ID: 1182116680

View in Genome Browser
Species Human (GRCh38)
Location 22:27760683-27760705
Sequence CGGGCTCTGCGTGGCCCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182116680_1182116687 -8 Left 1182116680 22:27760683-27760705 CCACCGGGGCCACGCAGAGCCCG 0: 1
1: 0
2: 0
3: 23
4: 234
Right 1182116687 22:27760698-27760720 AGAGCCCGAGGCAGGCCCAGGGG 0: 1
1: 0
2: 2
3: 36
4: 381
1182116680_1182116692 8 Left 1182116680 22:27760683-27760705 CCACCGGGGCCACGCAGAGCCCG 0: 1
1: 0
2: 0
3: 23
4: 234
Right 1182116692 22:27760714-27760736 CCAGGGGACTAGCCACTCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 128
1182116680_1182116685 -10 Left 1182116680 22:27760683-27760705 CCACCGGGGCCACGCAGAGCCCG 0: 1
1: 0
2: 0
3: 23
4: 234
Right 1182116685 22:27760696-27760718 GCAGAGCCCGAGGCAGGCCCAGG 0: 1
1: 0
2: 2
3: 68
4: 626
1182116680_1182116686 -9 Left 1182116680 22:27760683-27760705 CCACCGGGGCCACGCAGAGCCCG 0: 1
1: 0
2: 0
3: 23
4: 234
Right 1182116686 22:27760697-27760719 CAGAGCCCGAGGCAGGCCCAGGG 0: 1
1: 0
2: 3
3: 40
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182116680 Original CRISPR CGGGCTCTGCGTGGCCCCGG TGG (reversed) Intronic
900095702 1:939300-939322 GGGGCCCAGCATGGCCCCGGAGG + Exonic
900124899 1:1064888-1064910 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124927 1:1064948-1064970 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124942 1:1064978-1065000 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124957 1:1065008-1065030 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900124985 1:1065068-1065090 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125013 1:1065128-1065150 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125028 1:1065158-1065180 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125043 1:1065184-1065206 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125056 1:1065215-1065237 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900125083 1:1065275-1065297 TGGGGTCTGCGGGGCCCTGGGGG + Intergenic
900157030 1:1207231-1207253 CGGGCCCTGGGTGCCCGCGGGGG - Intergenic
900191891 1:1355581-1355603 TGGGACCTGCGCGGCCCCGGGGG - Exonic
900356700 1:2268401-2268423 CAGGCTCTGCGTGGCGCTGATGG + Intronic
901413850 1:9103834-9103856 CGGGCTGTGCTTGCCCCTGGTGG + Exonic
904130118 1:28269198-28269220 CGGGCTCGGCGAGGCCCTCGAGG + Exonic
904602910 1:31683603-31683625 AGGGCTCTGCCTGCCCCCAGAGG - Intronic
906707193 1:47903504-47903526 CTGGCTCTGCTGGGCCCTGGGGG - Intronic
908572065 1:65420606-65420628 GGGGCTCTGCGTGGCCGGGGCGG + Exonic
912481530 1:109985178-109985200 GGGGCTCTGGGTGGCGGCGGGGG + Intronic
914753200 1:150549478-150549500 CCTGCTCTGCGAGCCCCCGGTGG - Exonic
916961424 1:169893636-169893658 CGAGCTCGGCGCGGCGCCGGCGG - Intronic
917433917 1:174999949-174999971 CGGGCTGTGCGTGCTCGCGGTGG + Exonic
923864674 1:237927105-237927127 TGAGCTGTGCGTGGCCCTGGAGG + Intergenic
924042483 1:239997714-239997736 CGGGCTCGGCGCGGGCCGGGAGG - Intergenic
1063009805 10:2011261-2011283 CAGGCACAGCGTGGCCCCTGTGG + Intergenic
1065090575 10:22229175-22229197 CCAGCTCTGCGCGTCCCCGGAGG - Intergenic
1067216942 10:44311053-44311075 CGGGGTCTGCGCGGCTGCGGTGG + Intergenic
1067945029 10:50683751-50683773 TGGGCTCCCCGTGGCCCCGAGGG - Intergenic
1069964772 10:72105331-72105353 CAGGCTCTGTGTGGGCCCCGTGG - Intronic
1070579948 10:77711555-77711577 CGGGCTCAGCGTGGCTGTGGCGG - Intergenic
1072615046 10:97043566-97043588 CGGAAGCTGCGTGGCCCAGGTGG - Intronic
1072970124 10:100009996-100010018 CGCGGTCCGCGCGGCCCCGGGGG + Intergenic
1073122559 10:101131568-101131590 TGGGCTCTGCGTGACCCGGGTGG - Exonic
1076634936 10:131875823-131875845 CAGGCCCTGCGTGGCTCCTGGGG - Intergenic
1076687980 10:132206705-132206727 CGGTCTCTGCGAGGGCCCAGAGG - Intergenic
1076710676 10:132332121-132332143 CGCGCTCAGCGTGGCGCCTGCGG + Intergenic
1076852565 10:133100185-133100207 TGGGCCCAGCATGGCCCCGGCGG + Intronic
1077156462 11:1094224-1094246 TGGGGTCTGCGGGGCCCCTGAGG + Intergenic
1077194377 11:1272085-1272107 CGGGCCCTGCGTGTCCTCTGGGG - Intergenic
1077217414 11:1400747-1400769 CCGGCTCTGCCTGGGCCCTGCGG + Intronic
1077358072 11:2127770-2127792 CCGGCCCTGCGTGGGCCTGGGGG + Intergenic
1077413151 11:2412807-2412829 CGGGCCCTGAGGGGCCCTGGGGG + Exonic
1077539085 11:3138277-3138299 CGGGCTGGGCGTGGTCCCTGAGG + Intronic
1081873146 11:46392178-46392200 AGCGCCCTGCGTGGCCCCGCTGG + Intergenic
1083258318 11:61509812-61509834 CGGGCTCTGGGCGCCCCCGGGGG + Exonic
1083651884 11:64208825-64208847 CCAGCTCTGCATGGCCCCGAAGG + Intronic
1083768024 11:64851450-64851472 AGGGCTCTGTGTGGCCACAGAGG - Intergenic
1084477799 11:69398809-69398831 GGGGCTCTGCAGGCCCCCGGTGG - Intergenic
1084546783 11:69818683-69818705 CGGACGCTGCGGGGCCCCGGGGG - Intronic
1089243126 11:117098433-117098455 CCGGCTCCCCGCGGCCCCGGAGG - Exonic
1089697372 11:120224536-120224558 CAGGCTCTGAGTGGCCCCCTTGG - Intronic
1089835034 11:121363091-121363113 CGGGCCCCGCTTCGCCCCGGCGG - Intergenic
1090256454 11:125287884-125287906 AGGGCTCTGTGTGGCCCCCCTGG - Intronic
1091685032 12:2555490-2555512 GGGGCTCAGCATGGCCCCGCTGG + Intronic
1091832546 12:3560113-3560135 AGGGCCCTGCGTGGCCTCGCTGG - Intronic
1092204479 12:6606939-6606961 CGGGCGCTGCGGGGGGCCGGAGG + Intronic
1092871956 12:12813269-12813291 CGTGCTCTGCGCGCCCCCTGCGG - Intronic
1098226822 12:68332578-68332600 CGGGCTGGGCGGGACCCCGGGGG + Intergenic
1101717099 12:107320542-107320564 CGTGCACTGCGTGCCCCCCGAGG - Intronic
1103407715 12:120687383-120687405 CGGGCTCGGCGTGGCCGGCGTGG + Exonic
1104604642 12:130179194-130179216 AGGTCTCTGGGTGGCCCCTGTGG - Intergenic
1105070389 12:133231067-133231089 TGGGCTCTGGGTGGCCACTGAGG - Intronic
1105408443 13:20150714-20150736 CAGGCTCTGCGGGGCCTCAGGGG - Intronic
1106242818 13:27924205-27924227 GGGGCTGTGCGGGGCTCCGGGGG + Intronic
1109284837 13:60397554-60397576 AGGGCTCCGCGTGGCGCCGGGGG - Intronic
1112498818 13:99926565-99926587 CGGGCTGTGCGGGGACCCAGCGG - Intergenic
1112508139 13:99987799-99987821 CGCGCTCTGCGTCTCCACGGCGG - Intergenic
1113613895 13:111667968-111667990 CCGGCTCTGCATGGCCTCAGAGG - Intronic
1113850199 13:113413507-113413529 GGGGCTCTGCGTGTCTCCCGAGG + Intergenic
1113940432 13:114015969-114015991 CGGGCTCTGCGTCCCCTGGGGGG - Intronic
1115454007 14:33580576-33580598 CTGGTTCTGCATTGCCCCGGGGG - Intronic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1118849326 14:69572389-69572411 CGCGCTCTTCGCGGCCACGGCGG + Exonic
1119728325 14:76935684-76935706 TGGGCTCTCAGTGGCCCCGAGGG - Intergenic
1122418586 14:101561721-101561743 CGGGCTCGGGCTGCCCCCGGCGG - Exonic
1122543696 14:102510947-102510969 AGGCCTCTGCCTCGCCCCGGTGG + Intergenic
1122582371 14:102778280-102778302 CGGGCTCTGCGTCTTCCCCGCGG + Intronic
1122598816 14:102910707-102910729 CAGGCTCTGCTTGGCCACCGGGG - Exonic
1122782233 14:104148644-104148666 GGGGCTGTGCGTGGCCGGGGAGG + Intronic
1123500632 15:20878121-20878143 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1123557877 15:21451814-21451836 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1127261520 15:57330103-57330125 CGGGTGCTGGGTGACCCCGGAGG + Intergenic
1127995605 15:64151813-64151835 CGGGCTCTGCCTGGGCCCCTCGG - Exonic
1128099904 15:64989958-64989980 GCGGTGCTGCGTGGCCCCGGCGG + Intronic
1130014365 15:80175506-80175528 CTGGCTCTGTGTGGCCCCAGGGG - Intronic
1132320151 15:100919503-100919525 CGGGCTCTGGGTTCCCCGGGCGG - Intronic
1202966228 15_KI270727v1_random:178986-179008 TGAGCTCTGCGTGCGCCCGGCGG + Intergenic
1132544800 16:528114-528136 CGGGCTCGGCGGGGCGCAGGAGG + Intronic
1132803111 16:1763791-1763813 CGGGCGCTGCGGGGACCGGGCGG + Intronic
1135821948 16:25692632-25692654 CGGGCTCGGCGGGGGCTCGGCGG - Exonic
1136498710 16:30659280-30659302 CGGGCTCGGCGGGGCCGCGACGG - Exonic
1140478780 16:75251599-75251621 CCGGCTCTGGGTGGCCGAGGCGG - Intronic
1141677501 16:85525276-85525298 CGGGCTGTCTGTGCCCCCGGCGG - Intergenic
1141839524 16:86565903-86565925 TCGGCTCTGCCTGGCCCGGGTGG + Intergenic
1142130725 16:88430473-88430495 CGGGGTCTGCGCGGCTCCCGGGG - Exonic
1142197759 16:88746572-88746594 TGGGCTTGGCGTGGCCCTGGTGG - Intronic
1142269495 16:89081773-89081795 CTGGCTCTGCATGGCCCCAGCGG + Intergenic
1143205902 17:5139139-5139161 GGGTCTCTGTGTGGCCCCTGTGG - Intronic
1143584417 17:7844170-7844192 GGGGAACCGCGTGGCCCCGGCGG + Intronic
1145761779 17:27429620-27429642 GGGTCTCTGTGTGGCCCCTGTGG - Intergenic
1146842708 17:36166656-36166678 GGGTCTCTGTGTGGCCCCCGTGG + Intronic
1146855021 17:36254615-36254637 GGGTCTCTGTGTGGCCCCCGTGG + Intronic
1146865599 17:36333760-36333782 GGGTCTCTGTGTGGCCCCCGTGG - Intronic
1146870921 17:36378508-36378530 GGGTCTCTGTGTGGCCCCCGTGG + Intronic
1146878279 17:36429590-36429612 GGGTCTCTGTGTGGCCCCCGTGG + Intronic
1146882228 17:36450736-36450758 GGGTCTCTGTGTGGCCCCCGTGG + Intergenic
1147068468 17:37934372-37934394 GGGTCTCTGTGTGGCCCCCGTGG - Intronic
1147073805 17:37979132-37979154 GGGTCTCTGTGTGGCCCCCGTGG + Intronic
1147079991 17:38013909-38013931 GGGTCTCTGTGTGGCCCCCGTGG - Intronic
1147085326 17:38058670-38058692 GGGTCTCTGTGTGGCCCCCGTGG + Intronic
1147095940 17:38137869-38137891 GGGTCTCTGTGTGGCCCCCGTGG - Intergenic
1147101273 17:38182636-38182658 GGGTCTCTGTGTGGCCCCCGTGG + Intergenic
1147285758 17:39401698-39401720 CGGGCGCTCCGAGGCCCGGGCGG - Intronic
1147537101 17:41328134-41328156 GGGTCTCTGTGTGGCCCCCGTGG - Intergenic
1148101413 17:45094140-45094162 GGGGCTCTGGGTGGCCGGGGTGG - Intronic
1148139329 17:45317104-45317126 CGGGGGAGGCGTGGCCCCGGGGG - Intergenic
1148564717 17:48626066-48626088 CGGGCTCAGCGGCGCCCAGGAGG + Exonic
1149845870 17:60009142-60009164 GGGTCTCTGTGTGGCCCCCGTGG + Intergenic
1149884512 17:60327507-60327529 CGGGCTCAGCCTGGCTCCTGAGG - Intronic
1150084221 17:62265722-62265744 GGGTCTCTGTGTGGCCCCCGTGG + Intergenic
1150442729 17:65204160-65204182 CAGGCTGTTCCTGGCCCCGGGGG + Exonic
1152124500 17:78438204-78438226 AGGGCTAAGCCTGGCCCCGGTGG - Intronic
1152403363 17:80082766-80082788 GGGGCTCGGCGGGGGCCCGGGGG - Intronic
1152552167 17:81035317-81035339 CGGGCTCAGCTCGGCGCCGGGGG - Intronic
1152654066 17:81511968-81511990 CGAGCTGCGCGTGGCCCCGGAGG - Exonic
1152841381 17:82570942-82570964 GGGGCTCTTCGTGGGCCAGGGGG + Intronic
1160333760 18:78018485-78018507 CGGGCTCTGCCTGGCCTTGCAGG - Intergenic
1160508288 18:79439349-79439371 GGGCCTCTGCGTGGCTCCTGGGG - Intronic
1160760712 19:782742-782764 CGGGTCCAGGGTGGCCCCGGCGG - Intergenic
1160864539 19:1251012-1251034 TGGACACTGCGTGTCCCCGGAGG - Intronic
1161063517 19:2226841-2226863 CGGCCCCGGCCTGGCCCCGGCGG + Exonic
1161163222 19:2772050-2772072 CGGGCTGGGCCCGGCCCCGGAGG - Intronic
1161356484 19:3822025-3822047 CGGGCTGTGCTAGGGCCCGGCGG - Intronic
1161709108 19:5837923-5837945 CGGGCTCTGAGTGTCCCTCGAGG - Intronic
1162337911 19:10073025-10073047 TGGGCTCTGCCTGTCCCCTGTGG - Intergenic
1162901036 19:13795656-13795678 CCGGCTCCGCTTGGCCGCGGGGG - Exonic
1163442440 19:17328725-17328747 CGGGGGCTGCGGGGCGCCGGAGG - Exonic
1165871361 19:38975667-38975689 CGTGATCGGCGTGGCCCAGGGGG + Exonic
1166080996 19:40444115-40444137 CGGGGTCTGGGTGGGACCGGGGG - Intronic
1167144328 19:47672863-47672885 AGGGCTCAGCCTTGCCCCGGTGG + Intronic
1168199426 19:54804209-54804231 TGAGCTCTGTGTGGCCCAGGCGG + Intronic
1168412049 19:56146399-56146421 CCTGCTCTGCCTGGCCCAGGGGG - Exonic
1168694417 19:58396579-58396601 CGGGCCTTGCGCGGCCCGGGCGG - Exonic
925337632 2:3109433-3109455 CTGGCGCTGCCTGGCCCGGGAGG - Intergenic
925778239 2:7355937-7355959 CGGGCTCTGTGTGGGGCAGGTGG + Intergenic
927777784 2:25915558-25915580 CCGGGTGGGCGTGGCCCCGGCGG + Intergenic
930075665 2:47403551-47403573 CAGGTTCTGCTTGGCTCCGGAGG + Intronic
932091894 2:68813329-68813351 CGGGCTCTGGGAGGTCTCGGAGG - Exonic
932852498 2:75200415-75200437 CGGGCTCGGGGTGGCATCGGTGG + Intergenic
933832766 2:86224208-86224230 GGGGCTCTGCATGGCCCCAGAGG + Intronic
934539129 2:95159794-95159816 CTGGCTCTGAAGGGCCCCGGCGG - Intronic
937103863 2:119292412-119292434 AGGGCTCTGCGTATGCCCGGAGG - Intergenic
939460152 2:142488614-142488636 CAGGCTCTGTGTGGGCCCTGTGG - Intergenic
944221730 2:197310423-197310445 CGGGCTCTCGGAGGCACCGGCGG + Intronic
946410479 2:219512999-219513021 CAGCCTCTGCCTGGCCCCAGGGG - Intergenic
946419744 2:219558048-219558070 CCCGCTCTGTGTGGCCCCTGGGG - Exonic
947595956 2:231412099-231412121 CGGGCTCCGCCTGCCCCCCGCGG + Intergenic
947729430 2:232419890-232419912 GGGCCTCTGCATGGCCCCGGGGG + Intergenic
948983781 2:241508241-241508263 CGGGCGTGGCGGGGCCCCGGCGG - Intronic
1168965149 20:1894458-1894480 CGGCCTCTGGGCAGCCCCGGCGG + Exonic
1168992031 20:2103136-2103158 CGGGCGCAGCGGGGCCCGGGTGG + Exonic
1172284627 20:33732104-33732126 CGGGCGCTGCGAGGGCGCGGCGG - Intronic
1172786657 20:37473159-37473181 AGGGCTCTGAGTGGCCTCCGGGG + Intergenic
1174298728 20:49567665-49567687 CAGCCTCTGCGTGGCCCGGGTGG - Intronic
1176218423 20:63958917-63958939 CTGGCTCTGAGTGGCCACTGGGG - Exonic
1176548994 21:8213493-8213515 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1176550025 21:8217033-8217055 CGGCCGCCGCGGGGCCCCGGCGG + Intergenic
1176556887 21:8257705-8257727 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1176567923 21:8396523-8396545 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1176575827 21:8440742-8440764 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1179886841 21:44317875-44317897 AGGGCTGTCTGTGGCCCCGGGGG + Intronic
1180076769 21:45467120-45467142 CGGGCTCTGCCTGGCACGGCAGG + Intronic
1180077159 21:45468738-45468760 CGGGCTCTTCGTGGCTCAGGCGG + Exonic
1180142266 21:45899809-45899831 CTGGCTCTGCGTGGCCTGAGGGG + Intronic
1182116680 22:27760683-27760705 CGGGCTCTGCGTGGCCCCGGTGG - Intronic
1182469975 22:30542504-30542526 CGGCCTCTGGGCAGCCCCGGCGG + Intronic
1183424941 22:37734434-37734456 GGGGCTCTGCTTGGCTCCGCCGG - Exonic
1184042458 22:41952202-41952224 GGGGCTCTGAGTGGGCCAGGAGG - Intergenic
1185063255 22:48618055-48618077 CAGGCTCTGTGTGGACACGGAGG + Intronic
1185065777 22:48631088-48631110 CTGCCTCTGCCTGGCCCAGGAGG - Intronic
1185320044 22:50196411-50196433 CCGGCGCTGTGTGGCCCCCGGGG + Intronic
1203253878 22_KI270733v1_random:129800-129822 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1203254915 22_KI270733v1_random:133359-133381 CGGCCGCCGCGGGGCCCCGGCGG + Intergenic
1203261934 22_KI270733v1_random:174879-174901 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1203262971 22_KI270733v1_random:178438-178460 CGGCCGCCGCGGGGCCCCGGCGG + Intergenic
949129370 3:482803-482825 CGGGAACTGCGTGACCCCGGAGG + Intergenic
949129391 3:482892-482914 CGGGAACTGCGTGACCCCGGAGG + Intergenic
949129411 3:482981-483003 CGGGAACTGCGTGACCCCGGAGG + Intergenic
949129431 3:483070-483092 CGGGAACTGCGTGACCCCGGAGG + Intergenic
949129452 3:483159-483181 CGGGAACTGCTTGACCCCGGAGG + Intergenic
949129472 3:483248-483270 CGGGAACTGCGTGACCCCGGAGG + Intergenic
949129493 3:483337-483359 CGGGAACTGCTTGACCCCGGAGG + Intergenic
949129514 3:483426-483448 CGGGAACTGCGTGACCCCGGAGG + Intergenic
949129535 3:483515-483537 CGGGAACTGCGTGACCCCGGAGG + Intergenic
952152404 3:30606995-30607017 CGGGCTCGGCGGGGCGCCGGGGG + Intronic
954327144 3:49869794-49869816 CGGGCTCAGCGGGGCGCCGAGGG + Exonic
961213231 3:125141503-125141525 GGGGCTCTGGGTGGCACCTGCGG + Intronic
961417058 3:126766892-126766914 CCTGCTCTGCGTGGCCCAGCCGG + Intronic
961432089 3:126890496-126890518 AGGACTCTGCGAGGCCCCTGGGG + Intronic
961562519 3:127740555-127740577 GGGGCTCTGCGGGGGCCCTGAGG + Intronic
961735147 3:128996815-128996837 CTGGCTCTTCGTGGGCCCGCTGG + Intronic
967414363 3:189200145-189200167 AGGACTCTGCCTGGCCCAGGTGG + Intronic
967989507 3:195120753-195120775 CCGACTCTGCGGGGTCCCGGAGG + Intronic
968077796 3:195825831-195825853 GGGCCTCTGCGTAGCCCCCGTGG - Intergenic
969615935 4:8252580-8252602 AGGGCTGTGCGTGGCCAGGGTGG + Intergenic
980053792 4:128061527-128061549 CGGGCGCTGCGCGGCCTCGGCGG + Intronic
983204827 4:164901502-164901524 TGGGCTCTACATGGCCCTGGTGG + Intergenic
985064325 4:186105538-186105560 CGGCGCCTGCGTGGCCCCCGGGG + Intronic
985481079 5:111312-111334 CAGGCCCTGAGTGGCCCCAGTGG + Intergenic
986721137 5:10562787-10562809 CGGCATCTGCAGGGCCCCGGAGG - Intergenic
997265013 5:132490393-132490415 CGGGCTCCGGGGGGCGCCGGAGG - Intronic
997639819 5:135441856-135441878 GGGGCCCTGCGTGGCCCTGCTGG + Intergenic
998903315 5:146878267-146878289 CGGGTTCTGCGAGGCTGCGGCGG + Intronic
999391915 5:151199446-151199468 CTGGCTCTGTGTGACCCCAGAGG - Intronic
1006396090 6:33788652-33788674 CGGGCCCTGCGTGGCCCTGTCGG + Exonic
1007482307 6:42158232-42158254 CTGGCTCTGCTAGGCCCTGGGGG + Intronic
1007985705 6:46205251-46205273 CGAGCTGTGCGTGGCCCTGGAGG + Intergenic
1010208989 6:73348390-73348412 CAAGGTCTGCGAGGCCCCGGGGG + Intergenic
1017791304 6:157802012-157802034 TGGGCTCAGGGTGGCCCCAGGGG + Intronic
1017954920 6:159169587-159169609 CGGGCTCTCGATGGCCCCCGAGG + Exonic
1019177090 6:170165475-170165497 TGGGGGCTGCGTGGCCCCTGCGG - Intergenic
1019257587 7:61942-61964 GGGGCTGTGCCTGGCCCTGGGGG - Intergenic
1019647982 7:2141222-2141244 GGGGCACTGCGTGGCCCTGTAGG - Intronic
1019947109 7:4338504-4338526 AGGGCTCTGCATGGCACTGGGGG + Intergenic
1020055911 7:5117447-5117469 GGGCCTCTTCGTGGCCCTGGGGG + Intergenic
1021613772 7:22482041-22482063 ATGGCTCTGCCTGGCCCCTGTGG - Intronic
1024524374 7:50336233-50336255 GGAGCCCTGCCTGGCCCCGGCGG + Intronic
1029461023 7:100694020-100694042 CGGGCTCGGCGCGGCCGCCGCGG + Intergenic
1030176544 7:106660544-106660566 CGGGCTGTAGGGGGCCCCGGGGG + Exonic
1032515753 7:132504882-132504904 CAGGCTCTGTGTTGCCCCGATGG - Intronic
1032781880 7:135170453-135170475 CGGGGTCAGCGAGGCCCCTGCGG - Intronic
1035624303 8:1059888-1059910 CGCATTCTGTGTGGCCCCGGGGG + Intergenic
1038539693 8:28382010-28382032 TGGGCTCTGGGTGGCCACTGAGG - Intronic
1040016760 8:42706488-42706510 TGCCCTCAGCGTGGCCCCGGTGG + Intronic
1040107458 8:43548777-43548799 CAGGCCCTGCGTGGACCCTGAGG - Intergenic
1049668477 8:143859237-143859259 CGGGCACCGCGCGCCCCCGGAGG + Exonic
1049668895 8:143860845-143860867 CGGGCACCGCGCGCCCCCGGAGG + Exonic
1049669310 8:143862447-143862469 CGGGCACCGCGCGCCCCCGGAGG + Exonic
1049669722 8:143864040-143864062 CGGGCACCGCGCGCCCCCGGAGG + Exonic
1049670137 8:143865648-143865670 CGGGCACCGCGCGCCCCCGGAGG + Exonic
1059720981 9:116959899-116959921 AGGGCTTTGCGTGGCCCTGATGG - Intronic
1060514701 9:124258298-124258320 CGGGGTGTGCGCGTCCCCGGCGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060770074 9:126326524-126326546 CGGGCTCGGGGAGGCCCGGGTGG + Intergenic
1061222211 9:129258712-129258734 AGGGGTCCGCGTGGCCCGGGCGG + Intergenic
1061583917 9:131554600-131554622 CGGGCTTCGCGGGGCTCCGGGGG - Intergenic
1061617181 9:131787869-131787891 CAGACCCTGCGTGGCCCCAGAGG - Intergenic
1061894656 9:133640929-133640951 TGGGCTCTGGGTGGCCGGGGTGG + Intronic
1062236684 9:135513644-135513666 CTGGCCCTGCGTGGCCCACGTGG + Intergenic
1062396967 9:136356484-136356506 GGGGCTCGCCGTGGCCTCGGAGG - Exonic
1203470278 Un_GL000220v1:112944-112966 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1203478099 Un_GL000220v1:156916-156938 CGGGGTTCGCGTGTCCCCGGCGG + Intergenic
1185622837 X:1464126-1464148 CGGGCTCTGCGTCTCCGCAGTGG - Exonic
1186496576 X:10015979-10016001 CGAGCTCTGCCCGGGCCCGGGGG - Intronic
1190873000 X:54440463-54440485 TGGGGTCTGCGCGGCCCTGGAGG + Exonic
1194977323 X:100408694-100408716 CGCGCGCCCCGTGGCCCCGGAGG + Exonic
1199432392 X:147776241-147776263 CAGGCTCTGTGTGGGCCCTGAGG + Intergenic