ID: 1182144240

View in Genome Browser
Species Human (GRCh38)
Location 22:27987377-27987399
Sequence TCCCTTTGGTGTGGGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 816
Summary {0: 1, 1: 0, 2: 10, 3: 91, 4: 714}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182144240_1182144248 -5 Left 1182144240 22:27987377-27987399 CCACCACCCCCACACCAAAGGGA 0: 1
1: 0
2: 10
3: 91
4: 714
Right 1182144248 22:27987395-27987417 AGGGAGCCTCAGGCTCCATGAGG 0: 1
1: 0
2: 3
3: 28
4: 262
1182144240_1182144252 29 Left 1182144240 22:27987377-27987399 CCACCACCCCCACACCAAAGGGA 0: 1
1: 0
2: 10
3: 91
4: 714
Right 1182144252 22:27987429-27987451 TCCTTTATAAAGCAAGGTCTTGG 0: 1
1: 0
2: 2
3: 20
4: 193
1182144240_1182144251 23 Left 1182144240 22:27987377-27987399 CCACCACCCCCACACCAAAGGGA 0: 1
1: 0
2: 10
3: 91
4: 714
Right 1182144251 22:27987423-27987445 AGCTTTTCCTTTATAAAGCAAGG 0: 1
1: 0
2: 2
3: 30
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182144240 Original CRISPR TCCCTTTGGTGTGGGGGTGG TGG (reversed) Intronic
900157497 1:1209056-1209078 TCCCTATGCTGCGGGGGGGGAGG + Intergenic
900188294 1:1343027-1343049 TCCCCATGCTGGGGGGGTGGGGG - Intronic
900494489 1:2970375-2970397 CCCCTTTGGCGTGGGAGGGGGGG + Intergenic
900577240 1:3389416-3389438 TCCCTATGGCGTGGGGCTGAGGG + Intronic
900793610 1:4694643-4694665 TCCCCTTGGTGGGCAGGTGGAGG + Intronic
900913800 1:5620417-5620439 TCTCTTTGGGGTGTGTGTGGTGG + Intergenic
901236748 1:7671349-7671371 ACCCTTTGGGCTGAGGGTGGTGG - Intronic
901527218 1:9831166-9831188 TCCCTTGTGTGTGTGTGTGGTGG + Intergenic
901637162 1:10675796-10675818 TCCCTTTGTTGGGGGTGGGGGGG - Intronic
901652777 1:10752538-10752560 TCCCTGTACTGTGGGAGTGGAGG + Intronic
901668446 1:10839626-10839648 GCCCTGTGGGGTGGGAGTGGAGG + Intergenic
902302517 1:15512115-15512137 TCTCTTTGCTCTGGGGCTGGTGG - Intronic
902364581 1:15963505-15963527 TCCCTCTGGGGATGGGGTGGAGG - Intronic
902669735 1:17964738-17964760 TCTGGTTGGTGTGGGGGTGATGG - Intergenic
902875291 1:19337401-19337423 TCACCTGGGGGTGGGGGTGGAGG - Intergenic
902960800 1:19961744-19961766 TCCCTTGGGGTGGGGGGTGGGGG - Intergenic
903017257 1:20369117-20369139 TGCCATGGGTTTGGGGGTGGGGG - Intergenic
903402302 1:23063838-23063860 TCCTTATGGGGTGGGAGTGGGGG + Intronic
903617270 1:24669651-24669673 TTCCTTTTATATGGGGGTGGGGG - Intronic
903640849 1:24859268-24859290 TCCTTTGGGTGTGGGGGCAGGGG - Intergenic
904201014 1:28819012-28819034 TGAATTTGGTGTGGGGGTGAGGG + Intronic
904605524 1:31695854-31695876 TCCTGTTGGTTTGGGGGTAGGGG - Intronic
905015906 1:34778237-34778259 AACATTTGGGGTGGGGGTGGGGG + Intronic
905310119 1:37043235-37043257 GCTCTCTGGAGTGGGGGTGGGGG - Intergenic
905552226 1:38851342-38851364 TCCCACTGTTGTGGGGATGGGGG - Intronic
905966827 1:42105235-42105257 TCCCCTTTGTGTTGGGGTTGGGG + Intergenic
905972291 1:42151168-42151190 TCCCATTGATGTGGGGGTCAAGG + Intergenic
906032347 1:42731819-42731841 TCCTTCTGGGGTGGGGGGGGCGG + Intergenic
906069373 1:43006300-43006322 TAGCTTTGGTGGGGGGATGGAGG + Intergenic
906230164 1:44155763-44155785 TACCTTTGGGCTGGGGGCGGTGG + Intergenic
906365253 1:45205138-45205160 TTCCTTGGGTGGGGGTGTGGAGG + Intronic
906379961 1:45326628-45326650 TCCCTTCGCTGTGAGGTTGGGGG + Intergenic
906524873 1:46488203-46488225 GAGCTTTGGGGTGGGGGTGGGGG + Intergenic
907295597 1:53450496-53450518 TTCCTTTGGTGTGAGGATAGTGG - Intergenic
907454980 1:54569605-54569627 ACCCTGTGGTGAGGGGTTGGGGG - Intronic
907700911 1:56787343-56787365 TCCCCTGGGTGCTGGGGTGGAGG - Intronic
908425353 1:64001972-64001994 TCTCGTTGTGGTGGGGGTGGTGG + Intronic
908681984 1:66672370-66672392 TTCCTTTGGTGTGTGGCAGGTGG - Intronic
909298046 1:73976202-73976224 TTTCTTTGGTAGGGGGGTGGAGG + Intergenic
909501363 1:76338697-76338719 TTCATTAGGGGTGGGGGTGGGGG - Intronic
909627855 1:77738765-77738787 TCCCTTTGGGCTGGGTGCGGTGG - Intronic
910771541 1:90836335-90836357 TCCCCTTGGTGTCTGGGTTGGGG + Intergenic
910773993 1:90856623-90856645 TCCCTGGGAGGTGGGGGTGGGGG - Intergenic
910922818 1:92367714-92367736 TCTCTATGGTTTGGGGTTGGAGG - Intronic
910931471 1:92446690-92446712 TCCCTTGAATGTGGGTGTGGTGG - Intergenic
910979321 1:92943517-92943539 TCTCTGTGGGGTGGGGGAGGTGG - Intronic
911098236 1:94073262-94073284 TGCCCTTGGGGTGGGGGAGGAGG - Intronic
911327493 1:96485503-96485525 TCCCTTTGGGTTTGGGGTGTGGG + Intergenic
911651933 1:100398810-100398832 GCCTGTTGGTGTGGGTGTGGAGG + Intronic
911665030 1:100542279-100542301 TCCTTTTGGGGTGGGGCTGGAGG + Intergenic
911889380 1:103347668-103347690 TCCCTATGGGGTGGTGGTGGGGG + Intergenic
912551520 1:110488289-110488311 TTCCTCTGGGGTTGGGGTGGGGG + Intergenic
912554502 1:110506468-110506490 TCCCTTTGGAGAGGGGGCAGGGG - Intergenic
912633798 1:111271810-111271832 TGTCATTGGGGTGGGGGTGGGGG - Intergenic
912737324 1:112161308-112161330 TCCCTTTTGTCTGTGTGTGGAGG - Intergenic
912762312 1:112379963-112379985 TCCATCTGGGGTGGGAGTGGAGG - Intergenic
912801080 1:112720066-112720088 GCCCTCTGGTGTGGGAATGGGGG + Intergenic
913386882 1:118267399-118267421 CACCTTTGGTCTGGTGGTGGGGG + Intergenic
914741893 1:150472396-150472418 TCCCTTGGGGGTGGGGGCAGCGG + Exonic
914890005 1:151613211-151613233 TGCCTTTGGGGTGGGGGGCGTGG + Intronic
915083360 1:153367180-153367202 TGGCTGTGGTGTGGGGGAGGGGG + Intergenic
915101994 1:153507392-153507414 TTCCTTGGGTGTGTGTGTGGGGG - Intergenic
915118202 1:153613193-153613215 TCCCTCTGGGATGGGGGTAGAGG - Intergenic
915214386 1:154330106-154330128 TTCCTCTGGAGTGGGGGTGGGGG + Intronic
915642676 1:157241275-157241297 TCCCCTTGGCTGGGGGGTGGGGG - Intergenic
915965501 1:160304299-160304321 TCCTTTTGGGTTGGGCGTGGTGG - Intronic
916219277 1:162427322-162427344 TCCATTTTTTGTGGGGGGGGGGG - Intergenic
916277901 1:163014467-163014489 TCCCAGTGTTGTTGGGGTGGGGG - Intergenic
916482064 1:165223015-165223037 TTCTTTTGGTGGTGGGGTGGGGG + Intronic
916551736 1:165856438-165856460 TACTTGTGGGGTGGGGGTGGGGG - Intronic
916578281 1:166086277-166086299 ACCCTGTGCTGTGGGGATGGTGG - Intronic
916724182 1:167508221-167508243 GCTCTTTGGGGTGGGAGTGGTGG - Intronic
917969955 1:180199971-180199993 TCCTCTGGGTGTGGGGGTGGAGG + Exonic
918605110 1:186415455-186415477 TCTCTTTTTTGTGGGGGTGAGGG + Intronic
919001356 1:191835002-191835024 TGCCTATGGTGGGGGGTTGGTGG + Intergenic
919028091 1:192202833-192202855 TCTCTTGAATGTGGGGGTGGAGG + Intergenic
919046921 1:192464029-192464051 TGCCTTTGCTGTGAGAGTGGCGG + Intergenic
919676365 1:200387419-200387441 TCCTTTTGGGCTGGGTGTGGTGG - Intergenic
919705431 1:200670439-200670461 TCTTGTTGGTGTTGGGGTGGGGG - Intergenic
919747597 1:201018182-201018204 GCCCTTTGGTGTGTGTGAGGTGG + Intronic
919810496 1:201406026-201406048 CCCCTTTGGTGCGGGTGTGTGGG + Exonic
919996005 1:202751212-202751234 TACTTTTGGGGTGAGGGTGGTGG - Intronic
920712388 1:208307526-208307548 ACCTTTTGTTGTGGTGGTGGTGG - Intergenic
920750825 1:208674862-208674884 TGCCTTTGGTGTGTGGGAGAGGG + Intergenic
920888447 1:209957284-209957306 TCCCTTTTGTTTGGGTGGGGTGG + Intronic
922342625 1:224669950-224669972 ACTGTTGGGTGTGGGGGTGGGGG - Intronic
922756540 1:228100144-228100166 TCAATTGGGTGTGGGGGTTGGGG - Intergenic
923015036 1:230120153-230120175 TGCGTTGGGGGTGGGGGTGGGGG + Intronic
924398889 1:243656083-243656105 ACCATTTGGTGAGGGTGTGGCGG + Intronic
924442350 1:244096737-244096759 TCCCCTTGGTATGGGGCAGGAGG + Intergenic
924452068 1:244187403-244187425 TCCCCTTGGTGGGAGGGCGGAGG - Intergenic
924527661 1:244866504-244866526 GCCCATTGGTGTGGGGGGTGAGG - Intergenic
1062811865 10:472624-472646 TGGCTTTGCTGTGGGGATGGAGG - Intronic
1063733862 10:8730225-8730247 TTCCTTTGGTGGGGGGGGGGGGG - Intergenic
1065322156 10:24519983-24520005 TGCCTTTCGTGTGGTGGTGGTGG - Intronic
1065502851 10:26398946-26398968 ACCCTTTCGAGCGGGGGTGGTGG - Intergenic
1066094212 10:32056885-32056907 TCATTTTTGTCTGGGGGTGGAGG + Intergenic
1066310535 10:34191636-34191658 AGCCTTGGGGGTGGGGGTGGGGG + Intronic
1067058219 10:43064604-43064626 GGACTTGGGTGTGGGGGTGGGGG + Intergenic
1067562185 10:47311828-47311850 GCCCTCTTGTGTGGGTGTGGTGG - Intronic
1067571915 10:47378031-47378053 GCCCCTTAGTGTGGGGGTGGGGG - Intronic
1067771231 10:49127710-49127732 TCCCTTTGTTGTGGGGTTGGGGG + Intergenic
1067913948 10:50376189-50376211 TCGCTGTGGTGTGGGGATAGAGG + Intronic
1068922436 10:62498801-62498823 AACTTTTGGTGGGGGGGTGGAGG + Intronic
1069518689 10:69100680-69100702 TGGCTGTGGGGTGGGGGTGGCGG + Intronic
1069640964 10:69955347-69955369 TCCCATTGGTGCGTGGATGGTGG - Intronic
1069641009 10:69955544-69955566 TCCCATTGGTGTGTGGATGGTGG - Intronic
1069932003 10:71889205-71889227 TCCCTTGGGGGTGGGGGTGGGGG + Intergenic
1070129346 10:73646299-73646321 TCCCTTTGCTGTGTGCCTGGTGG + Exonic
1070129931 10:73648769-73648791 CCCCTTTGGAGTGGGGGTTGGGG + Exonic
1070578351 10:77697850-77697872 TACGTTTTGTGTGGGGGGGGGGG + Intergenic
1070836077 10:79447615-79447637 TTCTTTTGGTGTGGGGGCGGGGG - Intergenic
1071085483 10:81863886-81863908 GCCCTTTGGGGTTAGGGTGGAGG - Intergenic
1073136737 10:101224536-101224558 TCCCTTTGGGCTGGGGGCGGCGG - Intergenic
1073249397 10:102112595-102112617 ACCCTTGGGGGCGGGGGTGGGGG - Intronic
1073312791 10:102556156-102556178 TCCGGTGGGTGTGGGGGCGGGGG + Intronic
1073656104 10:105418520-105418542 TCCATTTGGTGTGGGTCTTGAGG + Intergenic
1074765153 10:116694960-116694982 TCACTGTGGGGTGGGGGTTGAGG - Intronic
1074865649 10:117543138-117543160 TTTGTTTGGGGTGGGGGTGGGGG - Exonic
1075612666 10:123865990-123866012 TGTGTGTGGTGTGGGGGTGGAGG - Intronic
1075979040 10:126721573-126721595 TCCCTTTTCTGTTGGCGTGGGGG - Intergenic
1076010742 10:126986129-126986151 ACCCTTTGGGCTGGGTGTGGTGG - Intronic
1076065882 10:127447525-127447547 ACCCTCTGGTGTGGAGGGGGAGG - Exonic
1076294944 10:129376856-129376878 TCTCTCTGGGGTGGGGGTGGGGG - Intergenic
1076681045 10:132171347-132171369 TCCCATGGGTGTGGGGTTGGTGG - Intronic
1077254338 11:1573646-1573668 CCCGTATGGGGTGGGGGTGGCGG + Intergenic
1077366164 11:2162202-2162224 TCCGTGTGATCTGGGGGTGGCGG + Intergenic
1077368436 11:2170687-2170709 TACCCTTGGGGTGGGGGTGTAGG + Exonic
1077897846 11:6467093-6467115 TCCCTGTGGTGGGGAGGTGGTGG + Intronic
1078083573 11:8220605-8220627 GCCCGTTGGGGTGGGGGTGGGGG - Intergenic
1078225178 11:9385005-9385027 TCGGTGTGGTGTGGTGGTGGTGG + Intronic
1078275373 11:9839947-9839969 TCCTTTTGGGCTGGGTGTGGTGG + Intronic
1078341892 11:10502988-10503010 TGCTTTTGGGGTGGGGTTGGTGG + Intronic
1080608082 11:33881093-33881115 TCCATTTGGGATGGTGGTGGTGG + Intronic
1080746097 11:35110024-35110046 GTCCTTTGATGTGGGGGTAGAGG + Intergenic
1081800419 11:45855160-45855182 TCACATTTTTGTGGGGGTGGGGG - Intronic
1082681925 11:56184322-56184344 TCTTTTTGTTGTGGTGGTGGTGG + Intergenic
1083000946 11:59290038-59290060 TCCCATTTGCCTGGGGGTGGAGG + Intergenic
1083163164 11:60867881-60867903 TTTCTGTGGTGAGGGGGTGGGGG - Intronic
1083343735 11:61975291-61975313 TTCCCTTGCTGTGGGGGAGGTGG - Intergenic
1083457726 11:62790143-62790165 TTCCTTTCGTTGGGGGGTGGGGG + Exonic
1083519649 11:63296397-63296419 TCTCATTGGTGTGTGGGTTGGGG + Intronic
1083613149 11:64013986-64014008 GATCTGTGGTGTGGGGGTGGGGG - Intronic
1083649801 11:64195742-64195764 TCCTTTTTGGGAGGGGGTGGTGG - Exonic
1084056515 11:66637459-66637481 TCTTTTTGGGGCGGGGGTGGTGG + Intronic
1084579485 11:70014266-70014288 TGTCCTTGGTGGGGGGGTGGGGG - Intergenic
1084684245 11:70684565-70684587 TGCCTTTGGGGTGGGGGTAGGGG - Intronic
1084701484 11:70788966-70788988 TCCTTGGGGTGTGGGGCTGGTGG + Intronic
1084792669 11:71484469-71484491 TCCCCTGGGGGTGGGGGTGCAGG + Intronic
1084892701 11:72244290-72244312 ACCCTTCGGGGTGGGGGTCGGGG - Intronic
1085103552 11:73822284-73822306 TGCCTTTGGGGTGGGGGTGCAGG - Intronic
1085269282 11:75260724-75260746 TCCCTGGGGGGTGGGAGTGGGGG + Intergenic
1085528205 11:77176134-77176156 TTCCTCTGGTGTGGGGGGTGGGG + Intronic
1087038300 11:93774858-93774880 TCCCTTTTGGCTGGGTGTGGTGG + Intronic
1088820658 11:113453923-113453945 TCCTTTTGATGGGGGGCTGGGGG + Intronic
1088968589 11:114750970-114750992 TACTCTTGTTGTGGGGGTGGGGG + Intergenic
1089113364 11:116074269-116074291 GCCCTCAGCTGTGGGGGTGGGGG + Intergenic
1089399055 11:118153774-118153796 CCCTTTTGGGGTAGGGGTGGAGG + Intergenic
1089494088 11:118899796-118899818 GGCCCTGGGTGTGGGGGTGGAGG - Intronic
1089758872 11:120708291-120708313 TACCCTGGGTGTGGTGGTGGGGG + Intronic
1090176771 11:124656930-124656952 TCTCTGTGGTGGGTGGGTGGGGG - Intronic
1090412650 11:126519801-126519823 GCCATGTGGTGTGGGGGTTGTGG - Intronic
1090865818 11:130699576-130699598 TCCCTTTGTTGTGGGTCTGATGG + Intronic
1091248725 11:134123378-134123400 TCCCTTTTTTGGGGGGGGGGGGG - Intronic
1091750386 12:3018473-3018495 GCCCTGTGGTGTGGGGGTGGGGG - Intronic
1092406416 12:8224670-8224692 TCTCTTGGGTATTGGGGTGGGGG - Intronic
1092439372 12:8484339-8484361 ACCCTTTGGGCTGGGTGTGGTGG - Intergenic
1092645186 12:10563271-10563293 TGCCTTTGGGGTGTGGGTGAGGG - Intergenic
1093013184 12:14129711-14129733 TCTCTTGTGCGTGGGGGTGGGGG - Intergenic
1093196542 12:16136202-16136224 TCCATATGGTGAGTGGGTGGAGG - Intergenic
1093297570 12:17410146-17410168 TCTCCGTGGGGTGGGGGTGGGGG + Intergenic
1093490982 12:19704030-19704052 TGCATTTGGTGGGGGGGGGGGGG - Intronic
1094167082 12:27453983-27454005 TCTCTTTTTTGTGGGGGAGGGGG + Intergenic
1094277828 12:28698882-28698904 TCGGCTTGGTGTGGGTGTGGGGG - Intergenic
1094763416 12:33561714-33561736 TGCCTTTTGTGTGGGCATGGTGG - Intergenic
1095491520 12:42739499-42739521 TCCCCATGGTATGGGGGTTGGGG + Intergenic
1095737168 12:45570147-45570169 GCCCAGTGGGGTGGGGGTGGAGG + Intergenic
1095819760 12:46464951-46464973 ATACTTTGGGGTGGGGGTGGGGG + Intergenic
1095850900 12:46804234-46804256 TGCCGTTGGTGTAGGAGTGGTGG - Intronic
1096145814 12:49277807-49277829 ACCCTTGGGTGTGGGGGCTGTGG + Intergenic
1096194799 12:49642938-49642960 GGCCTTTGGTGTGGAGGTGCTGG - Exonic
1096458982 12:51811599-51811621 TCACATTTGTGTGGGGGTGGGGG + Exonic
1097040839 12:56154989-56155011 TCCCTTCTGTCTGGGGGTGATGG + Intronic
1097973281 12:65657935-65657957 TGCCTTTGGGGTGGTGATGGGGG - Intergenic
1098103118 12:67040214-67040236 ACACTTTGCTGGGGGGGTGGGGG - Intergenic
1099979654 12:89583781-89583803 TTCCTTTGGCGGGGGGGGGGGGG + Intergenic
1100131970 12:91506137-91506159 TCCTTTTGGTCAAGGGGTGGGGG - Intergenic
1100620610 12:96268931-96268953 AGCCTATGGGGTGGGGGTGGGGG - Exonic
1101147389 12:101854042-101854064 TCCATTTGGTTTGAGGGAGGAGG + Intergenic
1101652471 12:106690058-106690080 TTCCTTTGGTGTGTGTGTTGTGG + Intronic
1102254248 12:111406688-111406710 GCCCTTGGGTGTGGGGGCAGCGG + Intronic
1103017573 12:117507839-117507861 TCCAATAGGAGTGGGGGTGGGGG - Intronic
1103637150 12:122316493-122316515 TGACTTTGGGGTGGGTGTGGTGG - Intronic
1103737309 12:123068800-123068822 AGCCTATGGTGTTGGGGTGGTGG - Intronic
1103751338 12:123165533-123165555 TATGTTTGGTGTGGGGGCGGGGG - Intronic
1103758653 12:123232297-123232319 TCCATTTGGGGTGGAGGTGCTGG + Intronic
1103942641 12:124509226-124509248 TGGCTTTGGTGGGGGGGGGGGGG + Intronic
1105995997 13:25672440-25672462 TCTCTTTGGGGTGGGAATGGAGG + Intronic
1106497459 13:30293613-30293635 TACCTTTGTTGTGGTGGTAGTGG - Intronic
1107514532 13:41116118-41116140 ATACTTTGGTGTGGGGGGGGGGG + Intergenic
1108037437 13:46306244-46306266 TCCTTTTTTTGGGGGGGTGGTGG + Intergenic
1108173421 13:47767683-47767705 CCTGTTTGGGGTGGGGGTGGGGG - Intergenic
1110284572 13:73734609-73734631 TTCCTTTTTTGGGGGGGTGGGGG + Intronic
1110345288 13:74439923-74439945 TCTCCAGGGTGTGGGGGTGGTGG + Intergenic
1112024204 13:95397547-95397569 GCCTTTGTGTGTGGGGGTGGTGG + Intergenic
1112537566 13:100275039-100275061 GCCCTTGGGGGAGGGGGTGGGGG + Intronic
1113114980 13:106865598-106865620 TCACTTGGGTGTAGGGGTTGTGG + Intergenic
1113444574 13:110355666-110355688 TCACCTGTGTGTGGGGGTGGAGG + Intronic
1113444595 13:110355764-110355786 TCACCTGTGTGTGGGGGTGGAGG + Intronic
1113490522 13:110688154-110688176 CCGCTTTGGTGAGTGGGTGGGGG - Intronic
1113567831 13:111329351-111329373 TCACTTTGGGGTGGTGGGGGTGG - Intronic
1113572323 13:111367079-111367101 TGACCTTGGTGTGGGGGTGGAGG + Intergenic
1113852807 13:113427633-113427655 ACCGTTTGGTGTGGGAGCGGTGG - Intronic
1114517641 14:23310034-23310056 TCCCATGGGTGTGAGGGTGATGG + Exonic
1114549301 14:23523960-23523982 TGGCTCTGGTGTTGGGGTGGTGG + Exonic
1115005870 14:28483921-28483943 TCACTATGTTGTGGGGGAGGAGG - Intergenic
1115379858 14:32723284-32723306 TCATTTTGGAGTGGGGGTAGTGG + Intronic
1115620290 14:35134257-35134279 TCCCTGTGGGCTGGTGGTGGCGG - Intronic
1116221018 14:42086669-42086691 TCCTTGTGGTGGGGTGGTGGCGG + Intergenic
1116360818 14:43995755-43995777 TCCCATTGGTTTGGAGGTGGAGG - Intergenic
1117784041 14:59264042-59264064 TACATTCGGTGTGGGGGTAGGGG - Intronic
1117791450 14:59346127-59346149 TCCCTTTTTTTTGGGGGGGGGGG + Intronic
1117994209 14:61463270-61463292 TTCCTTTGGTGTGAGGATGGAGG - Intronic
1118182814 14:63510214-63510236 TCCCATTGTTGTTGGGCTGGAGG - Intronic
1118696327 14:68389284-68389306 TACCTTTGGGATGAGGGTGGAGG - Intronic
1118808334 14:69256665-69256687 GGCCTTTGGTGTGGGGGTTGTGG - Intergenic
1118959614 14:70516966-70516988 TCCCTTTGGTGAAGGGCTGGGGG - Intergenic
1120435054 14:84470935-84470957 TTCCTTTGGGATGGGGCTGGTGG - Intergenic
1120755616 14:88241489-88241511 TGTGTGTGGTGTGGGGGTGGGGG - Intronic
1120875726 14:89373459-89373481 TCTTTTTGGGGTGGGGGTGGGGG + Intronic
1121023235 14:90594906-90594928 ATCCTTTGGTGAGGGGTTGGTGG + Intronic
1121833803 14:97074202-97074224 TCCCTTTGGGCCGGGCGTGGTGG - Intergenic
1122185940 14:99996076-99996098 TCACTTTGATGGGGTGGTGGGGG - Intronic
1122610980 14:102983293-102983315 TCCCCTGAGAGTGGGGGTGGGGG + Intronic
1123672958 15:22678945-22678967 TACCTGTGGTCCGGGGGTGGTGG - Intergenic
1123751909 15:23363659-23363681 TCTCCTGGGGGTGGGGGTGGTGG - Exonic
1124284275 15:28387583-28387605 TCTCCTGGGGGTGGGGGTGGTGG - Exonic
1124298422 15:28524031-28524053 TCTCCTGGGGGTGGGGGTGGTGG + Exonic
1124325012 15:28752236-28752258 TACCTGTGGTCCGGGGGTGGTGG - Intergenic
1125201593 15:37104882-37104904 TAGCTCTGGAGTGGGGGTGGGGG + Intergenic
1125421579 15:39510071-39510093 TCTCTGGGGTCTGGGGGTGGAGG + Intergenic
1126275855 15:46879909-46879931 TACCTTGTGGGTGGGGGTGGGGG + Intergenic
1126284677 15:46997022-46997044 TCCCTTGGGTGGGGGTTTGGGGG + Intergenic
1126696453 15:51329955-51329977 TCCCTGGGATGTGGGGCTGGAGG + Intronic
1127009070 15:54602740-54602762 TCACTTTGGAGGGAGGGTGGGGG - Intronic
1127743475 15:61938255-61938277 TCACTTTGCTGTGGGGTGGGGGG + Intronic
1128160862 15:65422219-65422241 TCCCGTTTGACTGGGGGTGGTGG - Intronic
1129163035 15:73757884-73757906 TGCCTGGGGTGTGGGGGTGAGGG + Intergenic
1129171624 15:73811609-73811631 TCCCTGTGGGGTGGGTGGGGGGG - Intergenic
1129243917 15:74268473-74268495 GCCCTCTGGGGTGGTGGTGGGGG + Intronic
1129680082 15:77653802-77653824 TCTCTTTGGAGCTGGGGTGGAGG + Intronic
1129708763 15:77809584-77809606 TCCCAGTGCTGTGGGGGTTGGGG - Intronic
1129724719 15:77895916-77895938 TCCCTTTGGTGAGTGTTTGGAGG + Intergenic
1129989371 15:79948865-79948887 TTTCCTTGGAGTGGGGGTGGGGG - Intergenic
1131228666 15:90645363-90645385 TCACTTGGGTGAGGGGTTGGTGG + Intergenic
1131832062 15:96360514-96360536 GCACTGTGGGGTGGGGGTGGGGG + Intergenic
1131942841 15:97585668-97585690 TCCTTTGGTTGTGGGGGTGGGGG + Intergenic
1132510564 16:339088-339110 TCCCTTTGGGCAGGGTGTGGTGG + Intronic
1132558583 16:583433-583455 TGCCCTGGCTGTGGGGGTGGAGG + Exonic
1132600430 16:770495-770517 CCCCGTGGGGGTGGGGGTGGGGG - Intronic
1132778474 16:1610381-1610403 TCCCTTTGGAATGGGCGGGGTGG - Intronic
1132833652 16:1941999-1942021 TCCCTTTGGAGTGGAGGGGGTGG + Intronic
1133084374 16:3350340-3350362 TCCCTTTGGGCTGGGCGCGGTGG - Intergenic
1133482193 16:6181618-6181640 TTCCTGTGGTGGGGGGGAGGAGG + Intronic
1133606817 16:7395596-7395618 TACCTTTGTTGTGGGGATTGAGG + Intronic
1133644944 16:7755162-7755184 TATCTTTGGGGTGGGGTTGGGGG + Intergenic
1133827981 16:9295893-9295915 TCAGTTTGTTTTGGGGGTGGAGG - Intergenic
1134198546 16:12178276-12178298 TTGCTATGATGTGGGGGTGGTGG + Intronic
1134486816 16:14665233-14665255 TACCTGTGTTTTGGGGGTGGGGG + Intronic
1135473228 16:22751020-22751042 TCCTTTTGATGTGTGGGAGGTGG - Intergenic
1135636483 16:24080099-24080121 TCACTTTGGTGGGGGAGTGAAGG + Intronic
1135637702 16:24093178-24093200 TGCCTGTGGTGTGGGGGAGTGGG + Intronic
1135647267 16:24174007-24174029 TCTCTTTTTTGGGGGGGTGGGGG + Intronic
1136107347 16:28039442-28039464 ATTCTTTGCTGTGGGGGTGGGGG - Intronic
1136412645 16:30086122-30086144 GCCATTTGGTGTGGGGGATGGGG + Exonic
1136589384 16:31208267-31208289 TTACTTTGTTGTGGGGGTAGGGG - Intergenic
1136791071 16:32968522-32968544 TCCCTTTGTGGGGGAGGTGGGGG - Intergenic
1136878742 16:33885410-33885432 TCCCTTTGTTGGGGAGGTGGGGG + Intergenic
1137562562 16:49512288-49512310 TGCCTGTGGTCTGGAGGTGGTGG - Intronic
1137614428 16:49838519-49838541 CCGCTTTGGGGTGGGGCTGGGGG - Intronic
1138705792 16:58913604-58913626 TGCCTTGGGTGTGTGGGTGTGGG + Intergenic
1139114576 16:63933978-63934000 TCCATCTGATGTGGTGGTGGTGG - Intergenic
1140087397 16:71809195-71809217 TCCGCTTGGTGAGGGGGTAGGGG + Exonic
1140186601 16:72778678-72778700 TCCCTTTGGGGGCAGGGTGGGGG + Intergenic
1140997932 16:80279136-80279158 TCCTTTTGAGGTGGGGGTGGGGG + Intergenic
1141585935 16:85033649-85033671 TCCCTTTGGGCTGGGGGTGGGGG + Intronic
1141855401 16:86677740-86677762 TCCTCATGGTGTGGGGATGGCGG - Intergenic
1142011066 16:87714406-87714428 TCCCATGGATGTGGGGCTGGCGG - Intronic
1142242239 16:88952860-88952882 TCCCCAGGGTGTGGGGGTGGGGG - Intronic
1143122525 17:4617793-4617815 TGCCCTTGGTGTGGTGGGGGTGG - Intergenic
1143126269 17:4642653-4642675 TCACTCTGGTGGGGTGGTGGGGG - Intergenic
1143202086 17:5120248-5120270 TGCCTGTGCTGTGGGGTTGGTGG + Intronic
1143323915 17:6086125-6086147 TCCCTTGGGTCTTGGTGTGGTGG + Intronic
1143486860 17:7260213-7260235 TCCTCTTGGGTTGGGGGTGGGGG - Exonic
1143580790 17:7824453-7824475 TCCACCTGGTGTTGGGGTGGGGG - Intronic
1143648511 17:8248074-8248096 TCGCTTGGGGGTGGGGATGGGGG + Intronic
1144174463 17:12691651-12691673 TCCATTTGGTGCGAGGGTGAAGG - Intronic
1144311776 17:14020368-14020390 GCCCATGGGTGTGGGGCTGGTGG + Intergenic
1144332985 17:14240950-14240972 GCCCATGGGTGTGGGGCTGGTGG - Intergenic
1144445121 17:15320181-15320203 TGCTTTTGGTGGGGTGGTGGGGG - Intronic
1144879100 17:18421802-18421824 TGCCTGTGCTGTGGGGTTGGTGG + Intergenic
1144965101 17:19072191-19072213 ACCTTTGGATGTGGGGGTGGCGG - Intergenic
1144982866 17:19179989-19180011 ACCTTTGGATGTGGGGGTGGCGG + Intergenic
1144985357 17:19198250-19198272 ACCTTTGGATGTGGGGGTGGCGG - Intergenic
1145153134 17:20522585-20522607 TGCCTGTGCTGTGGGGTTGGTGG - Intergenic
1145351674 17:22089710-22089732 TCCCTGAGGTGTGTGGGGGGGGG - Intergenic
1145842981 17:28011871-28011893 TCCATGTGCTGTGTGGGTGGTGG + Intergenic
1145855118 17:28148239-28148261 TACTTTTTGTGGGGGGGTGGGGG - Intronic
1145883882 17:28369711-28369733 TCCCTTTGGACTGGGCCTGGAGG + Exonic
1146161820 17:30564161-30564183 CCTCTTTGGGGTGGCGGTGGCGG - Intergenic
1146935406 17:36809809-36809831 TCCCTGTGCTCTGGGGCTGGGGG - Intergenic
1146973850 17:37094575-37094597 GCTGTTTGGTGTGGGGGGGGGGG - Intronic
1147153343 17:38531098-38531120 TCCCTTTGTGGGGGAGGTGGGGG - Exonic
1147178591 17:38671660-38671682 TTCCTTGGGGGTGAGGGTGGGGG - Intergenic
1147414506 17:40278809-40278831 TCCCTGGGGTGGTGGGGTGGGGG - Exonic
1147460528 17:40565319-40565341 ACCCTGTGGAATGGGGGTGGAGG - Intronic
1147948510 17:44093774-44093796 TCCATGGGGGGTGGGGGTGGAGG - Exonic
1148163905 17:45468984-45469006 TCCCTGTGCTGTGGAGGAGGAGG - Intronic
1148219214 17:45850268-45850290 TCACCCTGGGGTGGGGGTGGGGG - Intergenic
1148224628 17:45890198-45890220 TACTTTTTATGTGGGGGTGGGGG - Intergenic
1148335478 17:46838047-46838069 CCCCTGTGTTGAGGGGGTGGAGG + Intronic
1148397997 17:47325269-47325291 ACACTTTGATGCGGGGGTGGGGG - Intronic
1148493349 17:48037426-48037448 TCCGTTTGGAGTGGGGGTGGCGG - Intronic
1148689981 17:49521550-49521572 ACACTTTGGTCTGGGGGAGGAGG - Intergenic
1148755279 17:49969865-49969887 TCCCTGGGATGTGGGGGTGGGGG + Intronic
1148771627 17:50070742-50070764 TCCTTGTTGGGTGGGGGTGGGGG + Intronic
1148808205 17:50274705-50274727 TCTCTTTGCTGTGGAGGTGGAGG + Intronic
1148883580 17:50753906-50753928 TACCTGGGATGTGGGGGTGGTGG + Exonic
1149639047 17:58191435-58191457 TCGGTAGGGTGTGGGGGTGGGGG + Intergenic
1149865584 17:60149560-60149582 TGGCCTTGGGGTGGGGGTGGGGG - Intergenic
1150395135 17:64815636-64815658 TCCCTGTGCTGTGGAGGAGGAGG - Intergenic
1151510164 17:74553725-74553747 TCCCTTTGGCTTGGTGGTTGTGG + Intergenic
1152112433 17:78364736-78364758 TCCCTCTGCTGGGGGGGTCGAGG + Intergenic
1152224338 17:79085776-79085798 TCCAGCTGGAGTGGGGGTGGAGG + Intronic
1152302521 17:79503673-79503695 TCCCTTGGTTGTGGGGCTGCAGG - Intronic
1152387069 17:79980974-79980996 GCCCTTTGGGGTTGGGGTGCTGG - Intronic
1152513202 17:80804221-80804243 TCCGTTTGCAGAGGGGGTGGGGG + Intronic
1152889344 17:82871643-82871665 TCCTTTTGGTCTGGGCGGGGCGG + Intronic
1153099511 18:1450896-1450918 TGCCTGTGGTGTGGGAGGGGTGG - Intergenic
1153495041 18:5689305-5689327 GGCCTGTGGGGTGGGGGTGGGGG - Intergenic
1154054567 18:11000616-11000638 TCCCTTTGGTTCAGGGGTGCAGG - Intronic
1154056735 18:11019696-11019718 TCCCTTGTGTGTTGGGGTAGGGG - Intronic
1154170713 18:12048209-12048231 TGCCGGTGGTGTGGGGGTTGGGG - Intergenic
1156269059 18:35514344-35514366 TCCCTTTGATGGGGAGTTGGGGG + Intergenic
1156438713 18:37162240-37162262 CCCTTTTTTTGTGGGGGTGGGGG + Intronic
1156664494 18:39389693-39389715 TCCCTTGGCTTGGGGGGTGGGGG - Intergenic
1156707391 18:39899756-39899778 TTTTTTTGGAGTGGGGGTGGTGG - Intergenic
1157059608 18:44272553-44272575 TGTATTTGGTGTGGGGATGGGGG + Intergenic
1157444719 18:47736175-47736197 TCCGCTTGGTGTGGGGGTTGGGG + Intergenic
1157799834 18:50610212-50610234 TCCCTTGGCCTTGGGGGTGGCGG - Intronic
1158966932 18:62630334-62630356 TCTTTTTGGTGATGGGGTGGTGG + Intergenic
1159023312 18:63160798-63160820 TTCCTTTGGGGTGGGGGTAAGGG + Intronic
1160804895 19:988334-988356 TCCCTGTGGCGTGGGAGGGGCGG - Intronic
1160966926 19:1750740-1750762 TCCCTGTGGGGTGGGGAAGGGGG + Intergenic
1160968967 19:1759078-1759100 TCCACCTGGGGTGGGGGTGGGGG - Intronic
1161056433 19:2192947-2192969 TCCCACTGGTGTGGTGGCGGCGG + Intronic
1161089399 19:2352584-2352606 GACCTTTGGGGTGGGGGTGCTGG - Intronic
1161250622 19:3278124-3278146 GCCCTTGGCCGTGGGGGTGGGGG + Intronic
1161448269 19:4329821-4329843 TGCCTTGGGGCTGGGGGTGGGGG - Intronic
1161703279 19:5806035-5806057 ACCCTTTGGTGTTGGGGGTGGGG + Intergenic
1162773676 19:12965741-12965763 ACAGCTTGGTGTGGGGGTGGAGG - Intronic
1163424716 19:17235164-17235186 GCCCTTTGGTGAGGGAGTAGGGG + Intronic
1164026999 19:21361425-21361447 TACCATTGGTCTGGGTGTGGTGG - Intronic
1164595991 19:29530881-29530903 TCCCTTTGGCTTTGGGGTGGGGG + Intronic
1164701685 19:30289207-30289229 TCTCATTTGTGAGGGGGTGGAGG - Intronic
1164733651 19:30524702-30524724 TCCTGTTTGGGTGGGGGTGGAGG - Intronic
1166299852 19:41907367-41907389 GCACTTGGGGGTGGGGGTGGAGG - Exonic
1166408597 19:42541258-42541280 TTCCAGTGGTGTGGGGGTGAGGG + Intronic
1167112762 19:47471758-47471780 CCCCATTGGTGGGGAGGTGGGGG - Intronic
1167597015 19:50433093-50433115 TCCCTTTGCTGTGCGGGATGGGG + Intronic
1167769547 19:51506015-51506037 TGCCTTTGCTGTGGGGCTGAGGG + Intergenic
1168338369 19:55609778-55609800 TCCCTTGGTGGTGGTGGTGGAGG + Intronic
1168646362 19:58061460-58061482 TCCCTTTGGTCTGGGGTTTTGGG - Intronic
925089057 2:1138503-1138525 TGCCTGTGGGGTGGGGGCGGAGG + Intronic
925433271 2:3815259-3815281 TCCCTTTGCTGGTGGGGAGGGGG + Intronic
925831941 2:7904322-7904344 ACCCTTTTGAGTGGGTGTGGTGG + Intergenic
926699639 2:15795221-15795243 TCTCCTGGGGGTGGGGGTGGGGG - Intergenic
927418844 2:22908270-22908292 GCCCTTTGGTGTGGCTGTGAGGG - Intergenic
928124129 2:28604345-28604367 TGCCTTTGGAGTGGGAGTGGGGG - Intronic
928389642 2:30899273-30899295 TGCCATTGGTGAGGGGGTGGTGG - Intergenic
928420620 2:31135779-31135801 GTCCTTTGGCATGGGGGTGGGGG - Intronic
929461323 2:42103686-42103708 TCCCTATTGTGGGGGGGGGGCGG + Intergenic
930280194 2:49360700-49360722 TGACTTTGGGGTGGGGGAGGTGG - Intergenic
930879391 2:56254324-56254346 TCTCTTTGTTCTTGGGGTGGTGG + Intronic
931082282 2:58787815-58787837 CCACTTTGGTATGGTGGTGGGGG - Intergenic
931171326 2:59806868-59806890 TCTCTTTTGGGTGGGGGTGGGGG - Intergenic
931720451 2:65063606-65063628 ACCCTCTGGGGTAGGGGTGGGGG - Intronic
931740844 2:65242136-65242158 TCCCTTTAGTATTGGGGAGGGGG + Intronic
932272873 2:70426002-70426024 GCCCTTTGGTTTGGGGGTGGGGG + Intergenic
932336199 2:70932748-70932770 TCACCTTGGGGTGGGGGAGGGGG - Exonic
932764007 2:74458731-74458753 TCCCTTCCTTTTGGGGGTGGGGG + Intronic
934566374 2:95343887-95343909 TTGCTTTGGGGTCGGGGTGGGGG - Intronic
934849315 2:97687417-97687439 TTGCTTTGTTGTGGTGGTGGTGG - Intergenic
935206093 2:100897500-100897522 TTGCTTTGGTGAGGGGGAGGTGG - Intronic
935567260 2:104621645-104621667 CCACATTGGTGGGGGGGTGGGGG + Intergenic
937221181 2:120344150-120344172 TTCCCTGGGGGTGGGGGTGGGGG + Intergenic
938097132 2:128471355-128471377 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938097139 2:128471389-128471411 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938097217 2:128471683-128471705 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938537587 2:132258094-132258116 GCTCGTTGGTGTGGGGGTCGAGG - Intergenic
939109637 2:137992019-137992041 TCCCTTGGCTGGGGGGGAGGGGG - Intronic
939741103 2:145907547-145907569 TTCATTTGCTGGGGGGGTGGGGG - Intergenic
940765332 2:157784179-157784201 TTTATTTGGTGTGGGAGTGGGGG + Intronic
940902438 2:159137906-159137928 TCCTCCTGGTGTGGGAGTGGGGG + Intronic
941111544 2:161423299-161423321 GTCCCTTGGGGTGGGGGTGGGGG - Intronic
941437715 2:165492073-165492095 TTCCTTTGGGGTGGGAGTTGGGG - Intronic
941631626 2:167891126-167891148 TTCCTGTGTTGTGGGGATGGGGG + Intergenic
941638370 2:167960770-167960792 ACTCTATGGTGGGGGGGTGGGGG - Intronic
942510716 2:176696847-176696869 TCTCCTAGGAGTGGGGGTGGTGG - Intergenic
943049214 2:182895041-182895063 GACCCTTGGTGTGGTGGTGGTGG - Intergenic
943867387 2:192944054-192944076 TCTCTTTTATGTGGTGGTGGTGG + Intergenic
944531275 2:200670120-200670142 CCCGTTTGGGGTTGGGGTGGAGG - Intronic
944604947 2:201344396-201344418 TCATTATGGGGTGGGGGTGGAGG + Intronic
944911193 2:204312076-204312098 GCCCTTTGTTCTTGGGGTGGGGG - Intergenic
944954493 2:204792651-204792673 TGTATTTGGTGTGGGGGTGTTGG - Intronic
945198283 2:207257480-207257502 TCCCTCTGGGGTGGGGAGGGAGG - Intergenic
945778764 2:214140924-214140946 TCCCATTGGTGGGGGGGGGGGGG + Intronic
946974806 2:225136624-225136646 TCCCTGTAGAGTGGTGGTGGGGG + Intergenic
947054033 2:226079939-226079961 TCTGTTTGGAGTGGGGGTGGAGG + Intergenic
947285207 2:228506470-228506492 TGGGTTTGGTGTGGGGGTGGTGG + Intergenic
947597068 2:231419588-231419610 TCCCTCTGATGTTGGGGTTGGGG + Intergenic
947844412 2:233232468-233232490 TCCCTCTGTTGTTGGGGTCGGGG - Intronic
948714499 2:239852015-239852037 TTCCCTGGGTGGGGGGGTGGTGG + Intergenic
948838209 2:240636421-240636443 TGCATTTGGTGGGGGGGTCGGGG + Intergenic
1168831095 20:845596-845618 TCCCTATGGCGTGTCGGTGGTGG + Exonic
1169065098 20:2690746-2690768 TCCCGTGTGTGTGGGGTTGGGGG + Intergenic
1169114219 20:3052547-3052569 TTTTTTTGGTGGGGGGGTGGGGG - Intergenic
1169304930 20:4481400-4481422 TTTTTTTTGTGTGGGGGTGGGGG + Intergenic
1169506041 20:6213014-6213036 ACCCATTGGGTTGGGGGTGGGGG - Intergenic
1169757824 20:9062337-9062359 TACCTGTGGTGTGGTGGTGGTGG + Intergenic
1170330867 20:15209078-15209100 TCCCTTTCCTGTGGTGGTGGTGG + Intronic
1170662615 20:18357798-18357820 TACCTTTGGTGAGTGGATGGGGG + Intergenic
1171768350 20:29302035-29302057 GCTCGTTGGTGTGGGGGTCGAGG - Intergenic
1171811053 20:29744282-29744304 GCTCGTTGGTGTGGGGGTCGAGG - Intergenic
1172691978 20:36796447-36796469 TCCTTATGGTCTTGGGGTGGGGG + Intronic
1172750782 20:37249543-37249565 TCTATTTGGGTTGGGGGTGGTGG + Intergenic
1172793850 20:37523934-37523956 TCCCTTTGGGGAGGGGGAAGTGG - Intronic
1173480601 20:43395850-43395872 TCTCTTTGGGCTGGGCGTGGTGG + Intergenic
1174199650 20:48798364-48798386 ACCCTTAGGTGTGGGTATGGAGG - Intronic
1174240515 20:49130748-49130770 TCCCTGAGGGGTGGGTGTGGTGG + Intronic
1174511024 20:51052628-51052650 TCTTTTTGTTGTGGTGGTGGTGG + Intergenic
1174568988 20:51487731-51487753 AGTCTTTGGTGTGGGGGCGGAGG - Intronic
1175232238 20:57481342-57481364 TCCCCTGGGTCTGGAGGTGGAGG - Intergenic
1175527068 20:59642411-59642433 TATCTCTGGGGTGGGGGTGGGGG - Intronic
1175761560 20:61565156-61565178 TCCTCTTGGTGATGGGGTGGTGG + Intronic
1175857210 20:62128212-62128234 TCTCTGTGCTGTGGTGGTGGCGG + Intronic
1176128400 20:63486115-63486137 TCCCTTTTGTGTGGGTTTGAGGG + Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1178461897 21:32810052-32810074 TGGATTTGGTATGGGGGTGGTGG - Intronic
1178566721 21:33693354-33693376 TTTTTTTGGTGGGGGGGTGGGGG + Intronic
1179883868 21:44305179-44305201 TTCCTGTAGTGTGGGGATGGTGG + Intronic
1180027105 21:45172211-45172233 TCTCTCTGGTGCCGGGGTGGTGG + Intronic
1180035369 21:45245576-45245598 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035400 21:45245648-45245670 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035414 21:45245684-45245706 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035430 21:45245720-45245742 TGCCTATGGGGTGGGGGTGAGGG + Intergenic
1180035443 21:45245756-45245778 TGCCTATGGGGTGGGGGTGAAGG + Intergenic
1180199937 21:46218103-46218125 TGACTTTGGTGCGGGGGTGGGGG - Intronic
1180342055 22:11627626-11627648 GCTCGTTGGTGTGGGGGTCGAGG + Intergenic
1181113108 22:20613340-20613362 CACTTTTGCTGTGGGGGTGGGGG - Intergenic
1181257642 22:21574171-21574193 TCCCTTTCTTATAGGGGTGGGGG - Intronic
1181593464 22:23898254-23898276 GCCCTTCAGTGTGGGGCTGGTGG - Intronic
1181669723 22:24420466-24420488 TCCCTTGGGCCTGGGGGTGGGGG + Intronic
1181997949 22:26897766-26897788 TTCCTTTGTTTTAGGGGTGGAGG + Intergenic
1182144240 22:27987377-27987399 TCCCTTTGGTGTGGGGGTGGTGG - Intronic
1182455538 22:30448032-30448054 TCCCTTGGGAGAGGGGGTGGTGG + Intronic
1182615498 22:31586254-31586276 TGCCTCTGGGGTAGGGGTGGAGG - Intronic
1183096349 22:35554455-35554477 TCTCAGTGGGGTGGGGGTGGAGG - Intergenic
1183212821 22:36461473-36461495 TCCTTGTGGGGTGGGGGTTGGGG + Intergenic
1183268926 22:36848876-36848898 ACCCTGTGGCGGGGGGGTGGGGG - Intergenic
1183807048 22:40220367-40220389 TCCCTTTGAGGGAGGGGTGGAGG + Intronic
1184096329 22:42318327-42318349 TCTTTTTGGGGTGGGGCTGGGGG - Intronic
1184114296 22:42413270-42413292 TGCCTGTGGTGTGGGGCTGGAGG + Intronic
1184118734 22:42437062-42437084 TCCTTTTGGTGTGGCGGGGTTGG - Intergenic
1184632087 22:45789664-45789686 CCCCTTTGTGGTGGTGGTGGTGG + Intronic
950640555 3:14345715-14345737 TGCCTTTGGTTTAGGGGTGTTGG - Intergenic
950849226 3:16046566-16046588 TATGTTTGGTGTGGTGGTGGTGG + Intergenic
951685297 3:25337211-25337233 TAACTTTTTTGTGGGGGTGGGGG - Intronic
951720095 3:25689098-25689120 CCCCTTTAGGTTGGGGGTGGGGG + Intergenic
952088653 3:29857368-29857390 CCCCGTGGGGGTGGGGGTGGGGG - Intronic
952116983 3:30194524-30194546 TCACATTGTTTTGGGGGTGGTGG + Intergenic
952503879 3:33989674-33989696 TCCCTTGGCTGGGGGGGTGGGGG + Intergenic
952764479 3:36943184-36943206 TCCCTCTGGTGGGGGGTGGGGGG + Intronic
954413000 3:50379290-50379312 TCCATCTGCTGTGGGGGAGGAGG - Intronic
954639583 3:52089955-52089977 TACCATGGGGGTGGGGGTGGGGG + Intronic
954792456 3:53143329-53143351 TCCCTCTAGCCTGGGGGTGGTGG + Intergenic
955060700 3:55489436-55489458 CCTCTGGGGTGTGGGGGTGGAGG - Intronic
956085260 3:65601599-65601621 TGTGTTTGGTGTGGAGGTGGGGG - Intronic
956169825 3:66424237-66424259 TCCACTTGCTGTGGGAGTGGGGG - Intronic
956315746 3:67934520-67934542 CATCTTTGGGGTGGGGGTGGAGG - Intergenic
956593207 3:70938493-70938515 TCTTTTTGCAGTGGGGGTGGGGG - Intergenic
956681853 3:71788348-71788370 TCCCGTGTGTGTGGGGGGGGTGG - Intergenic
957131124 3:76223363-76223385 TACCTTTGGTGTGGGGAAGTAGG + Intronic
958133564 3:89459808-89459830 TCCCTTTGGGCTGGATGTGGTGG - Intronic
958611620 3:96433708-96433730 TCTGTTTGGGGTGGGAGTGGGGG + Intergenic
959595202 3:108122086-108122108 TTCCTTTGTCGTGGCGGTGGTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
960851133 3:122055854-122055876 TCAGTTTGGTCTGAGGGTGGAGG + Intronic
961043392 3:123693073-123693095 ACTCTTTGGAGTGGGGGAGGAGG - Intronic
961378692 3:126483263-126483285 TCTCCTGGGTGTGGGGATGGGGG - Intronic
961462732 3:127062979-127063001 CCACCGTGGTGTGGGGGTGGTGG + Intergenic
962534346 3:136314387-136314409 ACCCTTTGGGCTGGGTGTGGTGG + Intronic
962741227 3:138363824-138363846 ACCCTGTGGTTTGGGGGGGGGGG - Intronic
962796814 3:138856537-138856559 TCCCTGTGGGGTAGGGGTTGTGG - Intergenic
963895147 3:150677578-150677600 TCCCTTGAGCCTGGGGGTGGAGG - Intronic
964480555 3:157134500-157134522 TGGCAGTGGTGTGGGGGTGGAGG + Intergenic
964526735 3:157622665-157622687 TCACTTTTGTGTGTGTGTGGTGG + Intronic
964659979 3:159109645-159109667 TTTCTTTGGTGTGGGTGTGTGGG + Intronic
964914523 3:161823837-161823859 TCCTACAGGTGTGGGGGTGGTGG + Intergenic
965881883 3:173396849-173396871 TCCCATTGGGGTGGGGGTGGGGG + Intronic
966460691 3:180173053-180173075 TCCATTTGGTGAGTGGGTCGTGG - Intergenic
966529248 3:180956189-180956211 TCCCTTTGATTTGGGAGGGGTGG - Intronic
966809702 3:183832823-183832845 TCCATATGGTGTGGTGGGGGTGG + Intronic
967292837 3:187937910-187937932 TCCATTTAGTGTGTGTGTGGAGG - Intergenic
967822789 3:193853786-193853808 GGCCTGTGGTGTGGGGGTTGAGG - Intergenic
968230818 3:197003513-197003535 CCGCTCTGGGGTGGGGGTGGGGG + Intronic
968296259 3:197578592-197578614 TTATTTTTGTGTGGGGGTGGGGG - Intergenic
968581151 4:1396015-1396037 GCCCTGTGGGGTGGGGGTGCTGG + Intergenic
968646899 4:1745737-1745759 TCACCTGGGTGTGGGTGTGGAGG + Intergenic
968648560 4:1751524-1751546 TCCATCTGGGGTGGGGGTTGTGG - Intergenic
968649270 4:1753982-1754004 TCCCCATGGTGTCGGGCTGGGGG - Intergenic
968662915 4:1806183-1806205 GCCCTGGGGTGCGGGGGTGGGGG + Intronic
968837102 4:2973094-2973116 TGGCTTTGGTGAGGTGGTGGAGG - Intronic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
969626139 4:8306655-8306677 TCCCTTTGGGGTGCGGGGGTGGG + Exonic
970038170 4:11763773-11763795 TCTCTTTTGTGTGGAGGTGGGGG + Intergenic
970137027 4:12936505-12936527 TGCATTTGGGGTGGTGGTGGTGG - Intergenic
970235140 4:13951118-13951140 CTGCTTTGGGGTGGGGGTGGAGG - Intergenic
970506714 4:16738283-16738305 CCCTTTTGGTGTTGGGGAGGTGG - Intronic
970542010 4:17089332-17089354 TCCCTTTGGTAAGGGGGTCAGGG + Intergenic
970867830 4:20779578-20779600 TCTTTTTTGTGTGGGGGGGGGGG - Intronic
971615665 4:28788022-28788044 TGCCTTTATTGTGGGGTTGGGGG + Intergenic
973532850 4:51850636-51850658 TCCTTTTAGTGTAGGGGAGGGGG + Intronic
973852672 4:54976843-54976865 TCCCTCTGGTGTGCAGGTGCTGG - Intergenic
974049540 4:56927696-56927718 TGCCTTTAATTTGGGGGTGGGGG + Intronic
975622524 4:76308327-76308349 TTTATGTGGTGTGGGGGTGGTGG - Intronic
976111087 4:81674541-81674563 TTCCCTGGGGGTGGGGGTGGGGG + Intronic
977194051 4:94037133-94037155 TGTCTTTCCTGTGGGGGTGGTGG - Intergenic
978218856 4:106244695-106244717 TACCTTTGGTGTTTGGCTGGAGG - Exonic
978428916 4:108611938-108611960 TACTTTTCATGTGGGGGTGGGGG + Intergenic
979363091 4:119787530-119787552 TCCCTTGGGTCTGGAGGTAGAGG - Intergenic
979679420 4:123443528-123443550 TCTCTTTTTTGAGGGGGTGGAGG - Intergenic
981847965 4:149191370-149191392 TATTTTTGGGGTGGGGGTGGTGG - Intergenic
982297799 4:153847729-153847751 TCCATCTTGTCTGGGGGTGGGGG - Intergenic
982746695 4:159111142-159111164 TACCCTTGGTGCGGTGGTGGTGG + Intronic
983253065 4:165366428-165366450 TTCCTTTGGAGGGGGCGTGGTGG + Intronic
984192287 4:176620105-176620127 TTCCATTGGTTTGGGGGTGTAGG + Intergenic
984474006 4:180214702-180214724 TCCCTTGGGGCTGGGCGTGGAGG + Intergenic
984655748 4:182316586-182316608 TTCCTTTTTTGTGGGAGTGGGGG - Intronic
984805018 4:183744160-183744182 TCCGTTTGGACTGGGTGTGGTGG + Intergenic
985224562 4:187746164-187746186 TCCCTTTTTCCTGGGGGTGGTGG + Intergenic
985940787 5:3134024-3134046 TTCCCCTGGGGTGGGGGTGGGGG + Intergenic
986167895 5:5291655-5291677 GCCTTGTGGTGTGGGGGTGGGGG - Intronic
987492475 5:18598315-18598337 TCCCTTTGGGGAAGGGCTGGGGG - Intergenic
987858076 5:23447429-23447451 TCCCTGAGGTCTGGGGGAGGTGG - Intergenic
988046321 5:25960151-25960173 TCCCTTTGGTGTTTTGGTGGTGG - Intergenic
989302671 5:39912351-39912373 TCCCCATGGTTGGGGGGTGGGGG + Intergenic
989412926 5:41140935-41140957 TCCCTTTGGTGAGGAGGAGGAGG - Intergenic
989970711 5:50521174-50521196 TCCTCTTGGCCTGGGGGTGGTGG - Intergenic
990208313 5:53453894-53453916 TGCCATTGGGGAGGGGGTGGGGG - Intergenic
990237627 5:53784565-53784587 TCTCCTTGGTGTGGGGGTGGGGG + Intergenic
990507547 5:56459321-56459343 TGCCCTTGGAGTGGGGGTGGGGG + Intronic
990516558 5:56535811-56535833 ACTCTTTTCTGTGGGGGTGGAGG + Intronic
992255790 5:74919761-74919783 TCACTTTGAAGTGGGGGGGGGGG - Intergenic
992793468 5:80234513-80234535 GCCCTTTGTGGTGGGAGTGGTGG - Intronic
992935078 5:81694645-81694667 TCACTTTAGTTTGGTGGTGGTGG - Intronic
993890547 5:93466895-93466917 TCCCTTTTTTGGGGGGGGGGGGG + Intergenic
995410569 5:111852650-111852672 TCCATTTTTTGTGGGGGAGGGGG + Intronic
995847782 5:116512690-116512712 TGTGTTTGGGGTGGGGGTGGTGG - Intronic
995930812 5:117440389-117440411 TCGTTTTGTTGTGGTGGTGGTGG + Intergenic
996064638 5:119067435-119067457 TCTATTTGGGGTGGGGGAGGAGG + Intronic
996752383 5:126901949-126901971 TTCCATGGGTGTTGGGGTGGTGG - Intronic
997234225 5:132263500-132263522 TCCACTGGGGGTGGGGGTGGGGG + Intronic
997852924 5:137348462-137348484 TCCCAGAGGGGTGGGGGTGGGGG + Intronic
998601248 5:143587340-143587362 TCCTTTTCTTCTGGGGGTGGGGG + Intergenic
1000286941 5:159834904-159834926 TCCTTTTGCGGCGGGGGTGGGGG - Intergenic
1000937010 5:167314010-167314032 ACCCTTTTGTATCGGGGTGGGGG - Intronic
1001411130 5:171512792-171512814 CCCTTTTGGGGTGAGGGTGGTGG - Intergenic
1001832600 5:174802100-174802122 AGCCTTGGGTGGGGGGGTGGCGG + Intergenic
1001919200 5:175587304-175587326 TGCCTGTGATGTGGGGGTGGGGG + Intergenic
1001980786 5:176035867-176035889 TTGCATTGCTGTGGGGGTGGGGG - Intergenic
1002236674 5:177808198-177808220 TTGCATTGCTGTGGGGGTGGGGG + Intergenic
1002795310 6:466821-466843 TCCCTGTGGTCAGGGGATGGTGG + Intergenic
1003108079 6:3230222-3230244 TCCAGTGGGGGTGGGGGTGGGGG - Intronic
1003407150 6:5834764-5834786 TTCGATTTGTGTGGGGGTGGGGG + Intergenic
1004008321 6:11657301-11657323 TCCCTTTAGTGAGGGGATGTGGG + Intergenic
1004203849 6:13574148-13574170 TTTATTTGGGGTGGGGGTGGGGG - Intergenic
1004245079 6:13966767-13966789 TTTTTTTGGTGGGGGGGTGGGGG - Intronic
1004551665 6:16653887-16653909 ACCCTTTGCTGTGGGAGAGGAGG + Intronic
1004742031 6:18471503-18471525 TCCAGGTGGTGTGGGGTTGGAGG + Intergenic
1004983157 6:21049018-21049040 TGACTTAGGGGTGGGGGTGGAGG + Intronic
1005051952 6:21692936-21692958 CCCCTTTGCTGTGGGGGTGAGGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005612083 6:27535985-27536007 TCCCTGGGGTGTGGGGGTGAAGG - Intergenic
1006295517 6:33168460-33168482 TCCCTGGGCTGTGTGGGTGGAGG - Intronic
1007581573 6:42963220-42963242 GCCCTCTGGGGTGGGGGTGGGGG + Intronic
1007582993 6:42970251-42970273 TCCCATTGGTGTGGGTGGGTAGG - Intronic
1008215083 6:48778532-48778554 TCCCCATGGCCTGGGGGTGGTGG + Intergenic
1008639805 6:53450171-53450193 TCTCTGGGGTGTGGGTGTGGTGG + Intergenic
1008727875 6:54442973-54442995 TGCCCCTGCTGTGGGGGTGGGGG + Intergenic
1010752162 6:79627868-79627890 TCCCTTTAGGCTGGGGGTGAGGG - Intergenic
1011223739 6:85084833-85084855 TGTCTTTGCTATGGGGGTGGGGG + Intergenic
1011277325 6:85643405-85643427 ACCCCTTGGGTTGGGGGTGGGGG + Intronic
1011297694 6:85841220-85841242 TCCCTGTGGGGTGGGGGTGGGGG + Intergenic
1013044606 6:106471743-106471765 ACCCTTTGGAGTGGGGCTGGGGG - Intergenic
1013315376 6:108937290-108937312 TCACCTTGGGGTGGGGGAGGGGG + Intronic
1013328741 6:109075858-109075880 TCCCTCTGGGGTCGGGGAGGGGG - Intronic
1013833520 6:114303309-114303331 TTCTTTTGAGGTGGGGGTGGGGG - Intronic
1014930769 6:127333078-127333100 TCCCTCTGGGCTGGGCGTGGTGG - Intronic
1015208245 6:130666444-130666466 TGACATGGGTGTGGGGGTGGAGG + Intergenic
1015416225 6:132951781-132951803 TCTCTACGGAGTGGGGGTGGCGG - Intergenic
1015633299 6:135252405-135252427 TCACTTTGGTGGCAGGGTGGTGG - Intergenic
1016932978 6:149427708-149427730 TCCCTTTGGTGGAGGACTGGGGG + Intergenic
1017113385 6:150953373-150953395 GCCAGTGGGTGTGGGGGTGGAGG - Intronic
1017476102 6:154794750-154794772 TCCTTTTGGTGGGGGGGGGGGGG + Intronic
1017684872 6:156902342-156902364 TCTCTTTTGTGTGGTGGAGGTGG + Intronic
1017704972 6:157113741-157113763 TCCCTTTTGTGTGTGTGTGTTGG + Intronic
1018703315 6:166445220-166445242 TCACAGTGGGGTGGGGGTGGGGG + Intronic
1018924614 6:168197638-168197660 TCGCTGTGATCTGGGGGTGGAGG + Intergenic
1018980470 6:168598277-168598299 TCCCCCTCGTTTGGGGGTGGGGG + Intronic
1019043398 6:169124670-169124692 ACTCTTCGGTGTGGGGGTAGGGG + Intergenic
1019339937 7:504228-504250 TGCCTGTGGTGGGTGGGTGGTGG - Intronic
1019667619 7:2259618-2259640 TGCTTTGGGTGTGGGGTTGGTGG - Intronic
1019934925 7:4247896-4247918 TTCCTCTGGTGTGGGGCTGGAGG - Intronic
1020058603 7:5135764-5135786 TTTCTTTGGGGTGGGGGTTGCGG - Intergenic
1020191512 7:6002527-6002549 TCCCTCTGGGGCGGGGGTAGGGG + Exonic
1020337820 7:7076247-7076269 ACTGGTTGGTGTGGGGGTGGGGG + Intergenic
1020760398 7:12261776-12261798 TCCTTTGGGTGGGGGGGGGGAGG + Intergenic
1021018599 7:15567300-15567322 TCCCTTTTTTTTGGGGGGGGGGG + Intergenic
1023768509 7:43533712-43533734 TGCCTTTGGTGAGGAGGTGGGGG - Intronic
1024136592 7:46415071-46415093 TCCCTTTGGTGGGGTGGGGGTGG - Intergenic
1024378353 7:48664870-48664892 ACACTTTTTTGTGGGGGTGGCGG - Intergenic
1024498364 7:50072216-50072238 TCCCACTGGCCTGGGGGTGGTGG + Intronic
1024627711 7:51222648-51222670 ACCCTTTGGTCTAGGGGTAGAGG + Intronic
1026090476 7:67295692-67295714 TCCCTCTGGGGTGGGGGTAGGGG + Intergenic
1026464094 7:70639168-70639190 GACTTTTGGTGTGGTGGTGGCGG - Intronic
1026745959 7:73013181-73013203 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1026749612 7:73041325-73041347 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1026753260 7:73069435-73069457 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1026756911 7:73097471-73097493 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1026832465 7:73618563-73618585 TTGCTTTGGGGTGGGGGTGGGGG + Intronic
1026914570 7:74112111-74112133 TCAATTTGAGGTGGGGGTGGGGG + Intronic
1027032066 7:74897739-74897761 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1027090495 7:75296015-75296037 TCCCTCTGGGGTGGGGGTAGGGG + Intergenic
1027094140 7:75323943-75323965 TCCCTCTGGGGTGGGGGTAGGGG + Intergenic
1027097783 7:75351910-75351932 TCCCTCTGGGGTGGGGGTAGGGG + Intergenic
1027120072 7:75511005-75511027 TCCCTCTGGGGTGGGGGTAGGGG + Intergenic
1027271757 7:76524604-76524626 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1027321564 7:77015759-77015781 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1027325198 7:77043682-77043704 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1028389206 7:90295459-90295481 TTCCTTTGGTTTGGGGCTGAGGG + Intronic
1028428310 7:90716253-90716275 CTCCTTTGGTGTGGGTGTGAGGG - Intronic
1028459085 7:91071443-91071465 TCCCTTGGCTGGGGGGGTGAGGG - Intronic
1029398883 7:100328910-100328932 TCCCTCTGGGGTGGGGGTAGGGG + Intergenic
1029679599 7:102099133-102099155 TCCCTGTAGTGTGGGCATGGGGG + Intronic
1029717433 7:102339019-102339041 TCCCTCTGGGGTGGGGGTAGGGG - Intergenic
1029787355 7:102806014-102806036 TCTGTTTGGTGTGGGGGTCCAGG + Intronic
1030114110 7:106050219-106050241 TCCCTTTTCTGTGGGGCTGGAGG + Intergenic
1030162718 7:106525256-106525278 GCCCTTTGGTAAGGGGGTGTAGG + Intergenic
1030325929 7:108218164-108218186 TCCCTTGGCTGGGGGGGGGGGGG + Intronic
1031407359 7:121402685-121402707 TACCTTTTGTGTGGTGGTGAGGG - Intergenic
1031983764 7:128148796-128148818 TCCCACTGGGGTAGGGGTGGGGG + Intergenic
1032488629 7:132307150-132307172 TGCCCTTGGTGTGGGGTTGTAGG - Intronic
1033213178 7:139475552-139475574 TCCCCGTGCTGGGGGGGTGGCGG + Intronic
1033390533 7:140924209-140924231 TCTCTGTGGGGTGGGGGCGGCGG - Intronic
1033871106 7:145753272-145753294 TGCCTGTGGTGTCGCGGTGGAGG + Intergenic
1034150349 7:148910361-148910383 TCCTTGTGGGGTGGGGGTGGGGG - Intergenic
1034164997 7:149018835-149018857 TGCTCTTGGGGTGGGGGTGGGGG - Intronic
1034447268 7:151120090-151120112 TCGGATGGGTGTGGGGGTGGAGG - Exonic
1034469545 7:151248121-151248143 TGCCCTGGGGGTGGGGGTGGGGG - Intronic
1034477040 7:151291259-151291281 TCCCTTTGGTGCTGGGGTCTGGG - Intergenic
1035339563 7:158151560-158151582 TGCCTGTGGTGGGGTGGTGGTGG + Intronic
1035588299 8:793985-794007 TCCTTTTGGCCTGTGGGTGGGGG + Intergenic
1036263311 8:7257044-7257066 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036264614 8:7264666-7264688 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036265913 8:7272288-7272310 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036267215 8:7279910-7279932 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036268518 8:7287532-7287554 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036269822 8:7295154-7295176 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036298069 8:7551900-7551922 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036299374 8:7559550-7559572 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036300679 8:7567198-7567220 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036301986 8:7574844-7574866 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036303281 8:7582491-7582513 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036315355 8:7715583-7715605 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036316659 8:7723231-7723253 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036317966 8:7730879-7730901 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036319273 8:7738527-7738549 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036320582 8:7746174-7746196 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036321892 8:7753822-7753844 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036323201 8:7761470-7761492 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036324502 8:7769117-7769139 TCTCTTGGGTATCGGGGTGGGGG + Intergenic
1036351532 8:8015190-8015212 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036352842 8:8022836-8022858 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036354131 8:8030484-8030506 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036644664 8:10604575-10604597 TAGCATTGGGGTGGGGGTGGGGG + Intergenic
1036846790 8:12175609-12175631 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1036868155 8:12417928-12417950 TCTCTTGGGTATCGGGGTGGGGG - Intergenic
1037838672 8:22229281-22229303 CCCCTCATGTGTGGGGGTGGAGG + Intronic
1037881651 8:22576387-22576409 TCCCTGTGGGGTGGCAGTGGTGG + Intergenic
1037922064 8:22814457-22814479 CCTCTTTGGAGTGGAGGTGGGGG + Intronic
1038036575 8:23691361-23691383 TCCCTGTGGTGAGGGGCTGTAGG + Intergenic
1038571653 8:28667706-28667728 TTCCCTTGGTGTGGGGGGAGGGG + Intronic
1039118614 8:34120844-34120866 TCCCTTTTGTGTGGCTGTGATGG - Intergenic
1039568001 8:38564789-38564811 TCCCTTTGGTTTGGGGGAGTGGG + Intergenic
1039578806 8:38647041-38647063 TTTTTTTGGAGTGGGGGTGGTGG - Intergenic
1039621581 8:39001953-39001975 TACCTTTGGGCTGGGCGTGGTGG - Intronic
1041277364 8:56176402-56176424 GCTATTTGGGGTGGGGGTGGGGG + Intronic
1041394833 8:57379573-57379595 TCCCCTTGGTGTGTGGCTGTTGG - Intergenic
1041792921 8:61716018-61716040 TATCTTTGGTGTGGGGGGTGGGG - Intergenic
1042206151 8:66331901-66331923 TTCCTCTGGAGTGGGGGTGCAGG - Intergenic
1042902695 8:73745741-73745763 ACCCTTTGGAGTGGGGATGGGGG + Intronic
1044415727 8:91937229-91937251 TTCTTTTTTTGTGGGGGTGGGGG + Intergenic
1044432632 8:92126638-92126660 TTTTTTTGGTGGGGGGGTGGGGG - Intergenic
1044434929 8:92150820-92150842 TCTGTCTGGGGTGGGGGTGGAGG + Intergenic
1044973402 8:97641802-97641824 TTCCTTGGGGATGGGGGTGGAGG - Intergenic
1045474230 8:102539415-102539437 TGCTTTTGGGGTGGGGGTGAAGG + Intergenic
1045606344 8:103781374-103781396 TCCATTTTCTGTGGGGGTGGAGG + Intronic
1046082939 8:109394502-109394524 TCACTCTGTTGCGGGGGTGGTGG + Intronic
1046430150 8:114113793-114113815 TTCCTTTTGTGTGGGGGAGTGGG - Intergenic
1046708808 8:117486923-117486945 CCTCTTTCGTCTGGGGGTGGGGG - Intergenic
1046754869 8:117962760-117962782 TCTCTTTTTTTTGGGGGTGGGGG - Intronic
1046888110 8:119391281-119391303 TGCTTTTGGAGTGGGGGTTGGGG + Intergenic
1047753260 8:127898705-127898727 TCCCTGTGGTGGGGGTGAGGCGG + Intergenic
1048212808 8:132469670-132469692 TCTCTTTGGTTTGGGTCTGGAGG - Intronic
1048319559 8:133387812-133387834 TCCCTCTGGGGTGGGGGAGGAGG + Intergenic
1048399475 8:134050922-134050944 TCCCTTGGGGGAGGTGGTGGAGG + Intergenic
1049006023 8:139856207-139856229 GGCCTGTGGAGTGGGGGTGGAGG + Intronic
1049299746 8:141863199-141863221 GCCCTGCGTTGTGGGGGTGGTGG - Intergenic
1049924878 9:399270-399292 TCGCTCGGGGGTGGGGGTGGGGG - Intronic
1050156651 9:2673946-2673968 TCTATTTGCTGTGTGGGTGGAGG - Intergenic
1050324265 9:4485002-4485024 TCCTTTTTTTGGGGGGGTGGGGG + Intergenic
1051079584 9:13279282-13279304 GCGCTTGGGGGTGGGGGTGGGGG - Intronic
1051287303 9:15510487-15510509 TCTCTTCGGTGGCGGGGTGGAGG - Intronic
1051312799 9:15794466-15794488 TTTTTTTGGTGGGGGGGTGGGGG - Intronic
1051402171 9:16694871-16694893 TGCATTTGGGATGGGGGTGGGGG - Intronic
1051426271 9:16934745-16934767 TCACTTTGGGCTGGGCGTGGTGG - Intergenic
1051569292 9:18537616-18537638 TCCCAATGTTTTGGGGGTGGAGG + Intronic
1052647516 9:31254795-31254817 TTCCTTTGGTGTGTGTGTGGAGG - Intergenic
1053250663 9:36571852-36571874 GCACTTTGGTGGGGGGGCGGGGG - Intergenic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1053382999 9:37664223-37664245 TGCCCTTGGTGGTGGGGTGGGGG + Intronic
1054927793 9:70605444-70605466 GCCCCTGGGGGTGGGGGTGGGGG - Intronic
1055129138 9:72754380-72754402 CCCCTTAGGAGTGAGGGTGGAGG - Intronic
1055460956 9:76519794-76519816 ATTCTTTGTTGTGGGGGTGGAGG + Intergenic
1055943175 9:81669610-81669632 GTCTTTTGGTGTGGGGGGGGAGG - Intronic
1056419079 9:86406161-86406183 GGCTTTTTGTGTGGGGGTGGGGG + Intergenic
1057703110 9:97377794-97377816 GCACATTGGGGTGGGGGTGGGGG - Intronic
1057798329 9:98173827-98173849 AGCCTTTGGTCTGGGTGTGGTGG + Intronic
1058139913 9:101346349-101346371 TCCTTTTGGTGTGTGGGATGAGG + Intergenic
1058870810 9:109199953-109199975 TTCCTGTGGAGTGGGGGTCGGGG - Intronic
1059407400 9:114109752-114109774 ATCCTCTGGGGTGGGGGTGGCGG - Intergenic
1059876158 9:118637387-118637409 TCCCTTTGATGGAGGGGTTGGGG - Intergenic
1060195169 9:121618839-121618861 TGCCTTGGTGGTGGGGGTGGCGG + Intronic
1060237888 9:121878893-121878915 TCCCTGGGCTGTGGGGCTGGTGG + Intronic
1060268743 9:122127062-122127084 GCCCTTGGGTGCTGGGGTGGAGG + Intergenic
1060593192 9:124832279-124832301 TAACTTTTGTCTGGGGGTGGTGG + Intergenic
1060593834 9:124836084-124836106 TACCCTTGATGTGTGGGTGGTGG - Intergenic
1060619441 9:125050471-125050493 TCCCTGTGGTGGTGGGTTGGAGG - Intronic
1060655614 9:125370772-125370794 TCCTTTTCGTGTGGCTGTGGCGG + Intergenic
1060715229 9:125920435-125920457 TCCTTTTGGTAGGGTGGTGGAGG - Intronic
1061303162 9:129718065-129718087 TACCTTGGGGGAGGGGGTGGGGG - Intronic
1061366174 9:130173188-130173210 CCCCGTTCGTGTGGGGGGGGGGG + Intronic
1061421475 9:130475004-130475026 TACCTTGGAGGTGGGGGTGGAGG + Intronic
1061421601 9:130475755-130475777 TTTTTTTGGTGGGGGGGTGGGGG + Intronic
1061929231 9:133823971-133823993 TCCCTCAGTGGTGGGGGTGGGGG + Intronic
1062056778 9:134472926-134472948 TCCCTTGGGCGTGGAGGAGGTGG + Intergenic
1062349718 9:136132950-136132972 TCCCTGGGGTGCAGGGGTGGAGG + Intergenic
1203361686 Un_KI270442v1:222199-222221 GCTCATTGGTGTGGGGGTCGAGG - Intergenic
1185623545 X:1467525-1467547 TCCGCTTGGTGTGGCCGTGGGGG + Intronic
1186399537 X:9244548-9244570 TCCAGCTGGGGTGGGGGTGGGGG - Intergenic
1186526972 X:10257752-10257774 TTCCTTTGGTGTGTGTGTGGGGG - Intergenic
1186852337 X:13592852-13592874 TGCCTTTGTCGGGGGGGTGGGGG + Intronic
1187998136 X:24951346-24951368 TGCATTTGGTGGGGGGGGGGGGG - Intronic
1188445522 X:30249803-30249825 TCTATTTGGGGTGGGGGTTGGGG - Intronic
1188452190 X:30319323-30319345 TCCCATAGGTGTGGGGGTTTGGG - Intergenic
1188512219 X:30948779-30948801 TGTCTGTGGGGTGGGGGTGGGGG - Intronic
1188582013 X:31725378-31725400 TCCTTTTGGGGTGGTGGTGGGGG + Intronic
1189279624 X:39812033-39812055 TCCATTTGGTGTGTGGGTAGGGG - Intergenic
1189315815 X:40055811-40055833 TCCTTTTTTTGCGGGGGTGGGGG + Intronic
1189501091 X:41559843-41559865 TCCCTCTGGAGGGGGGGTGGTGG + Exonic
1190267013 X:48832548-48832570 GCGCTGTGGGGTGGGGGTGGGGG - Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191065627 X:56343880-56343902 TTCCTCTGGTTTCGGGGTGGGGG + Intergenic
1191857322 X:65637527-65637549 TCACTGTGGGGTGGGGGTTGGGG - Intronic
1191892696 X:65961013-65961035 TACTCTTGGTGTGGGGATGGAGG + Intergenic
1191900438 X:66034755-66034777 ACCCTTGGGGATGGGGGTGGGGG + Intronic
1192145545 X:68679901-68679923 ACCCATTGTTGTTGGGGTGGGGG + Intronic
1192313286 X:70033637-70033659 TGCTTTGGGTGAGGGGGTGGGGG + Intronic
1192763554 X:74120896-74120918 ACCCAGTGGGGTGGGGGTGGGGG + Intergenic
1194288487 X:92039491-92039513 TCCCTGTGGGCTGGTGGTGGTGG - Intronic
1194841930 X:98753787-98753809 TCCCTTTGGACTGGTGGTGGTGG - Intergenic
1195081620 X:101376723-101376745 TTCCTCTGGTGGGGGGGTGGGGG + Intronic
1195173707 X:102294640-102294662 TATCATTGGTTTGGGGGTGGGGG + Intergenic
1195185158 X:102392453-102392475 TATCATTGGTTTGGGGGTGGGGG - Intronic
1195449140 X:104990390-104990412 TCCCCTTGGGATGGGGTTGGAGG + Intronic
1195720743 X:107865553-107865575 ACCCTTTGGGGTGGGCGGGGAGG - Intronic
1195989206 X:110666065-110666087 TCACTTAGGTGCTGGGGTGGGGG - Intergenic
1196580273 X:117370940-117370962 CCCCTTTGGTGTGTGTATGGGGG - Intergenic
1197114739 X:122818589-122818611 ACCCTTTGCTGTGGGGGTCGCGG - Intergenic
1197302870 X:124802523-124802545 TCCCTTGGCTGGGGGGCTGGGGG + Intronic
1198182221 X:134220924-134220946 GCCTTTGGGTGTGTGGGTGGGGG + Intergenic
1198338247 X:135689289-135689311 ACCCTTGGTTGTGGTGGTGGTGG + Intergenic
1198871493 X:141180581-141180603 TCCCTCTGCTGTGGGGTTGTAGG - Intergenic
1199011325 X:142762096-142762118 TACCTTGGGTGGGGGGGTGTGGG + Intergenic
1199330439 X:146552156-146552178 CCCCTGTGTTGTGGTGGTGGGGG - Intergenic
1199665773 X:150095343-150095365 GGCCTTTGGTGAGGGGATGGGGG + Intergenic
1199668212 X:150118962-150118984 TCTCCCTGGGGTGGGGGTGGGGG + Intergenic
1200173178 X:154094124-154094146 CCCCTTTGATGTGGGGGTGGGGG + Intronic
1200218962 X:154381255-154381277 TGCCTTAGCAGTGGGGGTGGGGG + Exonic
1200292282 X:154885582-154885604 TTGCCTTGGGGTGGGGGTGGGGG + Intronic
1200325467 X:155233715-155233737 TACCTTTGCGGTGGGGGTGCTGG + Intronic
1200339119 X:155381319-155381341 TTGCCTTGGGGTGGGGGTGGGGG + Intergenic
1200347350 X:155459373-155459395 TTGCCTTGGGGTGGGGGTGGGGG - Intergenic
1200606006 Y:5264056-5264078 TCCCTGTGGGCTGGTGGTGGTGG - Intronic
1201076755 Y:10195357-10195379 GCTCGTTGGTGTGGGGGTTGAGG + Intergenic