ID: 1182124083

View in Genome Browser
Species Human (GRCh38)
Location 22:27803962-27803984
Sequence TGAACCTCCTGGACAAAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182124074_1182124083 18 Left 1182124074 22:27803921-27803943 CCTGGGGCTCTGGGGCTCCCGAG No data
Right 1182124083 22:27803962-27803984 TGAACCTCCTGGACAAAAAGCGG No data
1182124081_1182124083 0 Left 1182124081 22:27803939-27803961 CCGAGACAGAGCAGGGGGGATCT No data
Right 1182124083 22:27803962-27803984 TGAACCTCCTGGACAAAAAGCGG No data
1182124080_1182124083 1 Left 1182124080 22:27803938-27803960 CCCGAGACAGAGCAGGGGGGATC No data
Right 1182124083 22:27803962-27803984 TGAACCTCCTGGACAAAAAGCGG No data
1182124071_1182124083 26 Left 1182124071 22:27803913-27803935 CCTAGGACCCTGGGGCTCTGGGG No data
Right 1182124083 22:27803962-27803984 TGAACCTCCTGGACAAAAAGCGG No data
1182124073_1182124083 19 Left 1182124073 22:27803920-27803942 CCCTGGGGCTCTGGGGCTCCCGA No data
Right 1182124083 22:27803962-27803984 TGAACCTCCTGGACAAAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182124083 Original CRISPR TGAACCTCCTGGACAAAAAG CGG Intergenic
No off target data available for this crispr