ID: 1182145826

View in Genome Browser
Species Human (GRCh38)
Location 22:27996164-27996186
Sequence GCGCACGCTCCGGGTGCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182145819_1182145826 7 Left 1182145819 22:27996134-27996156 CCAGGTGCAGCAGCACTCGCAGG 0: 1
1: 0
2: 2
3: 20
4: 275
Right 1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1182145818_1182145826 12 Left 1182145818 22:27996129-27996151 CCTTACCAGGTGCAGCAGCACTC 0: 1
1: 0
2: 1
3: 5
4: 160
Right 1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1182145814_1182145826 19 Left 1182145814 22:27996122-27996144 CCGACCCCCTTACCAGGTGCAGC 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1182145813_1182145826 20 Left 1182145813 22:27996121-27996143 CCCGACCCCCTTACCAGGTGCAG 0: 1
1: 0
2: 2
3: 38
4: 360
Right 1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1182145816_1182145826 14 Left 1182145816 22:27996127-27996149 CCCCTTACCAGGTGCAGCAGCAC 0: 1
1: 0
2: 0
3: 17
4: 189
Right 1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1182145815_1182145826 15 Left 1182145815 22:27996126-27996148 CCCCCTTACCAGGTGCAGCAGCA 0: 1
1: 0
2: 2
3: 50
4: 260
Right 1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134
1182145817_1182145826 13 Left 1182145817 22:27996128-27996150 CCCTTACCAGGTGCAGCAGCACT 0: 1
1: 0
2: 1
3: 11
4: 162
Right 1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182145826 Original CRISPR GCGCACGCTCCGGGTGCTGC AGG Exonic
900381489 1:2386217-2386239 GCACAGGCTCTGCGTGCTGCTGG + Intronic
900564328 1:3324913-3324935 GCGGACGCCCCTGGTGGTGCTGG + Intronic
901684652 1:10937276-10937298 GCGCACGCTCTGGAAGCTGGGGG - Intergenic
903217884 1:21853045-21853067 GCGGATGGGCCGGGTGCTGCCGG + Exonic
903545726 1:24122231-24122253 GAGCAGGCTCCGGGTGCCTCAGG + Intronic
905639187 1:39576822-39576844 CCGCCCGCCCCGGGCGCTGCTGG + Intergenic
911633945 1:100213230-100213252 GCGCACGCCCCGGGTGGCTCGGG - Intronic
917974716 1:180231142-180231164 GCGCACGCGGCGGGCGCCGCGGG - Intronic
920199638 1:204251715-204251737 GGGCAAGCTCAGGGTGCTGGGGG - Intronic
920590873 1:207217308-207217330 GCTCACCCTCCAGTTGCTGCTGG - Intergenic
1063611980 10:7570368-7570390 GCGCACAGTCAGGGTGCTGGCGG + Intronic
1064443031 10:15370795-15370817 GAGCGCGTTGCGGGTGCTGCAGG + Intronic
1065020806 10:21500476-21500498 GCGCGCGCCCCGGGCCCTGCAGG - Intergenic
1075839072 10:125482831-125482853 CCCCACTCTCAGGGTGCTGCAGG + Intergenic
1076691760 10:132227245-132227267 GTGCCAGCTCCGGGTGCTTCAGG + Intronic
1077194325 11:1271914-1271936 GGGCACCCTGCTGGTGCTGCGGG + Intergenic
1077909100 11:6558650-6558672 GAGCACCCTCCAGGTGATGCTGG - Exonic
1077915860 11:6611192-6611214 GCTCTTGCTCCGGGAGCTGCCGG + Exonic
1078475000 11:11622249-11622271 GCGCCCTCTCCGGGAGCTTCAGG - Intergenic
1081637092 11:44727967-44727989 GCGCCGGCTCCGGGTCCTGCTGG + Intronic
1082106719 11:48229001-48229023 GAGCAGGCTGCTGGTGCTGCAGG + Intergenic
1083232725 11:61333255-61333277 GCGCACGCTTCGGGGTCTCCGGG + Exonic
1087046920 11:93850379-93850401 GGGGACGCCCCGGGTGCTGGGGG - Intronic
1090780380 11:130002191-130002213 GCGGGCGCTCCGGGCGCGGCGGG - Intronic
1090977735 11:131691134-131691156 GTGCGCCCTCCGGGGGCTGCAGG - Intronic
1095812366 12:46383907-46383929 GCGAACGCGCCGGGCGGTGCAGG + Intergenic
1096482449 12:51951688-51951710 GCGCGCGCGCTGGGCGCTGCTGG + Exonic
1102200668 12:111055676-111055698 GGGCAAGCTCCGGGGGCTGGGGG - Intronic
1102261940 12:111448188-111448210 GCTCATGCTCCAGGTGCTGCAGG - Exonic
1102904344 12:116662699-116662721 GCACACGCACAGCGTGCTGCTGG + Intergenic
1108313910 13:49220231-49220253 CCGCACGCTGCGGGCGCGGCAGG - Intergenic
1113556677 13:111241290-111241312 CTGCACGCTCTGGCTGCTGCAGG - Intronic
1113608755 13:111628630-111628652 GTGAACACTCCGTGTGCTGCTGG + Intronic
1120592256 14:86390300-86390322 GCGCAAGCTCAGAGTGATGCTGG + Intergenic
1122737805 14:103853809-103853831 GTCCAAGCTCCAGGTGCTGCAGG + Intergenic
1124426844 15:29570202-29570224 GCGCTCCCTCCGGCCGCTGCGGG + Intronic
1124790040 15:32718447-32718469 GAACACGCTCCTGGTGCTGGTGG + Intronic
1125524699 15:40367645-40367667 CCTCACGCTCATGGTGCTGCTGG + Exonic
1131694102 15:94856516-94856538 GCGCAGGCTGCGGGTACAGCAGG + Intergenic
1132505170 16:304420-304442 GCGCACGTACCGGGTGCCGAAGG - Exonic
1132696416 16:1204125-1204147 GCTCACCCTCCGGGTCCTCCAGG - Exonic
1132915324 16:2340739-2340761 GCGGCCGCTCCGGCTCCTGCAGG + Intronic
1136272503 16:29156767-29156789 AGGCACGCCCCGGGTGCTCCTGG + Intergenic
1137391223 16:48082848-48082870 GCGCTCACTCCTGGGGCTGCTGG + Intergenic
1139477123 16:67208362-67208384 GCTCACGCTGCGGGCCCTGCAGG - Exonic
1139592797 16:67942778-67942800 GCCCAAGCCCCCGGTGCTGCTGG - Intronic
1140210921 16:72969527-72969549 GCTCACACTCTGGGGGCTGCTGG - Intronic
1141608721 16:85169716-85169738 GCGCCGGCTCCTGCTGCTGCAGG - Intergenic
1142267299 16:89070586-89070608 GGGCACCCTAGGGGTGCTGCTGG + Intergenic
1144782393 17:17814622-17814644 GCACCTGCCCCGGGTGCTGCAGG - Exonic
1147899748 17:43776351-43776373 GCACAGGCCCCGTGTGCTGCTGG + Intronic
1147951716 17:44111301-44111323 GAGCATGCTCAGGGAGCTGCGGG + Intronic
1148854738 17:50572547-50572569 GTCCACGCTCAGGGGGCTGCAGG - Exonic
1150289010 17:63971189-63971211 GAGGACCTTCCGGGTGCTGCGGG - Exonic
1151967428 17:77438663-77438685 GCGCACCCTCCCGAGGCTGCAGG - Intronic
1152586770 17:81192818-81192840 GCTCCTGCTCCAGGTGCTGCTGG + Exonic
1152598304 17:81249002-81249024 GTGCTCGCCCTGGGTGCTGCGGG + Intronic
1153428853 18:4993280-4993302 GCACATACTCAGGGTGCTGCTGG - Intergenic
1157570725 18:48710332-48710354 GCGCATGCTCAGGTCGCTGCAGG + Intronic
1160071746 18:75635116-75635138 GAGCACGGTCCAGGTGCTGATGG + Intergenic
1160710511 19:549044-549066 GCGCCTGTCCCGGGTGCTGCGGG + Exonic
1160798366 19:955934-955956 GCGCTCCCTCCAGGGGCTGCAGG + Intronic
1161406693 19:4094976-4094998 GCCCACGCCACAGGTGCTGCTGG + Intronic
1163453048 19:17390536-17390558 CCGGACCCTCCGGGGGCTGCCGG - Intergenic
1163484393 19:17577402-17577424 GCGCATGCTGCGGGCGCTGCAGG + Exonic
1163807098 19:19405965-19405987 GCGCAGGTTACGGGGGCTGCTGG - Intronic
1164835117 19:31350893-31350915 GGGCCGGCTCCGGGCGCTGCCGG + Intergenic
1166748434 19:45153068-45153090 GCGCAGGCTGCGCGTGGTGCTGG - Exonic
1167615591 19:50531158-50531180 GCAGAGGCTCCGGGAGCTGCAGG - Intronic
1168594501 19:57664445-57664467 TCCCCCGCCCCGGGTGCTGCGGG - Intergenic
926581511 2:14635254-14635276 GCGCACGCTCGGGGCGGTGATGG - Exonic
927894420 2:26772223-26772245 GCACATGCTCTGGGTGCTGCGGG + Intronic
931635580 2:64338281-64338303 GAGCACCCTCCGGGAGCAGCAGG + Intergenic
935137564 2:100321445-100321467 GCGCGGCCTCCGGCTGCTGCTGG + Exonic
946225387 2:218261616-218261638 GCCCAGGCTCAGGGTGCTGGGGG + Intronic
948050285 2:234974840-234974862 GCCCACACTGGGGGTGCTGCAGG + Intronic
948140858 2:235670828-235670850 GCGCGCGCTCCAGCCGCTGCAGG - Intronic
1169091351 20:2863074-2863096 GCTCACCATCCAGGTGCTGCTGG + Exonic
1169971818 20:11276885-11276907 GGGCATGCTTCAGGTGCTGCAGG + Intergenic
1173516226 20:43667225-43667247 GCTCCCGCTCCGGGCTCTGCCGG + Exonic
1173690881 20:44960213-44960235 CCGCGCGCTGCGGGTGCTGCAGG - Exonic
1174554318 20:51382936-51382958 GGGCACCCTCTGTGTGCTGCTGG - Intergenic
1174898510 20:54475393-54475415 GGGCACGCTCCGGGTCCGCCAGG + Intergenic
1175205507 20:57308267-57308289 TCTGACTCTCCGGGTGCTGCCGG - Intergenic
1180045642 21:45303868-45303890 GCCCACTGTCCAGGTGCTGCGGG - Intergenic
1180162311 21:46003572-46003594 ACGCCCGCTCTGGGCGCTGCTGG - Exonic
1182145826 22:27996164-27996186 GCGCACGCTCCGGGTGCTGCAGG + Exonic
1182974929 22:34614620-34614642 GCTCCAGCTCTGGGTGCTGCCGG - Intergenic
955856527 3:63278688-63278710 GGGCACCTTCCGGGTGCTGAAGG + Exonic
957046727 3:75381383-75381405 GCGCATGCTCGGGGGTCTGCAGG - Intergenic
961878793 3:130045451-130045473 GCGCATGCTCAGGGGTCTGCAGG - Intergenic
966762303 3:183428754-183428776 CCTCCCGCTCCGGGTCCTGCCGG - Intronic
968664344 4:1812770-1812792 GCTTGCCCTCCGGGTGCTGCAGG - Exonic
984639327 4:182144698-182144720 GCGGACGCGGCGGCTGCTGCCGG + Intronic
991370554 5:65915085-65915107 CCGGAGGCTCCTGGTGCTGCAGG + Intergenic
1000009470 5:157217918-157217940 GCGCTAGCTCCGGGTGCAGGTGG + Intronic
1000318878 5:160118648-160118670 GCGCGCGCTCCGAGTGGGGCAGG - Intronic
1001639692 5:173235777-173235799 CCGCAGGCTCTGGGTGCTTCTGG + Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1004999350 6:21225088-21225110 GAGCACGCTTAGGGTGATGCAGG + Intronic
1014109247 6:117602245-117602267 GGGCCCCCTCCGGCTGCTGCTGG + Exonic
1015440453 6:133241327-133241349 GCGCACGCTCCGGCCGTTCCCGG + Intronic
1019197033 6:170289122-170289144 GGGCACGCTCCGGGTGGTAGCGG + Intronic
1019279685 7:193454-193476 GCACACGCTCCGCATCCTGCAGG + Exonic
1019474173 7:1236156-1236178 GCGCACGCCTCGGGCGCCGCGGG + Exonic
1020188138 7:5974283-5974305 GCGAGCCCTCAGGGTGCTGCAGG - Intronic
1020294780 7:6750486-6750508 GCGAGCCCTCAGGGTGCTGCAGG + Intergenic
1020313852 7:6890379-6890401 GCGCATGCTCGGGGGTCTGCAGG - Intergenic
1022350819 7:29565003-29565025 GCCCACGCGCCGGGCGCTCCTGG - Intronic
1023829245 7:44029414-44029436 CCGGCTGCTCCGGGTGCTGCAGG - Intergenic
1025729989 7:64100445-64100467 GCGGCCGCTGCGGGAGCTGCGGG + Intronic
1029281549 7:99438922-99438944 GCGCGGGCTCCGGGCGCTCCCGG + Intronic
1029739551 7:102483672-102483694 CCGGCTGCTCCGGGTGCTGCAGG - Exonic
1029757552 7:102582851-102582873 CCGGCTGCTCCGGGTGCTGCAGG - Exonic
1029775490 7:102681912-102681934 CCGGCTGCTCCGGGTGCTGCAGG - Intergenic
1029833058 7:103280678-103280700 GTGCGCACTGCGGGTGCTGCAGG - Intergenic
1033253092 7:139777501-139777523 GGGCAGGCGCCGGGGGCTGCGGG + Intronic
1034147166 7:148883905-148883927 GCGCACACCCCTGGAGCTGCGGG - Intronic
1035437709 7:158871522-158871544 CCGCCCGCTCCAGGAGCTGCCGG - Exonic
1035770975 8:2146747-2146769 GGGCACACTCCTGGTGCTGTTGG + Intronic
1043578536 8:81686208-81686230 CCGCACCCTCCGGGTTCAGCGGG - Intronic
1047998456 8:130358190-130358212 GCGCAGGCTCCCGGGGCCGCGGG + Intronic
1048999724 8:139817095-139817117 GAGCACCCCCAGGGTGCTGCAGG + Intronic
1049162026 8:141103770-141103792 GAGCAGGCTCCGGACGCTGCAGG - Intergenic
1049558679 8:143296656-143296678 GCGCGCGTTCCGGGCGCTGTCGG + Exonic
1049598266 8:143494556-143494578 GCCCTCGCTCTGGGTTCTGCCGG - Intronic
1049749883 8:144278059-144278081 ACGCACACTGCGGGTGGTGCTGG - Intronic
1058058601 9:100473386-100473408 GCGGACGCTGCGGGTGGGGCGGG + Exonic
1059470913 9:114504555-114504577 GCGCACCCTGCGCGTGCTGCTGG - Exonic
1061472228 9:130835561-130835583 GCGCGCCCTCCCGCTGCTGCTGG + Intronic
1061991740 9:134163167-134163189 GCGCAGGCCCCGGGAGCTGGAGG - Intergenic
1062165333 9:135104762-135104784 GCTCACCCTCCGGCTGCTGGGGG - Intronic
1062421282 9:136483805-136483827 GCGCATGCGCCGGGAGCGGCCGG + Exonic
1062503186 9:136859941-136859963 GCTCATGCTCCTGGTGCTGCTGG + Exonic
1062507637 9:136886311-136886333 GCGCACGCTGCGGCTCCTGCGGG + Intronic
1203794591 EBV:169756-169778 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1203794792 EBV:170294-170316 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1203794983 EBV:170817-170839 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1203795184 EBV:171355-171377 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1189478674 X:41376473-41376495 GCTCACCCTCTGGGTGCTGCGGG + Intergenic
1190554447 X:51618878-51618900 GCACGCGCTCCGGAGGCTGCAGG - Intergenic
1190560748 X:51682836-51682858 GCACGCGCTCCGGAGGCTGCAGG - Intergenic
1190563543 X:51710485-51710507 GCACGCGCTCCGGAGGCTGCAGG + Intergenic
1198341179 X:135714338-135714360 GTGCTCTCTCCCGGTGCTGCGGG + Intronic