ID: 1182145512

View in Genome Browser
Species Human (GRCh38)
Location 22:27994632-27994654
Sequence AGTATCCAGGAGGAGTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182145500_1182145512 25 Left 1182145500 22:27994584-27994606 CCCTCAGGAGCGGGGGGCCTCCA 0: 1
1: 0
2: 2
3: 9
4: 113
Right 1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG No data
1182145508_1182145512 -8 Left 1182145508 22:27994617-27994639 CCCACTGGGTCAAGGAGTATCCA 0: 1
1: 0
2: 1
3: 5
4: 75
Right 1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG No data
1182145506_1182145512 5 Left 1182145506 22:27994604-27994626 CCAAGGCACACTGCCCACTGGGT No data
Right 1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG No data
1182145501_1182145512 24 Left 1182145501 22:27994585-27994607 CCTCAGGAGCGGGGGGCCTCCAA 0: 1
1: 0
2: 1
3: 9
4: 90
Right 1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG No data
1182145503_1182145512 8 Left 1182145503 22:27994601-27994623 CCTCCAAGGCACACTGCCCACTG 0: 1
1: 0
2: 3
3: 24
4: 251
Right 1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG No data
1182145509_1182145512 -9 Left 1182145509 22:27994618-27994640 CCACTGGGTCAAGGAGTATCCAG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182145512 Original CRISPR AGTATCCAGGAGGAGTTAGA AGG Intronic
No off target data available for this crispr