG - Intronic
1162922717 19:13913009-13913031 CATTCCCTCCACTGGGAAATGGG + Intronic
1163098662 19:15080007-15080029 CATTTCCCCCCCTGGGAAATTGG - Intergenic
1163168905 19:15517301-15517323 CAGTTTCTCCACTACAAAATGGG - Intronic
1163286446 19:16351417-16351439 CAGTTTTCCCTCAGGAAAATGGG + Intergenic
1163566082 19:18052111-18052133 CAGTTTCCCCACCTGGAAAGCGG + Intergenic
1163615137 19:18322744-18322766 CAGTTTCCCCACCTGCAAACTGG + Intronic
1163625416 19:18386674-18386696 CAGTTTCCCCATTTGCAACTTGG - Intronic
1163665550 19:18602277-18602299 CAGTTTCCCCATCTGGAAAGTGG + Intronic
1163667830 19:18611484-18611506 AAGTTTCCCACCTGTGAAATGGG + Intronic
1163736891 19:18987261-18987283 CAGTTTTTCCATTGGGAAATGGG + Intergenic
1163773716 19:19205860-19205882 CAGTTTCTCATCTGTGAAATGGG + Intergenic
1163774748 19:19211693-19211715 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1163775435 19:19214629-19214651 CAGTTTCCCCACCTGTAAAATGG - Intronic
1163823727 19:19511182-19511204 CAGACTCCCCACTTGGAAAATGG - Intergenic
1164011007 19:21203472-21203494 CAGTTGCCTCTCTGGGTAATGGG + Intergenic
1164475463 19:28572535-28572557 CAGTTTCACCATGGGGAAAATGG + Intergenic
1164828146 19:31299316-31299338 CAGTCTCCCCACTTGAAAAATGG + Intronic
1164830470 19:31316240-31316262 CAGATTTCCCCCTGGAAAATGGG - Intronic
1165119825 19:33551932-33551954 CAGTTTCCCCATTGGTAACTGGG + Intergenic
1165780813 19:38433441-38433463 CAGTCTGCCCTCTGTGAAATGGG + Intergenic
1165781963 19:38440118-38440140 CAGTTTCCCCATTTTAAAATGGG + Intronic
1165803486 19:38566739-38566761 CAGTTTCCCCTCTGTAAAACGGG + Intronic
1165805171 19:38576093-38576115 CAGTTTCCCCATGGGGAGATGGG + Intronic
1165824299 19:38697016-38697038 CAGTTTCCTCACTGATAAACAGG - Intronic
1165838055 19:38771221-38771243 CAGTTTCCTCACTGGGAAAATGG + Intronic
1165841510 19:38791476-38791498 CAGTTTCCTCACTGGGAAAATGG - Intronic
1165896755 19:39145983-39146005 CAGTTTCCCCATTTGTAAAATGG + Intronic
1166100483 19:40568605-40568627 CAGTTTGCCCACTGGGCTAATGG + Intronic
1166141986 19:40810173-40810195 TAGTTTCCCTACAGGGAGATTGG + Intronic
1166156129 19:40912593-40912615 TGGTTTCCCCAGTGGTAAATGGG + Intergenic
1166175755 19:41068355-41068377 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1166187009 19:41146797-41146819 CAGTTTCCCCAGTGGTAAAATGG - Intergenic
1166255822 19:41603790-41603812 CAGTTTCCCCTCAGTAAAATAGG - Intronic
1166568415 19:43779086-43779108 CAGTTTCCCCATCTGTAAATTGG - Intronic
1166645335 19:44527441-44527463 CAGTTTCCCCATTTGAAAAATGG + Intronic
1166674910 19:44734496-44734518 CAGTTTCCCCATTTGGATAATGG - Intergenic
1166678294 19:44753000-44753022 CAGTTTCCCTATTTGGAAACTGG + Intronic
1166902618 19:46077400-46077422 CATTTTCACCACAGGGAACTTGG + Intergenic
1166943690 19:46384260-46384282 CAGTTTCCCCATTTGCAAAGAGG + Intronic
1167052795 19:47089928-47089950 CAGTTTCTCCTCTGGGGCATCGG - Intronic
1167095349 19:47372508-47372530 CAGTTTCCCCATTTGTAGATTGG - Intronic
1167339232 19:48905035-48905057 CAGTTTCCCCACCTGTAAAATGG + Intronic
1167516039 19:49923735-49923757 CAGTTTCCCCTCCGTAAAATGGG - Intronic
1167630711 19:50624960-50624982 CAATTTACCCACTAGGAAATGGG - Intronic
1168107497 19:54173565-54173587 CAGTTTCCCCTTTGTGAAATGGG + Exonic
1168386045 19:55963968-55963990 CAGTTTCTCATCTGTGAAATAGG - Intronic
925108723 2:1315129-1315151 CAGTTTCCTCACTGTGAACGTGG + Intronic
925383508 2:3445628-3445650 CAGTTTCCCCATCTGTAAATTGG - Intronic
925875729 2:8309758-8309780 CAGTTTCCTCACATGAAAATGGG + Intergenic
925882464 2:8364363-8364385 CAGATTCCCAAGTGAGAAATGGG - Intergenic
925910908 2:8573140-8573162 CAGTTTCCTCACTGGTAAAATGG + Intergenic
925920311 2:8633542-8633564 CAGTTTCCCCATTGGAAAAGAGG + Intergenic
926064273 2:9824557-9824579 CAGTGTCCCCTCTGAGGAATGGG + Intergenic
926093024 2:10062764-10062786 CAGTTTACTCACTAGGAAAATGG + Intronic
926695399 2:15767072-15767094 CAGTTTCCCCAAGTGTAAATGGG + Intergenic
926937685 2:18102983-18103005 CAATTTCCACACTGGAAAATGGG - Intronic
927580803 2:24244796-24244818 AAGTTTCCCAACTTGGAGATGGG - Intronic
928317091 2:30254959-30254981 CAGTTTTCCATCTGTGAAATGGG + Intronic
928450723 2:31375886-31375908 CAGTTTTCTCATTGGTAAATGGG - Intronic
929358412 2:41053880-41053902 CAGTTTCCCATCTGAAAAATAGG - Intergenic
929714198 2:44293859-44293881 CAGTTTCCTCACTGGTAAAGGGG + Intronic
929814811 2:45222169-45222191 CAGTTTCTCATCTGTGAAATGGG - Intergenic
929996053 2:46826818-46826840 CAGTTTTCCTACTGGTAAAATGG + Intronic
930383364 2:50660087-50660109 CACTTTACCCACTGGGGACTTGG + Intronic
931692358 2:64846028-64846050 CAGTTTCCCCACTTGTAAAATGG + Intergenic
932335173 2:70926858-70926880 CAGTTTCCCCACCAGTAAAATGG - Intronic
932420814 2:71600263-71600285 CAGTTTCCCCATTTGCAAAGTGG + Intronic
932694678 2:73945497-73945519 GATTTTCCCCTCTGGAAAATGGG + Intronic
933385256 2:81602405-81602427 CAGTTTCCCCATTTGTAAAATGG + Intergenic
933752587 2:85612429-85612451 CAGTTTCCTCATTAGTAAATGGG + Intronic
933777460 2:85779632-85779654 CAGTTTCCTCACTGGCAAACAGG - Intronic
933851054 2:86366973-86366995 CGGTGTCCCCATTGTGAAATGGG + Intergenic
933892229 2:86782492-86782514 CAGTTTCCCCACTTATAAAATGG - Intergenic
934603991 2:95680653-95680675 CAGTTTCTCAACTGGAAAATGGG - Intergenic
935188385 2:100755342-100755364 CAGTTTCCCCTCTATCAAATGGG - Intergenic
935508880 2:103946081-103946103 CAATTTCCTTACTGTGAAATGGG - Intergenic
935571300 2:104662923-104662945 CAGTTTCCCCATGGGCAAAATGG + Intergenic
935894369 2:107718904-107718926 CAGTTTCCTCATTTGGAAAATGG - Intergenic
935979511 2:108613083-108613105 CAGTTTCCCCATCTGTAAATGGG + Intronic
936024248 2:109019184-109019206 CAGTTTCCCCATTTGAAAATGGG + Intergenic
936165491 2:110116242-110116264 CAGTCTCCTCACTTGGAAAAGGG - Exonic
936373818 2:111924299-111924321 CAGTTTGCTCACAGGGAAAGTGG - Intronic
936587090 2:113767684-113767706 CAGTATCCCCACAGGGATTTGGG + Intergenic
936822059 2:116534199-116534221 CAGTTTCCCCATCTGTAAATTGG + Intergenic
936924991 2:117727692-117727714 CAGTTTCCACATTTGTAAATTGG + Intergenic
937343287 2:121105523-121105545 CATTTTCTCATCTGGGAAATGGG - Intergenic
937876833 2:126832359-126832381 CAGTTTCCCCACCTGTAAAGTGG + Intergenic
939182779 2:138823688-138823710 CAGTTTCTACAGTGGGAAAGGGG + Intergenic
939411352 2:141828971-141828993 CAGTTGCCTAACTGGGAACTGGG + Intronic
939570321 2:143832891-143832913 CAGTTTCCCCACTCACAAAATGG - Intergenic
940884691 2:158978669-158978691 GAGCATCCCCACTGGGAGATGGG + Intronic
941049851 2:160720672-160720694 CAGTTTCCCCACCTGTAAAATGG + Intergenic
941459377 2:165750307-165750329 CAGTTTTCTCACTAGAAAATGGG + Intronic
941548726 2:166888016-166888038 TAGTTTCCTCACTTGAAAATTGG - Intergenic
941595318 2:167469282-167469304 CAGTTTCTCATCTGTGAAATGGG + Intergenic
941858025 2:170250402-170250424 CAGTTCAGCCACTGTGAAATGGG + Intronic
942136471 2:172931098-172931120 CAGTTTCCTCACTGGTATAATGG + Intronic
943586231 2:189743873-189743895 CTGTTTCCACCCTGGGAATTTGG - Intronic
943621557 2:190153498-190153520 GTGTTTCTCCACTAGGAAATGGG + Intronic
943718687 2:191180041-191180063 GAGTTTCCACCCTGGGAACTAGG + Intergenic
944897607 2:204181041-204181063 CATTTTACACACAGGGAAATAGG + Intergenic
945869763 2:215214365-215214387 CTGTTTCCCTACAGGGAAAGGGG - Intergenic
946131296 2:217609054-217609076 CATTTTCCCGTCTGGAAAATAGG - Intronic
946179049 2:217939171-217939193 CAGTTTCCTCACTATCAAATGGG - Intronic
946366519 2:219252453-219252475 CAGATTCCCCACTGAGAAGTGGG - Intronic
946401379 2:219470220-219470242 CAGTTTCCCCATCTGTAAATGGG - Intronic
946928452 2:224648676-224648698 CAGTTTCCTCATTCGGAAATTGG - Intergenic
947804838 2:232959184-232959206 CAGTTTTCCCCTTGAGAAATTGG + Intronic
947816573 2:233041415-233041437 CAGCTGCCCCACAGGGACATGGG + Intergenic
948454557 2:238098704-238098726 CACCCTCCCCACTGGGAACTGGG + Exonic
948754425 2:240150716-240150738 GAGTTACCCCAGTGGGAAAACGG - Intergenic
1168984769 20:2038719-2038741 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1169034412 20:2437890-2437912 CAGTTTCCTCATTTGGAAAGAGG - Intergenic
1169247700 20:4036760-4036782 CAGTTTCCTCATTTGTAAATGGG - Intergenic
1169318423 20:4611700-4611722 CAGTTTCCCACCTGCAAAATGGG + Intergenic
1169400276 20:5273830-5273852 CACTTTCCCCTCTGAGGAATGGG + Intergenic
1170125578 20:12959820-12959842 CAGGATCCCAAATGGGAAATAGG + Intergenic
1170309575 20:14977580-14977602 CAGTTTCCTCAGCTGGAAATTGG + Intronic
1170666980 20:18394847-18394869 CAGTTTCCTCACCTGGAAAGTGG + Intronic
1171153098 20:22844932-22844954 CAGTTTCCTCACTCGTAAGTGGG + Intergenic
1172000738 20:31774583-31774605 AGTTTTCCCCACTGTGAAATGGG - Intronic
1172125520 20:32623132-32623154 CAGTTTCCCCACCTGTCAATGGG - Intergenic
1172689772 20:36782440-36782462 CAGTTTCCTCACAGCAAAATGGG + Exonic
1173223683 20:41148950-41148972 CAATTTCCTCACTCGGGAATTGG + Intronic
1173224752 20:41155852-41155874 CAGTTTCCCCATCAGGAAACTGG - Intronic
1173245807 20:41336645-41336667 CAGTTTCTTCACTGGTAAAATGG + Intergenic
1173357261 20:42305747-42305769 CAGTTTCCCCTCTGTCAAACAGG - Intronic
1173599224 20:44280829-44280851 CATTTTTCCCTCTGGGAAATTGG - Intronic
1173817953 20:46002038-46002060 CAGTTTCCTCATCTGGAAATGGG + Intergenic
1173839488 20:46148056-46148078 CAGTTTCTCCACCGGTAAAATGG + Intergenic
1173958617 20:47053973-47053995 CAGTTTCCCCATTTGTAAAATGG + Intronic
1174268675 20:49350920-49350942 CAGTTTCCCATCTGGAAAAATGG + Intergenic
1174300601 20:49579573-49579595 CAGTTTCCTCACCTGGAAAGTGG - Intergenic
1174345098 20:49923246-49923268 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1174362545 20:50038034-50038056 CTGTCTCCCCACTGGAAAGTGGG + Intergenic
1174391572 20:50221202-50221224 CAGTTTCCCCATTTGTAAAGTGG + Intergenic
1174546584 20:51330454-51330476 CAGTTTTACCACTTGGAAAATGG - Intergenic
1174546851 20:51332045-51332067 CAGTTTTTCCACTTGGAAAATGG - Intergenic
1174550155 20:51356350-51356372 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1175257787 20:57657430-57657452 CAGTTTCTCCTCTGGAAAGTGGG + Intronic
1175286565 20:57840678-57840700 CAGTTTCCCACCTATGAAATGGG - Intergenic
1175304465 20:57966444-57966466 CAGTTTCCCCACCTGTAAGTTGG + Intergenic
1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG + Intergenic
1175682267 20:60998003-60998025 CAGTTTTCTCATTGGAAAATGGG - Intergenic
1175726035 20:61319241-61319263 CAGTTTCCCCACCTGTAAAATGG - Intronic
1175726454 20:61321981-61322003 CAGTTTCCCCACCTGTAAAATGG - Intronic
1175788792 20:61728593-61728615 CAGTTTCCTCTTTGGGAAAATGG + Intronic
1175952813 20:62592449-62592471 CAGTTTCCTCACTAGGATATAGG + Intergenic
1175967376 20:62666282-62666304 CAGTTTCCCCACCTGTAAAGTGG + Intronic
1175970458 20:62684243-62684265 CAGTTTCTCCCCTCTGAAATGGG + Intronic
1176000255 20:62828450-62828472 CAGTTTCCCCACCGTAAAATGGG + Intronic
1178099168 21:29247842-29247864 CATTTTCCAAACTGGGAAACTGG + Intronic
1178282989 21:31299794-31299816 CGGTTTCCTCACTGGTAAAATGG + Intronic
1178308893 21:31513280-31513302 CAGTTTCCCCACCTGTAAAATGG - Intronic
1178362759 21:31963231-31963253 CAATTTCCTCACTGGTAAACAGG - Intronic
1178584789 21:33862797-33862819 GAGTTTCCCCAATAGGAAATGGG + Intronic
1178872915 21:36390963-36390985 CAGTTTCCTCACCTGTAAATGGG - Intronic
1179207551 21:39296664-39296686 CAGTTACCTCACTTGTAAATTGG - Intronic
1179508118 21:41855232-41855254 CAGATGGCCCACTGGGAACTGGG + Intronic
1179730884 21:43366829-43366851 GAGTGTCCTCGCTGGGAAATGGG + Intergenic
1179982847 21:44905547-44905569 CAGTTTCCTCACTGTGAAGTGGG + Intronic
1180157283 21:45983759-45983781 CAGTTTCCCACCTGTGAAATGGG + Intronic
1180991766 22:19941497-19941519 CAGTTTCCCCACCTGGGAAGGGG + Intronic
1181006792 22:20017302-20017324 CTGTTTCCCAACTGTAAAATGGG - Intronic
1181040019 22:20187726-20187748 CAGTTTACCCTCTGGGAAGAGGG - Intergenic
1181449605 22:23010488-23010510 CAGTTCCACCACTGGAAAAAGGG - Intergenic
1181529785 22:23510859-23510881 CAGTTTCCCCATTGGTAAAATGG + Intergenic
1181682023 22:24501888-24501910 CAGTTTCCTCACCTGGTAATGGG - Intronic
1181804665 22:25367493-25367515 CAGTTTCCCCATTGGTAAAAGGG - Intronic
1181849736 22:25741623-25741645 CAATTTCCCCACTTGTAAAGTGG + Intergenic
1181986798 22:26805480-26805502 CAGTTTCCCCATGCAGAAATGGG + Intergenic
1182062183 22:27406185-27406207 CAGTTTCCCCACCTGGAAGGAGG - Intergenic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1182282085 22:29223767-29223789 CAGTTTCCCTACCTGGAAAGTGG + Intronic
1182316178 22:29448862-29448884 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1182353046 22:29709559-29709581 CAGTTTCCCCATCTGGCAATGGG + Intergenic
1182423222 22:30258413-30258435 CAGTTTCCCCTCTGTACAATGGG - Intergenic
1182602529 22:31477762-31477784 CATTTTCTTCACTGAGAAATGGG + Intronic
1182659765 22:31917031-31917053 CAGTTTCTCCTCTGAGAAGTGGG - Intergenic
1182747808 22:32618933-32618955 CAGTTTACCCACTGGTAAAATGG + Intronic
1183095230 22:35547957-35547979 CAGTTTCCCCACTTGTAAAAAGG - Intronic
1183100491 22:35580747-35580769 CAGTTTCCTCACCTGGAAAATGG + Intergenic
1183225765 22:36548921-36548943 CAGAATCCCCACTGGGCACTGGG - Intergenic
1183263060 22:36808491-36808513 CAGTTTCTCCACTTGCAAAATGG + Intronic
1183317943 22:37147236-37147258 CCGTTTCCTCATTGGAAAATGGG - Intronic
1183349229 22:37325328-37325350 CAGTTTCCCCACCTGTAAAGTGG - Intergenic
1183352795 22:37343361-37343383 CAGTTTCCCCACCTAGAGATGGG + Intergenic
1183690183 22:39383809-39383831 CAGTTTCCCTTCTGTTAAATGGG - Exonic
1183748308 22:39704798-39704820 CAGGTGCCCCACTGTGCAATGGG - Intergenic
1183971280 22:41479405-41479427 CAGTTTCATCACTGTGAAACAGG - Intronic
1184019735 22:41813011-41813033 CAGTTTCCCATCTGTAAAATGGG + Intronic
1184263594 22:43333817-43333839 CAGTTTCCTCACTTGAAAAATGG + Intronic
1184566212 22:45293636-45293658 CAGTTTCCCCATCTGGAAAATGG + Intronic
1184596216 22:45515796-45515818 CAGCTTCCCCAGTGGGAAAACGG - Intronic
1184606608 22:45578055-45578077 CAGTTTCCCCATTGTGAACTGGG + Intronic
1184645517 22:45892682-45892704 CAGTTTCCCCACTTGTAAAATGG - Intergenic
1184689537 22:46111154-46111176 CAGTTTCTCCACTATGAAGTGGG + Intronic
1184767321 22:46578429-46578451 CAGTTTCCTCACTAGCAAGTGGG + Intronic
949112205 3:275125-275147 CAGTTTCATCACTAGTAAATAGG - Intronic
949554049 3:5137146-5137168 CAGTTTCCTCATTGGGGATTTGG + Intronic
949876892 3:8632192-8632214 CAGTTTCCCCACTGAGCCCTGGG - Intronic
949909460 3:8889323-8889345 CAGTTTCCTCACTGTAAAACAGG + Intronic
950107088 3:10395052-10395074 CAGTTTCCCCAGCTGCAAATTGG + Intronic
950668533 3:14511649-14511671 CAGTTTCCCCCCTGTAAAATGGG + Intronic
950672236 3:14534248-14534270 CATTTTCCCCTCTGTAAAATGGG + Intronic
950898849 3:16478334-16478356 CAGTTTCCTTATTGGGAGATGGG - Intronic
951419507 3:22467632-22467654 CAGTTTCCTCAATGGCAAATGGG - Intergenic
952596316 3:35022986-35023008 CAATTTACCCTCTGGAAAATGGG - Intergenic
952758221 3:36890951-36890973 CAGTTTCCTCACTTGAAACTGGG + Intronic
952838210 3:37622438-37622460 CAGTTTATTCTCTGGGAAATAGG + Intronic
952965624 3:38619340-38619362 CAGTTTTCCCACTTGTAAAATGG + Intronic
952988508 3:38810058-38810080 GAAGTTCCCCACTGGGAACTTGG + Intergenic
953356550 3:42260980-42261002 CAGCTTCCACACTGGCAAAATGG + Intronic
953692810 3:45134087-45134109 CAGCTTCCCCACTGAGCAAGGGG + Intronic
953780646 3:45867234-45867256 CAGTTTCCCCTTTGGTAAATGGG + Intronic
953789041 3:45932319-45932341 CGGTTTCTCAACTGTGAAATGGG + Intronic
953908600 3:46881241-46881263 CAGTTTCCCCACTTGGTACCGGG + Intronic
953925442 3:46980230-46980252 CAGTTTCCCCATTTGTAAAAAGG - Intronic
954372136 3:50174497-50174519 CAGTTTCTTCACTTGAAAATGGG + Intronic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
954710638 3:52503633-52503655 CAGTTTCCCCACTTGTAAAGTGG + Intronic
954749383 3:52805063-52805085 CAATTTCCCCATTGTAAAATGGG - Intronic
954757896 3:52851930-52851952 CAGTTCCACCACTGTAAAATGGG + Intronic
955374525 3:58383946-58383968 CTGTTTCCCCTCTCTGAAATAGG - Intronic
955483402 3:59412188-59412210 CAGTTTCCTCATTTGGAAAATGG + Intergenic
955971523 3:64442965-64442987 CAGTTTCCCTACTGTTAAGTGGG - Intronic
956002841 3:64747493-64747515 CAGTTTCCTCTCTGGGAGGTAGG - Intergenic
956263552 3:67372326-67372348 CAATTTCCTCACTGGTAAAATGG + Intronic
956361311 3:68450940-68450962 CAGTTTCCTCATTGTAAAATGGG - Intronic
956553059 3:70483602-70483624 CAGTTTCCACACCTGTAAATGGG + Intergenic
956665964 3:71642330-71642352 CAGTTTCCTCACTGAAAAGTGGG - Intergenic
956698391 3:71937710-71937732 CAGTTTTCTCACTGTAAAATAGG - Intergenic
956770972 3:72525724-72525746 CAGTTTCCCCATTGGTAAAGAGG + Intergenic
956772216 3:72536291-72536313 CATTTTACCCACTAGGAAACAGG + Intergenic
956784866 3:72633957-72633979 CAGTTTCCCCATTTGTAAAAGGG - Intergenic
959740979 3:109719337-109719359 CAGTTTTCCCATTTGCAAATGGG - Intergenic
959958893 3:112273510-112273532 CAGTTACCCCACTTGGGCATAGG - Intronic
960088948 3:113619372-113619394 CAGCCTCTCCACTGAGAAATGGG + Intronic
960615896 3:119595747-119595769 CAGTTTCTCCACTGGTGAAATGG + Intergenic
961215899 3:125160299-125160321 CTGTTTCCCCACTGTAAAATGGG + Intronic
961447358 3:126987163-126987185 CAGTTTCCCCATTTGCAAAAGGG - Intergenic
961818102 3:129561566-129561588 CAGCTTCCCCACTGGGGCATGGG + Intronic
961829006 3:129613742-129613764 CAGTTTCCCTACCTGTAAATAGG - Intergenic
962187501 3:133275188-133275210 TAGTTTCCCCAATTGAAAATGGG + Intronic
962635623 3:137328402-137328424 CAGTTTCCCCACCTGTAAAATGG - Intergenic
962986347 3:140539750-140539772 CAGTTTCCTCATTGGCAAAATGG - Intronic
964880689 3:161419510-161419532 CAGTTTCAAGACTGGGAAACTGG - Intergenic
965689357 3:171338871-171338893 CAGTTTCCTCACCTGTAAATTGG - Intronic
966435694 3:179881481-179881503 CAGTTTCCTCATTTGAAAATGGG + Intronic
966542530 3:181107741-181107763 CAGTTTCCCATCTGTAAAATGGG + Intergenic
966614181 3:181896663-181896685 CAGGTTCCCCACTATAAAATTGG - Intergenic
966732248 3:183161132-183161154 CAGTTCCCTCACTGAAAAATGGG - Intronic
967815300 3:193793120-193793142 CAGTTTCCTCAGTGGGGAAATGG + Intergenic
968007696 3:195254393-195254415 CAGTTTCCTCACAGGGGAAAAGG - Intronic
968704379 4:2071178-2071200 CAGTTTCCCCACGTGCAAAGAGG + Intergenic
968939285 4:3629736-3629758 CAGTTTCCCCAGCAGTAAATGGG - Intergenic
969134708 4:5020516-5020538 CAGTTTTCCCACCTGGAAAATGG - Intergenic
969256405 4:6005004-6005026 CAGGTTCCCAAGTGTGAAATGGG - Intergenic
969344488 4:6562706-6562728 CAGTTTCTCTTCTGTGAAATGGG - Intronic
969350925 4:6597407-6597429 CAGTTTCCCCTCTGTAAAGTGGG - Intronic
969481013 4:7446882-7446904 CAGTTTCTGCAATGGGAAATGGG - Intronic
969672642 4:8598244-8598266 GGGTTTCCCCACTGGGGACTGGG - Intronic
969846607 4:9924658-9924680 CACTTGCCCAGCTGGGAAATGGG - Intronic
970171269 4:13292882-13292904 CAGTTTCCTCACCTGTAAATTGG - Intergenic
970171839 4:13298528-13298550 CAGCTTCCCCACTGGAGAAACGG - Intergenic
970808878 4:20067694-20067716 TAGTTTCCCAACTGGAAAAATGG - Intergenic
971163814 4:24161503-24161525 CAGTTTCCTCACCTGGAAAATGG + Intergenic
971454200 4:26828701-26828723 CAGTTTCTTCATTGGTAAATAGG + Intergenic
971457459 4:26858112-26858134 CAGTTTCCCCACTTTTAAATTGG - Intronic
972023695 4:34349633-34349655 CAGTTTCCTCACTGGTAATATGG + Intergenic
972166388 4:36290189-36290211 CAGTTTCCTCAATGGTAAAATGG - Intronic
972359410 4:38313788-38313810 CAGTTTCCTCATTGGAAAATGGG + Intergenic
973261047 4:48163993-48164015 TAGTTTCCCCACCAGAAAATAGG - Intronic
973641238 4:52904934-52904956 CAGTTTCCTCACTGGTAAACAGG + Intronic
973710117 4:53621525-53621547 CAGTGTCCACACTGGGTATTTGG - Intronic
974187007 4:58458639-58458661 CAGTCTCACCACTTGGTAATAGG - Intergenic
974188675 4:58474787-58474809 CATCTTCCCTACTGGGAAGTGGG + Intergenic
974702728 4:65472396-65472418 CAGTGTCCCCACTGGGGAACTGG - Intronic
976318388 4:83683943-83683965 CAATTTCCTCACTAGTAAATGGG - Intergenic
976637677 4:87303418-87303440 CAGTGTGACCTCTGGGAAATGGG + Intergenic
977201150 4:94118510-94118532 TAGTTTCCTCAGTGTGAAATGGG - Intergenic
977930896 4:102747600-102747622 CAGTTTCTCCTCTGTCAAATAGG + Intronic
978127652 4:105153604-105153626 CAGTTTCCTCACTCATAAATAGG - Intronic
978331448 4:107617367-107617389 CTGGTTCCTCACTGGGAAGTTGG - Intronic
978430077 4:108624359-108624381 CAGGTTTACCAATGGGAAATGGG + Intronic
978469347 4:109046144-109046166 CAGTTTCCTCACTGAACAATAGG + Intronic
979322963 4:119345695-119345717 CAGTTTCCCCATCTGGAAAATGG + Intergenic
979567625 4:122173331-122173353 CAGAGTCCCCACTGGTAAAAAGG - Intronic
979712960 4:123802504-123802526 CAGTTTCCTCACTTGTAAATTGG + Intergenic
981520576 4:145657753-145657775 CAGTTTCCTCACTATTAAATGGG + Exonic
981663494 4:147195107-147195129 CAGTTTCCCCATTTGAAAACAGG - Intergenic
981843407 4:149138153-149138175 CAGTTTCCCCACTAGTAATTTGG - Intergenic
981924037 4:150117989-150118011 CAATTTCCCCACTGTAAAATGGG - Intronic
982551902 4:156812713-156812735 CATTTTCCTCACTGGTAAACTGG + Intronic
982643789 4:157996571-157996593 CAGTTTCCCCTCTGGGTCAAGGG + Intergenic
982796365 4:159650047-159650069 CAGTTTCTACACTGGAAAAGTGG - Intergenic
983240799 4:165230344-165230366 CAGTTTCCCCATCTGGAAAATGG + Intronic
983333284 4:166359198-166359220 CAGCTGCCCCACTTGGAAGTTGG - Intergenic
983394131 4:167171428-167171450 ATTTTTCCCCATTGGGAAATGGG - Intronic
984159580 4:176234815-176234837 CAGTTTCCTCACTATAAAATGGG + Intronic
985812685 5:2101691-2101713 CAGTTTCCCCAATGAAAAACGGG - Intergenic
985886982 5:2687441-2687463 CAGTTTCCCCACATGTAAACTGG + Intergenic
986301733 5:6482949-6482971 CAGTTTTCCCACTTGGAGCTGGG - Intronic
988265925 5:28951136-28951158 CAGTTTCCCCAGTTGAAAATGGG - Intergenic
989265946 5:39474390-39474412 CAGTTTCCCCTCTCTAAAATGGG - Intergenic
989351202 5:40488761-40488783 CAGTTTCTTCACTGGTAAAATGG - Intergenic
989655769 5:43745841-43745863 CAGCTGCCCCTCTGGGAAGTGGG - Intergenic
990177623 5:53125699-53125721 CAGTTTCCCCAATTAGAAAATGG - Intergenic
990213383 5:53504599-53504621 CAGTTTCTCAGATGGGAAATAGG + Intergenic
991457382 5:66818888-66818910 CACTTTCCTCATTGGTAAATTGG + Intronic
991503709 5:67303078-67303100 CTGTTTCCCCTCTGGGATTTTGG - Intergenic
991655007 5:68895242-68895264 CAGTTTCCCCACCTGTAAAATGG - Intergenic
991714668 5:69440144-69440166 CAGTTTCCTTACTGGTAAAATGG - Intronic
992127034 5:73652789-73652811 CAGTTTCCCCATCTGTAAATTGG - Intronic
992198798 5:74364429-74364451 GAGCTTCCCCAGTGGGAATTTGG - Intergenic
992668082 5:79031216-79031238 CACTTTACTCACTGAGAAATAGG - Intronic
992768408 5:80024468-80024490 TACTTTCCTCACTGGGAAATGGG - Intronic
992909509 5:81381700-81381722 CAGTTTCCCCAGGGTGAAATGGG + Intronic
993514338 5:88811944-88811966 CAGTTTCCTCACCTGGAAAGTGG + Intronic
993531730 5:89033652-89033674 CAGTTTCCACACCTGTAAATTGG + Intergenic
994179432 5:96747864-96747886 CAATTTCCTCACTGTAAAATGGG - Intronic
994915501 5:105971759-105971781 CAATCTCCCCAGTGGTAAATTGG - Intergenic
995155411 5:108906092-108906114 CATTTTACACACTGGGAAATGGG - Intronic
995885251 5:116887437-116887459 CAGTTTCCTCATCTGGAAATGGG - Intergenic
996037107 5:118770778-118770800 CAGTTTCCCCATGTGGAAAATGG + Intergenic
996775036 5:127123352-127123374 AAGTTTCCCCTCAGGGAAAGAGG + Intergenic
997057327 5:130460057-130460079 CAGAGTCCCCACTGTGACATGGG + Intergenic
997345592 5:133189723-133189745 CAGTGGCCTCACAGGGAAATGGG - Intergenic
997513166 5:134466679-134466701 CACATTCCCCACTAGGGAATTGG - Intergenic
997523434 5:134537815-134537837 CAGTCTCCCCACTGATGAATGGG - Intronic
998166218 5:139845841-139845863 CAGTTTCCTTGCTGGGAAATGGG - Intergenic
998196715 5:140079814-140079836 CAGTTTCCCCAACTGTAAATTGG - Intergenic
998459164 5:142296657-142296679 CAGTTTCCCCATCTGGAAAATGG - Intergenic
998515234 5:142747732-142747754 AAGTTTCCCCTCTGTAAAATGGG + Intergenic
998860943 5:146443463-146443485 CAGTTTCCTCATTTGTAAATTGG + Intergenic
998979014 5:147680060-147680082 CTGTTTCCTCACTGTAAAATAGG + Intronic
999119603 5:149198873-149198895 CAGTTTCTCCACAGGTAAAATGG + Intronic
999306087 5:150520687-150520709 CAGTTTCCCTACTTGTAAAATGG - Intronic
999419007 5:151424795-151424817 CAGTTTCCTCACTTGTAAAATGG - Intergenic
999443254 5:151619387-151619409 CAGTTTTGCCACTGCAAAATGGG - Intergenic
999496587 5:152104944-152104966 CAGTTTCCTCATTGGCAAAAGGG - Intergenic
999547082 5:152641601-152641623 CAGATCCCCCATTGGTAAATGGG - Intergenic
999708862 5:154298611-154298633 CAGTTTTCTCACTGTAAAATCGG - Intronic
999766988 5:154748748-154748770 CAGTTTCCCCATCTGTAAATTGG - Intronic
999979968 5:156948707-156948729 TAGTTTCCTCACTGGTAAACTGG - Intronic
1000336030 5:160242177-160242199 CAGTTTCCTCACCTGTAAATGGG + Intergenic
1000954943 5:167532111-167532133 CAGTTTCCTCACCTGAAAATGGG - Intronic
1001039173 5:168320504-168320526 CAGTTTCCCGTCTGTGAAATGGG + Intronic
1001048913 5:168398589-168398611 CAGTTTCCATACTGGTAAAATGG - Intronic
1001072521 5:168599315-168599337 CATTTTGCCATCTGGGAAATGGG + Intergenic
1001230512 5:169983415-169983437 CAGTTTCCCCATTTGTAAAGTGG + Intronic
1001545609 5:172568839-172568861 CAGTTTCTCCATTTGGAAATGGG + Intergenic
1001562264 5:172677448-172677470 CAGTTTCCCCACTTGCAAAGTGG - Intronic
1001586307 5:172835406-172835428 CAGTTTCACCACCTGCAAATTGG + Intronic
1001621134 5:173086259-173086281 CAGCTTCTCCACTGGGGCATTGG + Intronic
1001773796 5:174314005-174314027 CAGTTTTACCTCTGTGAAATGGG + Intergenic
1001947155 5:175788986-175789008 CAGTTTCCTCTCTGTAAAATGGG - Intergenic
1002527797 5:179824490-179824512 CAGTTTCCCCATTTGGGAAATGG - Intronic
1002919984 6:1561222-1561244 CAGTTTCCCCATCTGTAAATTGG + Intergenic
1003015334 6:2463123-2463145 CAGTATCCCTCCTGGGAAATGGG + Intergenic
1003079731 6:3012256-3012278 CAGTTTGCTCTCTGGTAAATTGG + Intronic
1003523605 6:6880199-6880221 CAGTTTCCAAACTGAGAAACTGG - Intergenic
1003563807 6:7205356-7205378 CAGTTTCCACACTGGTAAAATGG - Intronic
1004234941 6:13866798-13866820 CAGTTTCCCATCTGCAAAATGGG + Intergenic
1004718950 6:18248167-18248189 CAGTTTCCCATCTGTAAAATGGG - Intronic
1005281850 6:24282871-24282893 CAGTTTCCCCCATGGCAAAATGG + Intronic
1005422211 6:25663569-25663591 CAGTTTCCTCATTTGGAAAATGG - Intronic
1006130414 6:31865765-31865787 CAGTTACCACACTGGGTCATTGG - Exonic
1006348249 6:33500992-33501014 CAGTTTCTGCTCTGTGAAATGGG - Intergenic
1006399204 6:33806586-33806608 CAGTTTCCCCACATGTAAGTTGG - Intergenic
1006604153 6:35244192-35244214 CAGTGTCCCCTCTGGGAAATTGG - Intronic
1006615961 6:35327090-35327112 CAGTTTCCTCACTTGTAAATGGG + Intergenic
1006779773 6:36624422-36624444 CAGTTTCCCCACCTGTAAAATGG + Intergenic
1006804486 6:36779233-36779255 CAGTTTCCCCTCTGGAACATGGG + Intronic
1006878772 6:37321167-37321189 CAGTTTCCCCATTTGTAAAATGG - Intronic
1006907534 6:37543028-37543050 CAGTTTCCTCACTGGTACAGTGG - Intergenic
1007275544 6:40670839-40670861 CAGTTTCCCCAATTCCAAATGGG - Intergenic
1007336751 6:41160025-41160047 CAGTTTCCCCACTTATAAAGTGG + Intronic
1007658374 6:43466890-43466912 CAGTTTCCCCACTTGTGAAATGG + Intergenic
1008138039 6:47799830-47799852 CAGTTTTCCCACTCCCAAATAGG - Intronic
1008415132 6:51230646-51230668 CAGTTTTCTCAGTGGGAAAGAGG - Intergenic
1008769052 6:54956651-54956673 CAGTTTTCTCACTGGGAGAATGG - Intergenic
1008827196 6:55710858-55710880 CAGTTTCCTAGCTGGAAAATGGG - Intergenic
1008853955 6:56058765-56058787 CAGTTTCCTCATTGGTAAAATGG - Intronic
1008957202 6:57228782-57228804 CAGTTTCCTCACTTGTAAAATGG + Intergenic
1009736811 6:67687297-67687319 CAGTTTTGTCACTGGGAATTGGG + Intergenic
1009979152 6:70705814-70705836 CAGTTTCCACACTAAAAAATAGG - Intronic
1010188907 6:73174733-73174755 CTGTTTCCTCACTGGCAAACTGG + Intronic
1011117537 6:83910263-83910285 CAGTTTCCTCATTGGTAAAATGG + Intronic
1011741290 6:90363328-90363350 CAGTTTCCTCCCTGTGAAACAGG - Intergenic
1011753257 6:90474323-90474345 CAGTTTCCCCTTTGGAAAAAGGG + Intergenic
1012370147 6:98494858-98494880 CAGTTGCCTCATTGGAAAATAGG + Intergenic
1012444321 6:99292661-99292683 CAGTTTTCCCATCTGGAAATGGG + Intronic
1012658838 6:101860383-101860405 TATTTTCCCCAATGGGATATAGG + Intronic
1012856315 6:104506328-104506350 GAGTTGCCCAACTGGGAGATAGG - Intergenic
1013152801 6:107462255-107462277 AAAATTGCCCACTGGGAAATGGG + Intergenic
1013164207 6:107575175-107575197 CAGTTTCTACACTGGCAAAATGG + Intronic
1013359830 6:109383260-109383282 CAGTTTCCTCACTGGTAATGTGG - Intergenic
1014089605 6:117388822-117388844 CAGTTTCCACACCTGGAAATGGG - Intronic
1014920751 6:127212283-127212305 CATTTTCCTCACTTGTAAATGGG + Intergenic
1015797496 6:137027579-137027601 CAATTTCCCCATTTGGAAAATGG + Intronic
1016974214 6:149791099-149791121 CAGTTTCCCCACCGGGCCCTGGG + Intronic
1017512980 6:155130453-155130475 CAGTTTCCCCACCTGGAGAAGGG + Intronic
1017565408 6:155679672-155679694 TAATTTCCCCACTGGTAAAATGG - Intergenic
1017972770 6:159327423-159327445 CAGTTTTCCCACTGGTAGAGGGG + Intergenic
1018178890 6:161202999-161203021 GAGTCTCCCCACTGGGAACCAGG + Intronic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1019533054 7:1513231-1513253 CAGTTCCCCCACCTGGAAAATGG + Intergenic
1019581063 7:1763413-1763435 CCGTTTCCACACTCGTAAATGGG - Intergenic
1019931313 7:4225172-4225194 CAGTCTCACAACTGGGACATGGG - Intronic
1020217921 7:6209202-6209224 CAGTTTCCTCATTTGTAAATGGG + Intronic
1021209407 7:17827693-17827715 CAGTTTTCCCAATGGTAAAATGG + Intronic
1021552427 7:21885537-21885559 CAGTTACCCTACTGTGCAATAGG - Intronic
1022267914 7:28775936-28775958 CAGTTTCCCCATTTGTAAAAAGG - Intronic
1022411365 7:30141053-30141075 CAATTTCCTCACTGGTAAAATGG + Intronic
1023168993 7:37372365-37372387 CAGTTTCCCCATTTGTAAAATGG + Intronic
1023553100 7:41389692-41389714 CAGTTTCCCCATCTGGAAAGTGG - Intergenic
1023639722 7:42245369-42245391 CAGTTTCCTCACAGGTAAAATGG + Intergenic
1023901604 7:44485397-44485419 AAGTTTTCCCACTGGCAAAATGG + Intronic
1024508754 7:50185774-50185796 CAGTTTCCCCACGTGTAAAATGG + Intergenic
1024567412 7:50693303-50693325 CAGTCTCTCCACTAAGAAATTGG + Intronic
1026451704 7:70535154-70535176 CAGTTCCCTCATTGTGAAATGGG + Intronic
1026567592 7:71502308-71502330 CACTTTCTCCACTGAGAGATGGG + Intronic
1026940958 7:74287726-74287748 CAGTTTCCCCATCTGTAAATTGG - Intergenic
1027262968 7:76478172-76478194 CAGTTTCCTCATTGGCAAAATGG - Intronic
1027314352 7:76976273-76976295 CAGTTTCCTCATTGGCAAAATGG - Intergenic
1028535297 7:91885024-91885046 CAGTTTCCCCATTTGTAAAATGG - Intergenic
1028614047 7:92744592-92744614 CAGTTTACTCATTGGTAAATGGG + Intronic
1029597101 7:101543749-101543771 CAGTTTCCCCACATTGAAAATGG + Intronic
1030072319 7:105708568-105708590 CAATTTTCCCACTGTGAAATGGG + Intronic
1030100694 7:105942541-105942563 CAGTTTCCCCACCTGTAAAATGG + Intronic
1030816849 7:114049394-114049416 CAGATTCACCACTGGTAACTTGG + Intronic
1031143801 7:117975178-117975200 CACTTTCCTCTCTGTGAAATAGG + Intergenic
1031614814 7:123867793-123867815 CAGTTTCCCCATTTGTAAAATGG + Intronic
1031622783 7:123955268-123955290 CTATTTCCCCACTGGAAAATGGG - Intronic
1032475070 7:132206135-132206157 TAGTTTCCCCATTGGTAAAGTGG + Intronic
1032673272 7:134105745-134105767 CAGTTTTCCCAATGGAAAAATGG - Intergenic
1032867591 7:135942561-135942583 CTGTTTCCCCAGTGGTAAAATGG + Intronic
1032982406 7:137299388-137299410 CAGTTTCCCCATTTGTAAAATGG - Intronic
1033300183 7:140177827-140177849 CATCTTCCCCACTTGGGAATCGG - Intergenic
1034061842 7:148099169-148099191 CAGTTTCCCCACATGAAAAGTGG + Intronic
1034320987 7:150181627-150181649 GAGTTCCCTCATTGGGAAATGGG - Intergenic
1034771759 7:153785614-153785636 GAGTTCCCTCATTGGGAAATGGG + Intergenic
1036681524 8:10877907-10877929 CAGTTTCCCCATTTGTAAAAGGG + Intergenic
1037346245 8:17904443-17904465 CAGTCACCTCACTGGGAAAATGG - Intronic
1037881926 8:22577813-22577835 CAGTTTCCCCATGTGGAAAATGG - Intergenic
1038311930 8:26451399-26451421 CAGTTTCTCCATGGGTAAATTGG + Intronic
1039762121 8:40589226-40589248 CAGTTTCCTCTCTGTTAAATCGG - Intronic
1040888773 8:52293714-52293736 CAGTTTCCTCATTGGTAAATGGG + Intronic
1041617686 8:59927446-59927468 CAGTTTCCCCATGTGGAAAAGGG + Intergenic
1041619016 8:59943493-59943515 CAGTTTCCCCACTTGGAAATTGG - Intergenic
1042260186 8:66850577-66850599 CAGTTTCCTCAGTGGTAAAATGG - Intronic
1042809166 8:72805068-72805090 CAGTCTCCTCACTGGAAAAATGG + Intronic
1043563894 8:81526477-81526499 CAGTTTCCTCACTGTTAAATGGG + Intronic
1043983409 8:86666483-86666505 CAGTTTCCTCATTTGTAAATGGG + Intronic
1044217995 8:89635570-89635592 CAGTTTCCTCACCTGCAAATGGG - Intergenic
1044769875 8:95619953-95619975 CAGTTTCTCTACTGGGGAAATGG + Intergenic
1045016654 8:98006627-98006649 CACTTTCCTCTCTGTGAAATGGG + Intronic
1045226179 8:100248161-100248183 CAGTTTCCCATCTGTAAAATAGG + Intronic
1045668244 8:104514729-104514751 CAATTTCCTCACTTGTAAATGGG + Intronic
1046470368 8:114664867-114664889 CAGCTTCCTCACTGTAAAATAGG - Intergenic
1046769157 8:118101197-118101219 CAGTTTCCACATCTGGAAATGGG - Intronic
1047205744 8:122802020-122802042 CAGTTTCCCCACTTAGAAAGTGG + Intronic
1047364911 8:124202866-124202888 CAGTTTCCTCACATGTAAATGGG - Intergenic
1047373520 8:124275506-124275528 CAGTCTTCCCTCTGGAAAATGGG - Intergenic
1047492976 8:125389466-125389488 CAGTTTGCTCACTGTAAAATGGG + Intergenic
1047499059 8:125428690-125428712 CAGTTTCTTCCCTGTGAAATGGG + Intergenic
1047720420 8:127633854-127633876 CAGTTTCTCATCTGTGAAATGGG - Intergenic
1047768308 8:128008407-128008429 CAGTTTCCTCATTGATAAATTGG - Intergenic
1047775963 8:128070717-128070739 CAGTTTGGCCACTGAGACATAGG - Intergenic
1047916597 8:129590668-129590690 AAGTTTCTCCTCTGTGAAATGGG + Intergenic
1047919591 8:129620475-129620497 CATTTTCTCCCCTGAGAAATGGG + Intergenic
1048174247 8:132137345-132137367 CAGTTTCCTCATTGGAAAAATGG + Intronic
1048260113 8:132938099-132938121 CAGTTTCTCCTCTGTAAAATGGG + Intronic
1048293957 8:133200677-133200699 CAGTTTCCCATCTGTCAAATTGG + Intronic
1048517774 8:135126080-135126102 CACGTTCCCCACTGGGATTTAGG + Intergenic
1048799797 8:138185157-138185179 TAGTTTCCCCACTAGGAATCAGG + Intronic
1048846684 8:138609208-138609230 CAGTTTCCCCATTTGTAAAAGGG - Intronic
1048965425 8:139611285-139611307 CAGTTTCCCCACCTTTAAATTGG - Intronic
1049069248 8:140344363-140344385 CATTTTCCCCATTTGGAAAAGGG - Intronic
1049189916 8:141281403-141281425 CAGTTTCCCCACCTGTAAATGGG + Intronic
1049277448 8:141726876-141726898 CAGCTTCCCCACTGTAAACTTGG - Intergenic
1049346135 8:142139734-142139756 CAGTTTCCTCAGTGTAAAATGGG + Intergenic
1049595691 8:143482302-143482324 CATTTTCCCCAGTGGTAAGTAGG - Intronic
1050087542 9:1981612-1981634 CAGTGTTCCCACTAGCAAATGGG + Intergenic
1051757747 9:20422964-20422986 CAGTTTCCTCACTTATAAATTGG - Intronic
1052021183 9:23527342-23527364 CAGTTTCCACACTTGGAAAAGGG - Intergenic
1052239809 9:26257896-26257918 CAGGTTTCCCACTGTAAAATGGG - Intergenic
1052349581 9:27444751-27444773 CAGTTTCCTCATTTGAAAATAGG + Intronic
1056000960 9:82216045-82216067 CAGTTTCCTCCCTGGGAAAGGGG + Intergenic
1056230427 9:84538040-84538062 CAGTTTCCCAACTGTAAAGTTGG + Intergenic
1056720599 9:89068350-89068372 CAGTTTACCCAGTAGGAAAATGG - Intronic
1056940196 9:90949008-90949030 CAGTTACCCATCTGGGAAAATGG - Intergenic
1057168930 9:92949263-92949285 CAGTTTCTCCATTTGTAAATGGG + Intronic
1057184988 9:93052515-93052537 CAGTTTCCCATCTGTAAAATGGG + Intergenic
1057199351 9:93132114-93132136 CAGTTTCTCATCTGTGAAATGGG - Intronic
1057307112 9:93918852-93918874 CAGTTTCACCACCTGGAAAAGGG + Intergenic
1057999514 9:99850711-99850733 CAGTTTCCCCATTTGTAAAATGG + Intronic
1058033538 9:100225478-100225500 CAGTTTCCTCACCTGTAAATTGG + Intronic
1058186244 9:101859026-101859048 CAGTTTCCTTACTGGTAACTGGG + Intergenic
1058712368 9:107691348-107691370 CAGTTTCCTCACATGGAAAATGG - Intergenic
1058986600 9:110213734-110213756 AAGTTTCCCATCTGGAAAATGGG - Intergenic
1058989752 9:110243375-110243397 CTGTTTCCTCACAGGTAAATGGG + Intergenic
1059365385 9:113782820-113782842 CAGTTTCCCCACCTGTAAAATGG - Intergenic
1059419967 9:114184741-114184763 CAGTTTCCCCATCTGTAAATGGG - Intronic
1059424975 9:114215312-114215334 CAATTTCCCTACTTGGAAATAGG - Intronic
1059439933 9:114301216-114301238 CAGTTTCCTCATCTGGAAATGGG + Intronic
1059508930 9:114825882-114825904 CAGTTTCCTTATTGGTAAATGGG + Intergenic
1059535097 9:115073389-115073411 AATTTCCCCCACTGGGAAATAGG - Intronic
1059623773 9:116038706-116038728 CAGTTTCCTCATTGGCAAAGGGG - Intergenic
1059765110 9:117376711-117376733 CAGTTTCTGAACTGGAAAATCGG + Intronic
1059770188 9:117416566-117416588 CAGTTTCCTCACATGGAAAATGG - Intergenic
1059986838 9:119828422-119828444 CAGTTTCCCCACTTGCTAAATGG - Intergenic
1060148709 9:121272878-121272900 GAGTTTCCTCACTGGTAAAATGG - Intronic
1060175338 9:121493439-121493461 CAGTTTCCCCACATGCAAAATGG + Intergenic
1060259870 9:122065016-122065038 GAGTGTCACCACTGGGAATTTGG - Intronic
1060408236 9:123383181-123383203 CAGTTTCCTCACTTGCAAGTGGG - Intronic
1060493093 9:124099217-124099239 CAGTTTCCTCATTGGTAAAAGGG - Intergenic
1060563960 9:124572478-124572500 CAGTTTCCTCACTTGCAAAATGG - Intronic
1060569979 9:124629493-124629515 CAGTTTCTTCACTGGTAAAATGG - Intronic
1060659064 9:125392486-125392508 CAGTTTCCCCATTTGTAAAATGG + Intergenic
1060809021 9:126599061-126599083 CAATTTCCCCACTTGTAGATTGG + Intergenic
1060863057 9:126972115-126972137 CAGCTTCCTCACTGGGTACTGGG - Intronic
1060976785 9:127769841-127769863 CAGTCTCCTCACTGGCAAAATGG + Intronic
1061060366 9:128247203-128247225 CAGTTTCCTCACTGGGAAGATGG - Intronic
1061130339 9:128704608-128704630 CAGTTTCCTCACTAGAAAATAGG + Intronic
1061170924 9:128953718-128953740 CAGTTTCCCCACTGGTAAAATGG - Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061234016 9:129332006-129332028 CAGTTTCCCATCTGCAAAATGGG + Intergenic
1061236451 9:129345876-129345898 CAGTTTTCTCATGGGGAAATGGG + Intergenic
1061250628 9:129424374-129424396 CAGTTTCCCCATTGGTAAAATGG + Intergenic
1061373703 9:130212094-130212116 CAGTTTCTCCATTGGCAAAGTGG + Intronic
1061376071 9:130225609-130225631 CAGCTTCCTCACTGGTAAAATGG + Intronic
1061586795 9:131574884-131574906 CAGTTTCCCCAGCTGGAAGTGGG - Intergenic
1061674916 9:132210237-132210259 CAGTTTCCCCACCTGTAAAATGG + Intronic
1061678341 9:132230687-132230709 CAGTGTCCCCTCTGGGACTTGGG + Intronic
1061880332 9:133565751-133565773 CAGTTCCCCCAGAAGGAAATCGG - Intronic
1061908350 9:133710236-133710258 CAGTTTCGCCACCTGGAAAATGG - Intronic
1062014151 9:134282866-134282888 CAGTTTCCCCACCTCCAAATGGG - Intergenic
1062467904 9:136689265-136689287 CAGTTTTCCCTCTGTAAAATGGG - Intergenic
1062537952 9:137029046-137029068 CAGTTTCCCCCCTGTGAATGGGG + Intronic
1186270931 X:7887203-7887225 CACTTTCCCCACTGGGATAACGG - Intergenic
1186884908 X:13903426-13903448 CAATTTCCTCATTGGTAAATTGG - Intronic
1187236247 X:17470146-17470168 CAGTTTCCCCAGCTGTAAATAGG - Intronic
1187529925 X:20086975-20086997 CAGTTTCCCCACCTGGAAAATGG - Intronic
1187880640 X:23844075-23844097 CAGTTTCCTCACTTATAAATGGG + Intronic
1187943043 X:24400305-24400327 CAGTTCCCCCACTGACAAAGTGG + Intergenic
1188049719 X:25470012-25470034 TACTTTTCCCACTGAGAAATGGG + Intergenic
1188546665 X:31314894-31314916 GAGTTTTCCCACTGAGAAAGGGG + Intronic
1188813160 X:34678178-34678200 CAGATTCCCAACTTGGAAAATGG - Intergenic
1189031148 X:37452339-37452361 CAGTTTCCTCACTTGTAAAATGG - Intronic
1189234083 X:39474454-39474476 CAGTTTCCCCACCTGCAAAATGG + Intergenic
1189643845 X:43104828-43104850 CATTTCCCCATCTGGGAAATGGG - Intergenic
1190534480 X:51412067-51412089 CAGTTTCCACACCTGCAAATTGG + Intergenic
1190576812 X:51847699-51847721 TAGTTTGCCCACTGGGAGAATGG - Intronic
1190751513 X:53366067-53366089 CAGTTTCCATAGTGGGAAATAGG + Intergenic
1192094890 X:68200166-68200188 CAGTTTCCTCACTGGTAAAATGG + Intronic
1192142037 X:68654141-68654163 CAGTTTCCTCACTGGTAGTTTGG - Intronic
1192462240 X:71326905-71326927 CAGTTTCCCCAATTGTAAAATGG + Intergenic
1194065634 X:89258145-89258167 TAGTTTCCCCATTGGTAAAAAGG + Intergenic
1194756736 X:97746975-97746997 CAGATTCGCCACTGGTAACTCGG - Intergenic
1195465634 X:105176270-105176292 CCTTTTTCCCTCTGGGAAATGGG - Intronic
1196138852 X:112238988-112239010 CAATCTCCCCACTGGGAAACAGG + Intergenic
1196185221 X:112738293-112738315 CAGTTTCCTCATCTGGAAATAGG + Intergenic
1196414030 X:115452001-115452023 CAGTTTCCTCTTTGGGAAGTTGG + Intergenic
1196687756 X:118526772-118526794 TTGTTTTCCCACTGGAAAATGGG + Intronic
1197725785 X:129775523-129775545 CAGCTTCCTCCCTGGAAAATGGG + Intergenic
1198166754 X:134065017-134065039 AAGTTCTCCCTCTGGGAAATGGG + Intergenic
1198507344 X:137313826-137313848 CAGTTTCCCCTCTGAAAAAGTGG + Intergenic
1198513268 X:137375641-137375663 CAGTTTCCTCACTTGAAAAATGG + Intergenic
1198587767 X:138141674-138141696 CTGTGTCACCACTGGGAAAAAGG + Intergenic
1199769095 X:150962667-150962689 CAGTTTCCTCACTGATAAAATGG - Intergenic
1200141327 X:153904428-153904450 CAGTTTCCCCACTTATAAAATGG + Intronic
1202015643 Y:20403683-20403705 CAGTTTCCCAACTGGATTATTGG + Intergenic
1202579711 Y:26366976-26366998 CATTTGCCACACTGAGAAATTGG - Intergenic