ID: 1182131415

View in Genome Browser
Species Human (GRCh38)
Location 22:27855610-27855632
Sequence CACCTCCGGTTCCGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182131415_1182131423 -4 Left 1182131415 22:27855610-27855632 CCCCCACCCCGGAACCGGAGGTG No data
Right 1182131423 22:27855629-27855651 GGTGCCAGTTAAGAACAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182131415 Original CRISPR CACCTCCGGTTCCGGGGTGG GGG (reversed) Intronic