ID: 1182116860

View in Genome Browser
Species Human (GRCh38)
Location 22:27761681-27761703
Sequence CCTGCCCATCATGAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182116860_1182116880 28 Left 1182116860 22:27761681-27761703 CCCCCCAACTCATGATGGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1182116880 22:27761732-27761754 GCCCCACGAGGGTGAAGCAGAGG 0: 1
1: 0
2: 2
3: 14
4: 138
1182116860_1182116870 6 Left 1182116860 22:27761681-27761703 CCCCCCAACTCATGATGGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1182116870 22:27761710-27761732 CTGCAAGGCCCCCCCGTTCCAGG 0: 1
1: 0
2: 0
3: 8
4: 123
1182116860_1182116869 -9 Left 1182116860 22:27761681-27761703 CCCCCCAACTCATGATGGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1182116869 22:27761695-27761717 ATGGGCAGGAGGGGTCTGCAAGG 0: 1
1: 0
2: 2
3: 37
4: 361
1182116860_1182116874 16 Left 1182116860 22:27761681-27761703 CCCCCCAACTCATGATGGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1182116874 22:27761720-27761742 CCCCCGTTCCAGGCCCCACGAGG No data
1182116860_1182116876 17 Left 1182116860 22:27761681-27761703 CCCCCCAACTCATGATGGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1182116876 22:27761721-27761743 CCCCGTTCCAGGCCCCACGAGGG 0: 1
1: 0
2: 1
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182116860 Original CRISPR CCTGCCCATCATGAGTTGGG GGG (reversed) Intronic
901807078 1:11745326-11745348 CGTGGCCATCTTGATTTGGGTGG + Intronic
904266376 1:29320580-29320602 ACTGCCCACCCTGAGTTGGACGG - Intronic
906436832 1:45803643-45803665 CCTGCCCAACGTGTGCTGGGTGG + Exonic
907977322 1:59444592-59444614 GCTGCACAGCATGAGGTGGGCGG + Intronic
909732505 1:78912323-78912345 CCTGGCCATGATGAGTTGGAAGG + Intronic
911365462 1:96932492-96932514 TCTTCCCATCTTGACTTGGGTGG + Intergenic
911649906 1:100376141-100376163 CCTGCCTGTCATGGGGTGGGGGG + Intronic
912126823 1:106549771-106549793 CCTGACCAGCATGAATTGAGGGG - Intergenic
912456082 1:109798349-109798371 TCTTCCCATCAAGAGGTGGGGGG - Intergenic
912831929 1:112960281-112960303 CATGCCAATCATTAGATGGGAGG - Intergenic
914814774 1:151055444-151055466 CCTGTCCATTCTGAGCTGGGTGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918244800 1:182649611-182649633 CCTGCTCATCTTGTGTTGGTTGG - Intronic
920595716 1:207267920-207267942 ACTGTTCATCATGATTTGGGGGG - Intergenic
922681630 1:227603211-227603233 CATGCCCATCATGACGTGGGAGG - Intronic
924163221 1:241255351-241255373 CCTGTCAATGATGAGTTGGAAGG - Intronic
1064904609 10:20331894-20331916 CCTGGCCATGATGGGATGGGAGG + Intergenic
1066695443 10:38073260-38073282 TCTGGCCATGATGAGATGGGAGG + Intergenic
1066696795 10:38086234-38086256 CCTGGCCATGACGAGATGGGAGG - Intergenic
1066995763 10:42561486-42561508 CCTGGCCATGATGGGATGGGAGG + Intergenic
1066997048 10:42573993-42574015 TCTGGCCATGATGAGATGGGAGG - Intergenic
1068034506 10:51742869-51742891 GCTGCCCTTCAGGAGGTGGGGGG + Intronic
1069546020 10:69329611-69329633 CCTGTCATTCATGAGTTGTGTGG - Intronic
1070574552 10:77667691-77667713 TCTGGACATCATGAGTTGAGGGG - Intergenic
1073208951 10:101783085-101783107 CCTGCCCCAGATGTGTTGGGCGG - Intronic
1074233539 10:111561902-111561924 GATGCCCATCAGGAGTTGAGTGG + Intergenic
1074291072 10:112138376-112138398 CCTGCCCTCGAGGAGTTGGGAGG + Intergenic
1074446471 10:113525178-113525200 CCAGCTCCTCATCAGTTGGGAGG - Intergenic
1076507134 10:130985608-130985630 CCCGTCCATCATGGGCTGGGAGG - Intergenic
1078133073 11:8629461-8629483 CCTGACCATTATTATTTGGGTGG - Intronic
1079783912 11:24646017-24646039 TCTGCCTCTCATGAGTTGTGTGG + Intronic
1080646290 11:34190325-34190347 CCTGCCACTCACGAGCTGGGTGG - Intronic
1083919443 11:65774128-65774150 CCTGGCCCTGATGGGTTGGGAGG - Intergenic
1085607106 11:77911073-77911095 CCTGCCGAGCATGAGATGGGAGG - Intronic
1086106056 11:83148561-83148583 CAAGCACATCATTAGTTGGGAGG - Intergenic
1086783121 11:90931443-90931465 CCTTCCCATGAGGAGTTGAGAGG + Intergenic
1087347580 11:96991278-96991300 ACTGCCCATCATGAACTTGGGGG + Intergenic
1089183025 11:116595934-116595956 GCAGCCCAGCATGAGCTGGGAGG + Intergenic
1089505886 11:118961593-118961615 CCTGCCCCTTCTGAGTTGGCAGG - Intergenic
1091277584 11:134362813-134362835 CCTGGTCACCATGAGATGGGAGG - Intronic
1099808754 12:87553746-87553768 CCTGCCCATGATGAGATCAGAGG + Intergenic
1102867788 12:116387690-116387712 CCAGCTCCTCATGAGGTGGGAGG + Intergenic
1103044636 12:117725829-117725851 CCTCCCCCTCTTGAGTCGGGGGG - Intronic
1103713989 12:122932469-122932491 CATGCCCCTTATGAGTTGGGTGG - Intronic
1103863033 12:124029450-124029472 CCTGCCCTTGATGTGTTGGGGGG + Intronic
1104855495 12:131900582-131900604 CCTGCCCAGCATGCCCTGGGAGG + Intronic
1105328018 13:19387814-19387836 CCTGCCCTACATGAGCTGGCAGG + Intergenic
1105863888 13:24441875-24441897 CCTGCCCTACATGAGCTGGCAGG - Exonic
1106620135 13:31364777-31364799 CCTGCCCCTTCTGAGTTTGGAGG + Intergenic
1108088191 13:46818115-46818137 CCTGTCCCTTCTGAGTTGGGAGG + Intergenic
1108690898 13:52858176-52858198 CATGTCCATCATGAATTGGCTGG + Intergenic
1112608349 13:100930151-100930173 CCTGGCCACAATGAGATGGGAGG - Intergenic
1112766542 13:102751894-102751916 CCTGACCATGATGGGATGGGAGG + Intronic
1113030104 13:105983445-105983467 CCTACCCAACATGACTTGAGAGG - Intergenic
1120141353 14:80933172-80933194 CCTGCCCATCATTCGTGGTGTGG + Intronic
1122044371 14:99012725-99012747 CCAGCCCATCAGGAGCAGGGAGG + Intergenic
1122979598 14:105185609-105185631 CCTGCCAAGGATGAGATGGGAGG + Intergenic
1124657005 15:31516845-31516867 GGAGGCCATCATGAGTTGGGAGG - Intronic
1127773038 15:62245652-62245674 CCTGCCCTTCTTGAATTGGGCGG + Intergenic
1128475150 15:67991157-67991179 CCTGCTAATCATGAGATTGGAGG - Intergenic
1128732837 15:70032852-70032874 GCTGCCCCTTATGAGTTCGGGGG - Intergenic
1128976988 15:72161353-72161375 CCGGCCCCTCATGAGGTGGCTGG - Exonic
1129691524 15:77716672-77716694 CCTGCCCATCTTGGCTTGGGAGG - Intronic
1130730159 15:86483483-86483505 CCTGGCCATGATGGGATGGGAGG - Intronic
1132305729 15:100810777-100810799 GCTGCCCATCATGAACTAGGTGG - Intergenic
1132978897 16:2724872-2724894 CCTGCCCCTTCTGAGTTGGCAGG + Intergenic
1134109575 16:11506781-11506803 CCTGCCCACCATCAATGGGGAGG + Intronic
1135000438 16:18772348-18772370 CCTGCTGATCTGGAGTTGGGGGG + Intergenic
1138186778 16:54983251-54983273 CATGACCACCATTAGTTGGGAGG - Intergenic
1142376385 16:89709031-89709053 CGTGCACATCAGGAGGTGGGTGG - Intronic
1145223660 17:21109581-21109603 CCTGCCCATGATGGGAAGGGAGG + Intergenic
1145284983 17:21498670-21498692 CCTGGCCATGATGGGATGGGAGG + Intergenic
1146162048 17:30565337-30565359 CCTTCCCAGCCTGAGTTGGCTGG - Intergenic
1148342376 17:46881052-46881074 CCTTCCCAACATGCTTTGGGAGG + Intronic
1148439904 17:47706556-47706578 CCTGCTCACCATCAGATGGGTGG + Intronic
1149160520 17:53687266-53687288 CCTGCCCCTTCTGAGTTGGTGGG - Intergenic
1151230553 17:72681942-72681964 CCTGCACAGCAGGAGATGGGCGG + Intronic
1156681539 18:39595104-39595126 CATGAACATCAGGAGTTGGGGGG + Intergenic
1160073691 18:75651389-75651411 CCTGGCTATTATAAGTTGGGTGG - Intergenic
1161542124 19:4858331-4858353 CCTGCCCCTCAGCAGCTGGGTGG - Intronic
1163870336 19:19816041-19816063 CCTTCCCATTATGAGTTAGATGG + Intronic
1164256685 19:23533757-23533779 GCCGCCCATCATGAGATGTGGGG - Intronic
1164438248 19:28251080-28251102 CCTGTCCATCACTAGTTGAGGGG + Intergenic
1164518408 19:28956669-28956691 CCTGGCCATGATGGGATGGGAGG - Intergenic
1165022499 19:32935988-32936010 CCTGCCCCTTCTGAGTTGGTGGG + Intronic
1165099204 19:33428504-33428526 GCTGCCCTTCAGGAGCTGGGAGG + Intronic
1166468805 19:43059528-43059550 CCTGGCCATCCAGAGTGGGGAGG + Intronic
1166479950 19:43163049-43163071 CCTGGCCATCCAGAGTGGGGAGG + Intronic
1166489776 19:43248580-43248602 CCTGGCCATCCAGAGTGGGGAGG + Intronic
1166770709 19:45280452-45280474 CCTGCCCAGCAGGAGGTAGGTGG - Exonic
925019330 2:556261-556283 CCTGGCCATGATGGGATGGGAGG + Intergenic
925145223 2:1578256-1578278 CCTGGCCATGATGGGATGGGAGG + Intergenic
926220266 2:10931625-10931647 CCCTCCCATCATGACTTGGGAGG + Intergenic
929991590 2:46794058-46794080 TCTGGCCATGATGAGATGGGAGG - Intergenic
931644368 2:64408274-64408296 TCTGCCCATCAATAGTTGGCTGG + Intergenic
935588726 2:104825453-104825475 CATGTCCATTATGGGTTGGGAGG - Intergenic
936383670 2:112010308-112010330 CCTTACCAACTTGAGTTGGGTGG + Intronic
937008079 2:118536109-118536131 CATGCCCAGGATGAGCTGGGAGG + Intergenic
937735194 2:125279408-125279430 TCTTGCCAGCATGAGTTGGGAGG + Intergenic
938016959 2:127875122-127875144 CCTTCGCATCATCAGCTGGGAGG - Intronic
940817657 2:158313554-158313576 CCTGTCCATAACGAGGTGGGGGG - Intronic
940895771 2:159080872-159080894 CCTGCTGGTCAGGAGTTGGGAGG - Intronic
945330239 2:208530453-208530475 CCTGCCCCTTATGAGTTGCTGGG - Intronic
946230465 2:218287943-218287965 CCAGGCCATCCTGACTTGGGTGG - Intronic
946790932 2:223299848-223299870 ACTGCCCATCATGAACTGGGTGG + Intergenic
947790386 2:232863412-232863434 CCAGCCCCTCATCTGTTGGGTGG + Intronic
948133928 2:235621587-235621609 CCTGCCCATCATGCATTTAGGGG + Intronic
1169410400 20:5364454-5364476 CCTGGCCATGATGGGATGGGAGG - Intergenic
1170890050 20:20368758-20368780 CGTGCCCATCTTGAGCTCGGCGG - Exonic
1172385290 20:34529906-34529928 GCTGCCCCTGATCAGTTGGGTGG + Intronic
1172463147 20:35135167-35135189 CCTGCTCATCATGAGGGGGCAGG + Intronic
1175064303 20:56272358-56272380 CCTGCCCCTTCTGAGTTGGTGGG + Intergenic
1175091735 20:56510573-56510595 TCTGCCCCCTATGAGTTGGGTGG - Intronic
1176943481 21:14951958-14951980 CCTGCCCATCCTGGGTTGGCAGG - Intergenic
1179225619 21:39450555-39450577 GCTGCCCATCATGGATTGGGTGG - Intronic
1181835590 22:25605304-25605326 CCTGCTCCTCAGGAGTTGGTTGG + Intronic
1182116860 22:27761681-27761703 CCTGCCCATCATGAGTTGGGGGG - Intronic
1182184359 22:28386387-28386409 CCTGCCCATCATGAGAGAGCAGG - Intronic
1183346337 22:37310336-37310358 CCTGACCATCAGTACTTGGGTGG - Intronic
1184090976 22:42292929-42292951 CCTGCCCACCAGGAGTGGCGGGG + Intronic
1184439520 22:44500260-44500282 CCTGGCCATGATGGGATGGGAGG + Intergenic
1185319494 22:50193956-50193978 CCTGTCCCTCCTGAGTGGGGTGG + Intronic
950054352 3:10012713-10012735 CATGGCCACCATGAGCTGGGTGG - Intergenic
950305539 3:11913160-11913182 CATGGCCACCATGAGCTGGGTGG - Intergenic
950429994 3:12945120-12945142 CCTGCCCATTCTGAGTTCAGTGG - Intronic
953852437 3:46475668-46475690 CTTGGCCAGCTTGAGTTGGGTGG - Intronic
954033699 3:47838587-47838609 CCAGCTTGTCATGAGTTGGGTGG + Intronic
954675986 3:52315682-52315704 CCTGCCCCTCTTGTGATGGGAGG - Intergenic
956539900 3:70324881-70324903 CTTCTCCATCATGAGTTGGAAGG + Intergenic
956561821 3:70586732-70586754 CCTGGCCAACATGGTTTGGGAGG + Intergenic
960615360 3:119591266-119591288 CCTGCGGGTCATGAGGTGGGTGG + Intergenic
968538844 4:1151932-1151954 CCTGCCCCTTCCGAGTTGGGTGG - Intergenic
970820415 4:20205412-20205434 CCTGGCCATGATGGGTTGGGAGG - Intergenic
973590653 4:52437368-52437390 CCTGCCTAGCAGGAGATGGGAGG + Intergenic
974644606 4:64674677-64674699 ACTTCCCATCATGAACTGGGTGG - Intergenic
976151482 4:82096864-82096886 GCTGCCCACACTGAGTTGGGAGG - Intergenic
976885442 4:89978063-89978085 CCTGGCTATGATGAGATGGGAGG + Intergenic
979074178 4:116251153-116251175 CCTACCAATCATGAGCTGGAAGG - Intergenic
979390754 4:120124840-120124862 CCTGCCCACCATGTGTTAGAAGG - Intergenic
979649617 4:123114708-123114730 TCTGCCCCTTATGAGTTGGTAGG - Intronic
980942003 4:139283670-139283692 CCTGGCCATGATGGGATGGGAGG + Intronic
985886838 5:2686626-2686648 CCAGCCAATTGTGAGTTGGGAGG + Intergenic
988942541 5:36160774-36160796 CCTGCCCATGTTGACTTTGGAGG + Intronic
991504036 5:67305792-67305814 CCAGCCCATCATGTGTGGAGGGG - Intergenic
992065444 5:73103505-73103527 CCTGGCCATGATGAGATGGGAGG + Intergenic
993501597 5:88672992-88673014 CCTGCCCAGCTGGATTTGGGGGG - Intergenic
995967354 5:117923884-117923906 ACTGCCCATTATGACTTGTGAGG - Intergenic
997408586 5:133672341-133672363 CATGCCCATCATGAGGTGGCTGG - Intergenic
998061340 5:139121047-139121069 CCTGCCACTCATGCGTCGGGTGG + Exonic
999099465 5:149011165-149011187 CCTGCACAACATCAGTTAGGTGG + Intronic
999242122 5:150133783-150133805 CCGGCCCCTCCTGATTTGGGGGG - Intronic
999423547 5:151466112-151466134 GGTGACCACCATGAGTTGGGTGG + Intronic
1002819058 6:706846-706868 CTTGCCCATGATGAAGTGGGAGG - Intergenic
1006536736 6:34705206-34705228 CTTTCCCATCATGCTTTGGGAGG - Intergenic
1013092367 6:106911921-106911943 CCTGGCCATGATGGGATGGGAGG - Intergenic
1013098271 6:106966020-106966042 GCTGCCCATCATGATTTGGTGGG + Intergenic
1013375415 6:109509800-109509822 CCTGCCCCTTGTGAGTTGGTGGG + Intronic
1016465767 6:144323412-144323434 CCAGCCCATCATTAATTGGAGGG - Intronic
1017983822 6:159425228-159425250 TCTGCCCAGCATGAGCTGGGAGG - Intergenic
1021561559 7:21972688-21972710 CCTGCCCCTTCTGAGTTGGGAGG - Intergenic
1023500770 7:40847261-40847283 CCTGTCCATCATGGGTTGACAGG + Intronic
1026359707 7:69591848-69591870 CCTGCCCCTTCTGAGTTGGCAGG - Intergenic
1033440454 7:141373651-141373673 CCTGCCCAATGTGTGTTGGGGGG - Intronic
1039005651 8:33033955-33033977 CCTGTCCATCAACAGGTGGGTGG + Intergenic
1039435555 8:37557045-37557067 TCTGCCAATCATGAGCTGTGTGG + Intergenic
1041993928 8:64029853-64029875 CCTGCCCACTCTGTGTTGGGTGG - Intergenic
1048094557 8:131277394-131277416 CCTGTCCATCATGAGTCAGAAGG - Intergenic
1048933411 8:139335610-139335632 CCTGCCTACCATGACTTGGAGGG - Intergenic
1050352812 9:4756441-4756463 CCTGGCCATGATGGGATGGGAGG - Intergenic
1050883179 9:10729885-10729907 CCTACCCATTTTCAGTTGGGTGG + Intergenic
1057990784 9:99767372-99767394 CCTGTCCGTCATGAGTTAGCAGG - Intergenic
1185870347 X:3659491-3659513 CCTGCCCCTCAGCAGCTGGGTGG + Intronic
1193927866 X:87512030-87512052 CTTGCCCATGATGGGATGGGGGG + Intergenic
1196075094 X:111567609-111567631 CCTGGCCATGACGAGATGGGAGG + Intergenic
1199319133 X:146417732-146417754 CCTACCCACTATGAGTTTGGAGG + Intergenic
1201234695 Y:11897770-11897792 CGTGGCCATCTTGAGTTTGGTGG + Intergenic
1202603836 Y:26621802-26621824 CCTGCCCTACATGAGCTGGCAGG - Intergenic