ID: 1182123882

View in Genome Browser
Species Human (GRCh38)
Location 22:27802546-27802568
Sequence CGGGCCGCACACCTTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182123872_1182123882 11 Left 1182123872 22:27802512-27802534 CCCGAGAAGACACGCACGAAGAG No data
Right 1182123882 22:27802546-27802568 CGGGCCGCACACCTTGCCCTGGG No data
1182123873_1182123882 10 Left 1182123873 22:27802513-27802535 CCGAGAAGACACGCACGAAGAGG No data
Right 1182123882 22:27802546-27802568 CGGGCCGCACACCTTGCCCTGGG No data
1182123871_1182123882 12 Left 1182123871 22:27802511-27802533 CCCCGAGAAGACACGCACGAAGA No data
Right 1182123882 22:27802546-27802568 CGGGCCGCACACCTTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182123882 Original CRISPR CGGGCCGCACACCTTGCCCT GGG Intergenic
No off target data available for this crispr