ID: 1182128752

View in Genome Browser
Species Human (GRCh38)
Location 22:27835272-27835294
Sequence CACTGCCAGGCATAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182128752_1182128759 7 Left 1182128752 22:27835272-27835294 CCTCCATCCTATGCCTGGCAGTG No data
Right 1182128759 22:27835302-27835324 CTGAAAAGAGGCAGCCTGGAAGG No data
1182128752_1182128760 8 Left 1182128752 22:27835272-27835294 CCTCCATCCTATGCCTGGCAGTG No data
Right 1182128760 22:27835303-27835325 TGAAAAGAGGCAGCCTGGAAGGG No data
1182128752_1182128758 3 Left 1182128752 22:27835272-27835294 CCTCCATCCTATGCCTGGCAGTG No data
Right 1182128758 22:27835298-27835320 CCATCTGAAAAGAGGCAGCCTGG No data
1182128752_1182128756 -5 Left 1182128752 22:27835272-27835294 CCTCCATCCTATGCCTGGCAGTG No data
Right 1182128756 22:27835290-27835312 CAGTGCTACCATCTGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182128752 Original CRISPR CACTGCCAGGCATAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr