ID: 1182145787

View in Genome Browser
Species Human (GRCh38)
Location 22:27995989-27996011
Sequence GAAGCCGGTCAGTGCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182145782_1182145787 6 Left 1182145782 22:27995960-27995982 CCAGCAGGCTTATCCCAGGGACG 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1182145787 22:27995989-27996011 GAAGCCGGTCAGTGCCATCCTGG 0: 1
1: 0
2: 0
3: 11
4: 91
1182145785_1182145787 -8 Left 1182145785 22:27995974-27995996 CCAGGGACGTCTGTGGAAGCCGG 0: 1
1: 0
2: 1
3: 6
4: 79
Right 1182145787 22:27995989-27996011 GAAGCCGGTCAGTGCCATCCTGG 0: 1
1: 0
2: 0
3: 11
4: 91
1182145781_1182145787 7 Left 1182145781 22:27995959-27995981 CCCAGCAGGCTTATCCCAGGGAC 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1182145787 22:27995989-27996011 GAAGCCGGTCAGTGCCATCCTGG 0: 1
1: 0
2: 0
3: 11
4: 91
1182145784_1182145787 -7 Left 1182145784 22:27995973-27995995 CCCAGGGACGTCTGTGGAAGCCG 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1182145787 22:27995989-27996011 GAAGCCGGTCAGTGCCATCCTGG 0: 1
1: 0
2: 0
3: 11
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182145787 Original CRISPR GAAGCCGGTCAGTGCCATCC TGG Intronic
902973764 1:20074022-20074044 GATGACGGTCAGTGCCATGAAGG + Intronic
905569256 1:38991160-38991182 GAGGCTGGTCAGTGCCGGCCCGG - Intergenic
907381480 1:54094504-54094526 GAAGCCAGGCACTGCCCTCCTGG + Intronic
911464423 1:98233698-98233720 GCAACAGGTCAGTGCCCTCCTGG + Intergenic
922180025 1:223226323-223226345 GAGGTGTGTCAGTGCCATCCTGG - Intronic
922791766 1:228314824-228314846 GGAGGTGGTCAGTGCCATGCAGG + Intronic
1063705538 10:8426906-8426928 GAAGCCAGTGAATGCCACCCTGG - Intergenic
1063752769 10:8970007-8970029 GAAGCCAGGGTGTGCCATCCTGG - Intergenic
1064245691 10:13666081-13666103 ATAGACGGTCAGTGCCAACCGGG - Exonic
1069822288 10:71235399-71235421 GAAGTGGGTCAGTCCCACCCAGG - Intronic
1069847382 10:71381940-71381962 GAAGCCTCTCATTGCCATGCTGG - Intergenic
1070825374 10:79387591-79387613 GAAGCTGGTCAGGGCCAGCCTGG + Intronic
1075332084 10:121581148-121581170 GAGGCCGGTCAAGGGCATCCCGG - Intronic
1076870996 10:133194963-133194985 GAAGCCGGACAGACCCATGCTGG - Intronic
1081625690 11:44653903-44653925 GAAGGCTGTCACTGCCATCAAGG + Intergenic
1083604979 11:63973142-63973164 GAGGCTGGACAGTGACATCCGGG + Intergenic
1083609447 11:63998127-63998149 GTGCCCGGGCAGTGCCATCCTGG + Exonic
1084460728 11:69295173-69295195 CAAGGAGGTCAGTGCCTTCCCGG + Intronic
1089075452 11:115734841-115734863 GCAGCCGTTCTGTGCCAACCTGG - Intergenic
1096518940 12:52173413-52173435 GAAGCTGGTCTGTGCCCTCCAGG - Intronic
1097388992 12:58985925-58985947 GAAGACTGTCAGTATCATCCAGG - Intergenic
1104934692 12:132358183-132358205 GAGGCCAGTCAGTGCCCTCTGGG - Intergenic
1105597027 13:21848537-21848559 GAGACCGGTCAGGGCCATCCTGG + Intergenic
1110371248 13:74743112-74743134 GAATCCAGTCAGTTCCATCAAGG + Intergenic
1113885804 13:113657892-113657914 GAAGCCCGTCCACGCCATCCAGG + Intronic
1115202641 14:30871080-30871102 GAAGCCTGACAATGCCACCCAGG + Intergenic
1122155367 14:99747356-99747378 GGAGCCGATCTGTGCCACCCCGG - Intronic
1124200621 15:27675862-27675884 GAAGCAGGGCAGTGCAAGCCAGG + Intergenic
1126743245 15:51799360-51799382 AAAGCCGCAGAGTGCCATCCAGG + Intronic
1127043402 15:55001631-55001653 GAAGGAGGTCACTGCCCTCCAGG - Intergenic
1129450837 15:75650347-75650369 GAAGCTGGGCAGTGCCTTCCAGG + Exonic
1132547929 16:541782-541804 GAAGCCGGTCAGTGGCCGTCTGG - Intronic
1132897173 16:2234553-2234575 GACACCTGTCAGTGCCAGCCTGG - Intronic
1141818508 16:86429365-86429387 CAAGCCGGTCAGTTCGATCCAGG - Intergenic
1143451254 17:7038230-7038252 CACGCCTGTCAGTGCCAGCCCGG - Exonic
1144321756 17:14130046-14130068 GAAGCCACCCAGTGCCAGCCTGG + Intronic
1147537254 17:41328757-41328779 GAAGCTGGTGGGTGCCACCCTGG - Intergenic
1152558969 17:81068434-81068456 GACCCTGGTCAGTGCCATCCGGG + Intronic
1154407543 18:14107960-14107982 CAAGCCCATCGGTGCCATCCAGG - Intronic
1157344639 18:46814741-46814763 TAAGCCTGTCTGTGCAATCCAGG + Intronic
1159235824 18:65671783-65671805 GCATCAGGTCAGTGCCCTCCTGG + Intergenic
1159940257 18:74401424-74401446 GAAGCAGTTCTGGGCCATCCAGG + Intergenic
1160700510 19:504703-504725 GACCCCGGTCAGAGCCCTCCAGG - Intronic
1161983639 19:7642922-7642944 GAAGCCAGGCAGTGCCCACCTGG - Intronic
1163156504 19:15442660-15442682 GCAGCTGGTGAGTGCCATGCTGG - Intronic
1166695246 19:44848111-44848133 GAGGCCAGTGAGAGCCATCCTGG - Intronic
1167506444 19:49873383-49873405 GAGGGTGGTGAGTGCCATCCAGG - Intronic
925100231 2:1237954-1237976 GCAGCCAGTCGGTGCCATCCTGG - Exonic
926199117 2:10780670-10780692 GAAGCCTGTCCATGCCTTCCAGG + Intronic
927683537 2:25155548-25155570 GGAGCCGGGCAGAGCCACCCAGG + Exonic
927699063 2:25256466-25256488 GCAGCCAGTAACTGCCATCCTGG - Intronic
928850102 2:35734909-35734931 GCATCAGGTCAGTGCCCTCCTGG + Intergenic
933656634 2:84894075-84894097 GAACACGGTAAGGGCCATCCAGG + Intronic
937346931 2:121131965-121131987 GGAGCCGGCCAGGGCCACCCTGG + Intergenic
938182377 2:129194631-129194653 GAAACCTGTCGGTGCCATCCAGG + Intergenic
939396634 2:141638812-141638834 GAAGAAGGGCAATGCCATCCTGG + Intronic
944217473 2:197270527-197270549 GAAGCCCTTCAGGGACATCCAGG + Intronic
946977080 2:225164889-225164911 GAAGCAGGCCAGAGGCATCCAGG - Intergenic
947105263 2:226662239-226662261 GAGGCAGGTCAGTTCCATCGTGG - Intergenic
948146383 2:235711182-235711204 GTGGCCAGTCAGTGCCATCAAGG + Intronic
1170715429 20:18827105-18827127 CAAGCTGGTCAGTGACATCTCGG - Intronic
1172178844 20:32988413-32988435 GAGGCCGGTGAGAGCCATTCAGG - Intronic
1174008683 20:47431205-47431227 TAAGCTGGTCAGTGTCAACCAGG + Intergenic
1179231437 21:39507190-39507212 AAAGCCTGACAGTGCCAGCCAGG - Intronic
1182035594 22:27195815-27195837 ATAGCCCTTCAGTGCCATCCAGG - Intergenic
1182145787 22:27995989-27996011 GAAGCCGGTCAGTGCCATCCTGG + Intronic
1184823855 22:46933648-46933670 GCTGCCGGCCAGTGCCACCCTGG - Intronic
1185116337 22:48940385-48940407 GAAGCCAGGCAGTGACATCCAGG + Intergenic
950487694 3:13282733-13282755 GCAGCCGCTCGGCGCCATCCCGG - Intergenic
950546900 3:13643544-13643566 AAAGCCTGTTAGTGCCACCCAGG - Intergenic
960820679 3:121727510-121727532 AAAACCAGTCAGTGCCATGCAGG + Intronic
961005480 3:123402473-123402495 GAAGCCGGTGCTTGCCTTCCTGG - Intronic
961667827 3:128504567-128504589 CCAGCCAGTCAGAGCCATCCTGG + Intergenic
963526029 3:146414328-146414350 GAAGCTCTTCAGTGCAATCCTGG + Intronic
970422512 4:15918749-15918771 GAGGCTGGTCAGTGCCCTCAAGG - Intergenic
970513795 4:16807044-16807066 GGAGCTGATCAGTCCCATCCTGG + Intronic
971934011 4:33123561-33123583 CAACCCTGTCAGTGTCATCCCGG + Intergenic
983409769 4:167381282-167381304 AGAGCCAGTCAGTGCCATACGGG - Intergenic
993970479 5:94413599-94413621 AAAGCAGGTCAGTGTCTTCCTGG + Intronic
995732622 5:115262582-115262604 GAAACCAGTCAGTGCCAACTGGG + Intronic
1001603384 5:172943591-172943613 GCAGCTGGACAGTGTCATCCCGG + Intronic
1002063443 5:176640208-176640230 GAGGCCACGCAGTGCCATCCTGG + Intronic
1003147136 6:3518116-3518138 GGACCCGGGCAGTGCCAGCCTGG + Intergenic
1003256380 6:4478783-4478805 GAAGACCATCTGTGCCATCCTGG - Intergenic
1009544376 6:65005441-65005463 GAAGCGGGTCACCGCCATCTTGG + Intronic
1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG + Intergenic
1017309521 6:152959361-152959383 GAAGCCCGTCAAAGCCAGCCAGG - Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019926755 7:4198098-4198120 GAAGCCAGCCTGTGCCCTCCTGG + Intronic
1025258974 7:57404632-57404654 GAAGCCGGGCTGTGCCGGCCTGG + Intergenic
1033053290 7:138026748-138026770 GACTCAGGTCAGTACCATCCTGG + Intronic
1037281541 8:17247196-17247218 GAAGCAGGCCAGAGCCTTCCAGG + Exonic
1038003252 8:23408070-23408092 GTAGCCGGTCTGTGCCTTCATGG + Intronic
1040110961 8:43567041-43567063 GCAGGAGGTCAGTGCCTTCCCGG - Intergenic
1050291522 9:4160282-4160304 GAAGCCTGTCAGTGCCAGCGTGG - Intronic
1058800174 9:108538023-108538045 GAAGACGGTCAGTGGCTCCCTGG - Intergenic
1062634409 9:137482684-137482706 GCAGCCCGTCCGTGCCCTCCTGG - Intronic
1186164032 X:6807677-6807699 GAAGCAAGTCAGCCCCATCCTGG + Intergenic
1188219964 X:27529235-27529257 GGAGTAGTTCAGTGCCATCCAGG - Intergenic
1190262356 X:48805441-48805463 GGAGCCGCTCAGGGCCTTCCGGG - Exonic
1193087609 X:77461116-77461138 GGAGCTTGTCAGAGCCATCCGGG + Intergenic
1196859655 X:120015307-120015329 GAAGACGGTCAGTGCCTGTCTGG - Intergenic
1197175527 X:123481854-123481876 GAAGCCGGTCAGTGACTTTCAGG - Intronic