ID: 1182115417

View in Genome Browser
Species Human (GRCh38)
Location 22:27753582-27753604
Sequence AAGGCTCCTGTTTCATGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182115417_1182115421 -4 Left 1182115417 22:27753582-27753604 CCTGCCCATGAAACAGGAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1182115421 22:27753601-27753623 CCTTTGCCCCATTTCACAGAAGG 0: 1
1: 0
2: 17
3: 87
4: 540
1182115417_1182115425 7 Left 1182115417 22:27753582-27753604 CCTGCCCATGAAACAGGAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1182115425 22:27753612-27753634 TTTCACAGAAGGAGAAACTGAGG 0: 4
1: 40
2: 408
3: 2281
4: 7762
1182115417_1182115426 21 Left 1182115417 22:27753582-27753604 CCTGCCCATGAAACAGGAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1182115426 22:27753626-27753648 AAACTGAGGTTCTGAATCCAAGG 0: 1
1: 1
2: 3
3: 18
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182115417 Original CRISPR AAGGCTCCTGTTTCATGGGC AGG (reversed) Intronic
903021178 1:20396315-20396337 ATGGTTCCTGGTGCATGGGCTGG - Intergenic
903809750 1:26028709-26028731 AAGGCTCCTCTGTCATGAGGTGG - Intronic
906184777 1:43853542-43853564 ACAGCTGCTGTTTCATGGGCAGG + Intronic
907130184 1:52090502-52090524 CTGGCTCCTGTGTAATGGGCTGG - Exonic
907703562 1:56813493-56813515 AATCCTCATGTTTCATGGGAGGG - Intronic
907950500 1:59178713-59178735 CTGGCTCCTGTTTCAGGGCCTGG + Intergenic
910052481 1:82991858-82991880 AGGGCTCCTTCTTCATAGGCTGG + Intergenic
914512343 1:148345241-148345263 AAGGCTCCTGGGTCTGGGGCGGG + Intergenic
914940016 1:152014342-152014364 AAGGCTCCTGGGTCTGGGGCGGG - Intergenic
920036867 1:203071768-203071790 AAGGCTCCTAATTCATGGCCAGG - Intronic
921919688 1:220653264-220653286 AATGCACCCGTTTCATGGGATGG - Exonic
1063959205 10:11292892-11292914 CAGGCTCCTGTTGCCTGGGAGGG - Intronic
1068666268 10:59678875-59678897 AAGGATTCTGTTGCATTGGCAGG - Intronic
1069682284 10:70293835-70293857 TTCGCTCCTGTTTCCTGGGCTGG + Intergenic
1074653859 10:115559133-115559155 AATGTTCCTGCTTCATGAGCAGG - Intronic
1074981159 10:118620943-118620965 AAAGCACCTGTTTCTTGGGCAGG + Intergenic
1075629010 10:123988735-123988757 AATGCCCATGTTTCATGGGAGGG + Intergenic
1075933066 10:126315646-126315668 CAGCCTGCTGTTTCATTGGCAGG - Intronic
1076600048 10:131651459-131651481 AAGCCTCCTTTACCATGGGCTGG - Intergenic
1076717019 10:132371304-132371326 CAAGCTCCTGGCTCATGGGCTGG - Intronic
1077013970 11:391939-391961 AGGGCTCCTGTGTCAGGAGCTGG + Intergenic
1077303582 11:1858076-1858098 AAGGCTCTTGTTTCATCCCCCGG + Intronic
1077484333 11:2831962-2831984 GAGGCTCCTGGTACACGGGCAGG - Intronic
1078095915 11:8297123-8297145 ATGGCACCTCTTTCATGAGCTGG - Intergenic
1078885490 11:15495894-15495916 AAGGCCACTGTGGCATGGGCTGG - Intergenic
1080106686 11:28518481-28518503 AACCCTCTTGTTCCATGGGCAGG + Intergenic
1083656460 11:64232133-64232155 AGGGGTCCTGTCTGATGGGCTGG + Intronic
1083935912 11:65870081-65870103 CAGGCTCCTGGGTCCTGGGCAGG - Intronic
1084408789 11:68994170-68994192 AAAGCTCCTCTCTCATGGTCGGG - Intergenic
1084602351 11:70153526-70153548 AAGGCTTCTGTTTCATTGCTCGG - Intronic
1087054305 11:93918642-93918664 AAGGCTCCGTCATCATGGGCAGG - Intergenic
1088835757 11:113576839-113576861 TCAGCTCCTATTTCATGGGCTGG - Intergenic
1093150494 12:15615538-15615560 AAGGTACTTGTTTCATGAGCCGG + Intergenic
1093509149 12:19905085-19905107 AATGCTCCCTTTTCCTGGGCAGG + Intergenic
1097148029 12:56954974-56954996 ACGTCTCCAGTGTCATGGGCCGG - Exonic
1098091196 12:66903580-66903602 AAGGCTTCTGTTTGAAGGGGAGG + Intergenic
1100091491 12:90977370-90977392 AAGGCTCTGGTTTCATCTGCAGG + Intronic
1100187338 12:92152089-92152111 AAGCCTCCTTTTTCCTGTGCTGG + Intergenic
1100867675 12:98874550-98874572 AAGGCTCCTGTTGTTTGGGGTGG + Intronic
1100881932 12:99028794-99028816 CTGGCTCCTTTTTCATGGTCAGG + Intronic
1101633499 12:106518068-106518090 CAGCCTCCTGTTTCATTGTCTGG - Intronic
1105676072 13:22673022-22673044 AATGCTTCTGTGTGATGGGCAGG + Intergenic
1106213578 13:27673752-27673774 AAGGCAACTGTTTCATGGAATGG + Intergenic
1107230565 13:38104649-38104671 AAGGATCCTGTTTCACTGGAGGG - Intergenic
1111774855 13:92647378-92647400 AGTGCTCCTGTTTCAGGGCCAGG + Intronic
1113482408 13:110631097-110631119 AAGTCTTCTGGTTCCTGGGCTGG + Intronic
1113850450 13:113414600-113414622 AATGCTCCTCTTCCAGGGGCAGG + Intergenic
1115495840 14:34003761-34003783 AAGTGTCCAGCTTCATGGGCTGG - Intronic
1118912061 14:70069731-70069753 AAGGCCCCTGTTCCATGAGAAGG + Intronic
1120559987 14:85979497-85979519 AATCCTCATGTGTCATGGGCGGG - Intergenic
1121637496 14:95463621-95463643 AAGGCCCGTGTGGCATGGGCAGG - Intronic
1122281372 14:100624389-100624411 AAGGAGCCTGTTTCCTGTGCAGG - Intergenic
1126731391 15:51686770-51686792 AGGGCTCATGGCTCATGGGCTGG + Intronic
1131874478 15:96790157-96790179 CAAGCTCATGTGTCATGGGCAGG + Intergenic
1134677714 16:16102304-16102326 AGGGCTACTGTTTTCTGGGCTGG + Intronic
1134685001 16:16152371-16152393 AAGGATGCTGTTTCATGGAAGGG - Intronic
1140263931 16:73404131-73404153 AAGGATCCAGTTTCAGGGGCTGG + Intergenic
1141445956 16:84058465-84058487 AAGACTCCTGCTTGATGGGGTGG + Intronic
1143614648 17:8042601-8042623 AAGGAGGCTGTTTCCTGGGCAGG - Intronic
1143811012 17:9471816-9471838 AAGGCTCCTGGTTGAAGTGCTGG - Intronic
1144050013 17:11490411-11490433 ACACCTCCTGTTTCATCGGCAGG - Intronic
1144394023 17:14825995-14826017 AAGGTGCATGTTGCATGGGCAGG + Intergenic
1144488020 17:15683886-15683908 AAGGCTCCTGTACCAGGGCCAGG - Intronic
1144615231 17:16765027-16765049 AAGGTTCCTGTTACATGTCCAGG - Intronic
1144897470 17:18550629-18550651 AAGGTTCCTGTTACATGTCCAGG + Intergenic
1144912996 17:18698402-18698424 AAGGCTCCTGTACCAGGGCCAGG + Exonic
1145134902 17:20395087-20395109 AAGGTTCCTGTTACATGTCCAGG - Intergenic
1147854427 17:43468106-43468128 GATGCTCCTGTTCCCTGGGCAGG - Intergenic
1152424181 17:80210110-80210132 AAGACTCCCTTGTCATGGGCTGG + Exonic
1158742949 18:60164695-60164717 AAGGCTCTTGTATCATGAGGTGG + Intergenic
1161910402 19:7189192-7189214 AAGGGGCTTGTTTCCTGGGCTGG + Intronic
925114016 2:1363131-1363153 ATGGTTCCTCTTTCATGGGGGGG - Intronic
925122944 2:1433074-1433096 CAGTCTCCTGTTTCATTAGCTGG + Intronic
927400440 2:22704289-22704311 AAGGCTGCTGGCTCAGGGGCTGG - Intergenic
933989966 2:87627091-87627113 AAAGCTCCCATTTCATGGGGTGG + Intergenic
934080795 2:88466244-88466266 AAGGCACCTTTTCCTTGGGCTGG + Intergenic
935275363 2:101471704-101471726 AAGGTTTCTGTTTCATGGACAGG - Intronic
936303879 2:111323733-111323755 AAAGCTCCCATTTCATGGGGTGG - Intergenic
938668871 2:133567820-133567842 AAGGCTACTTTTTCATGAACTGG - Intronic
940152306 2:150615889-150615911 AAGGCACCCCTTTTATGGGCTGG - Intergenic
943455818 2:188105165-188105187 AATCCTCATGTGTCATGGGCGGG - Intergenic
945929990 2:215845034-215845056 ATGGCTCCAGTTTCTTGGGTAGG + Intergenic
946062979 2:216960885-216960907 CAGGCTCCAGTTTCATGGGGTGG - Intergenic
946476445 2:220010896-220010918 GAGGCACCAGTTTCCTGGGCAGG + Intergenic
946812244 2:223538233-223538255 TTGGCCCCTGTTTCATGGGGAGG + Intergenic
948546129 2:238730173-238730195 AAGGCTCAGGCTTCAGGGGCAGG - Intergenic
1169218094 20:3804844-3804866 AGGCCTCGTGGTTCATGGGCCGG - Exonic
1169522285 20:6386758-6386780 AATCCTCCTGTTTTATGGGAGGG + Intergenic
1170593714 20:17790240-17790262 AAGCCTCCTGTTTAGTGGCCAGG - Intergenic
1170760514 20:19245020-19245042 AAGGCTCCTCTTTCATGGCAGGG - Intronic
1170959453 20:21012234-21012256 CAAGATCCAGTTTCATGGGCGGG - Intergenic
1171159368 20:22907458-22907480 ATGGCTCATGTTTCATGGGATGG + Intergenic
1172097108 20:32465852-32465874 CAGGCTCCTGTGTCAGGGACAGG - Intronic
1172219931 20:33266888-33266910 AAGGCTCCTCTTTCATGAATGGG + Intergenic
1173427302 20:42954324-42954346 AAGGCTCTTGTTTGGTGAGCAGG + Intronic
1173474360 20:43348560-43348582 AAGGCTTGTGTTTCATTGGGAGG - Intergenic
1174489082 20:50879636-50879658 CTGGCCCCTGTTTCAGGGGCTGG - Intronic
1175954105 20:62599515-62599537 CAGGCTCCTCTGTCATGGGAGGG + Intergenic
1176306043 21:5123651-5123673 GCAGCTCCTGTTTCAAGGGCAGG - Intronic
1178585365 21:33866700-33866722 AAGACTCCAGTTTCAGGGTCTGG - Intronic
1178780831 21:35602413-35602435 AAGGCTCTGGTTCCTTGGGCTGG + Intronic
1179808406 21:43854641-43854663 AGGGCTCCTGTATCAGGGCCCGG + Intergenic
1179851014 21:44138380-44138402 GCAGCTCCTGTTTCAAGGGCAGG + Intronic
1182115417 22:27753582-27753604 AAGGCTCCTGTTTCATGGGCAGG - Intronic
1184177526 22:42797260-42797282 AAGCCTCCTGGTTCAGGAGCAGG + Exonic
949742680 3:7254172-7254194 ACGGGTCCTGTTTAATGGACAGG - Intronic
951043188 3:18010857-18010879 AAGGCTCATGTTTCCTTGGAAGG + Intronic
952126340 3:30305135-30305157 ATGGCTCATGTTCCATGGGATGG + Intergenic
952873081 3:37919625-37919647 AAGGCTGCAGTTTCAAGAGCTGG + Intronic
954803343 3:53200388-53200410 AAGGCCCCTGTTTCAGGGACTGG - Intergenic
960394137 3:117115529-117115551 AAGGCTCACATTTCATGGTCTGG - Intronic
962800957 3:138890096-138890118 CAGGCTTCTGTTCCCTGGGCAGG + Intergenic
963603475 3:147396155-147396177 TGAGCTCCTGTTTGATGGGCTGG + Exonic
966777461 3:183555541-183555563 AAGTCTCCTGTTTTCTGGGAGGG + Exonic
969632588 4:8347093-8347115 AGGGCTCCTGTCCCCTGGGCTGG + Intergenic
974012809 4:56623095-56623117 AAGGCTCCTGCATCCTGGGCAGG - Intergenic
977305594 4:95319530-95319552 AGCGCTCATGTTACATGGGCTGG + Intronic
977721741 4:100246964-100246986 TAGGATCCTGTTTCCTGGCCAGG + Intergenic
980092910 4:128460840-128460862 AATGCTTCTATTTCATGGGTTGG - Intergenic
984951581 4:185011678-185011700 AGGGGTTCTGTTTTATGGGCAGG - Intergenic
985395443 4:189538718-189538740 GACGGTCCTGTCTCATGGGCAGG - Intergenic
986200655 5:5575400-5575422 AGGGCTCCTGTCACATGGGGTGG - Intergenic
992198685 5:74363830-74363852 CTGGCTCCTGCTTCATGGGGAGG + Intergenic
992474600 5:77089066-77089088 AAGGGTACTGGTTCATGGCCCGG - Intergenic
998529271 5:142870123-142870145 AACCCTGCTGTTTCATGTGCAGG - Intronic
998962700 5:147505764-147505786 AAGTTTCCTGTGTAATGGGCTGG + Intronic
999554777 5:152728542-152728564 AAGGCTGCTTTTTCATGGCCTGG + Intergenic
999723601 5:154417099-154417121 AGGGCTCTTGATTCAGGGGCTGG + Exonic
1001761204 5:174209921-174209943 AAGGCTGGGGTCTCATGGGCTGG + Intronic
1002311734 5:178319120-178319142 ATGGCTCTTGCTACATGGGCTGG + Intronic
1003807229 6:9738605-9738627 AGGTCTCCTATTTCACGGGCAGG - Intronic
1004313314 6:14564918-14564940 AAGCCTCATGTGTCATGGGAGGG - Intergenic
1004318317 6:14611545-14611567 CAGGCTTCTGTTTCTTGGTCTGG + Intergenic
1007719630 6:43877424-43877446 AAGTCTCCTGACTCCTGGGCTGG - Intergenic
1012141357 6:95630503-95630525 AAGGCCCATGTGTCATGGGGGGG + Intergenic
1015927408 6:138323972-138323994 ATGCATCCTGGTTCATGGGCCGG - Intronic
1017180111 6:151544100-151544122 AAGGGTCCTGGTTCATGGCCAGG - Intronic
1033539909 7:142347047-142347069 AAGGCTCAGGTTTTATGGGTTGG - Intergenic
1033551167 7:142449651-142449673 AAGGCTCATGTTTTATGGGTTGG - Intergenic
1034280546 7:149850894-149850916 AAGGCTCCTGCATCCTGGCCAGG + Intronic
1034487140 7:151373099-151373121 GAGGCGCCTGTTGCCTGGGCTGG + Intronic
1037237716 8:16740338-16740360 AAGGCACATCTTACATGGGCAGG - Intergenic
1037706918 8:21323100-21323122 AAGGCACCTGCTTCCTGGGATGG - Intergenic
1038221026 8:25608009-25608031 AGGGCTCCTGTTCAATGGACTGG + Intergenic
1041765440 8:61413691-61413713 ATGGCTTGTGTTTCATGGGATGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049650047 8:143761731-143761753 AAGGCTCCATGTTTATGGGCTGG - Intergenic
1049651918 8:143773751-143773773 AAGGGTCCTTCTTCCTGGGCTGG + Intergenic
1052676816 9:31636755-31636777 AAGGCACCTGTGTGATGGGGTGG - Intergenic
1052678191 9:31653911-31653933 ATGGCTCCAGTTTCATGTCCTGG + Intergenic
1057499490 9:95585425-95585447 AACGCTCCTATTTCCTGGGTAGG - Intergenic
1058129464 9:101233572-101233594 AAGGCTCCACCTTCATGGGTGGG + Intronic
1059962097 9:119575596-119575618 AAGCCTCCAGTCTAATGGGCAGG + Intergenic
1061744098 9:132727165-132727187 AAGGCTGCTGTTTCACATGCTGG + Intronic
1062021078 9:134319697-134319719 CAGCCTCCTGTTTCATTTGCAGG - Intronic
1190303883 X:49071770-49071792 TAGGCTCCTGTTTTAAGTGCTGG + Exonic
1191720007 X:64221579-64221601 AAGGCTCCAGTTTCATGAATGGG - Intergenic
1192146731 X:68687724-68687746 AAGGCTCCTGGGTCAGGGCCAGG - Intronic
1194483024 X:94450562-94450584 AAGGCACCAGTTTCATGCCCTGG - Intergenic
1197745166 X:129927923-129927945 AAAGCTCCTGTTTCCTTGCCTGG - Intronic