ID: 1182120315

View in Genome Browser
Species Human (GRCh38)
Location 22:27782156-27782178
Sequence TAGGAACACGTGCCCGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182120309_1182120315 0 Left 1182120309 22:27782133-27782155 CCTTGGCGCTACCATCCCACTGC No data
Right 1182120315 22:27782156-27782178 TAGGAACACGTGCCCGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182120315 Original CRISPR TAGGAACACGTGCCCGATGG TGG Intronic