ID: 1182149414

View in Genome Browser
Species Human (GRCh38)
Location 22:28017829-28017851
Sequence GTGTTAGCCCTGGGGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 267}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182149414_1182149427 20 Left 1182149414 22:28017829-28017851 CCCCCCATCCCCAGGGCTAACAC 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1182149427 22:28017872-28017894 CAGCGATTAATGGGGTGGCCAGG No data
1182149414_1182149428 21 Left 1182149414 22:28017829-28017851 CCCCCCATCCCCAGGGCTAACAC 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1182149428 22:28017873-28017895 AGCGATTAATGGGGTGGCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 103
1182149414_1182149425 15 Left 1182149414 22:28017829-28017851 CCCCCCATCCCCAGGGCTAACAC 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1182149425 22:28017867-28017889 AGAACCAGCGATTAATGGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 50
1182149414_1182149422 10 Left 1182149414 22:28017829-28017851 CCCCCCATCCCCAGGGCTAACAC 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1182149422 22:28017862-28017884 CTTCAAGAACCAGCGATTAATGG 0: 1
1: 0
2: 0
3: 6
4: 71
1182149414_1182149424 12 Left 1182149414 22:28017829-28017851 CCCCCCATCCCCAGGGCTAACAC 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1182149424 22:28017864-28017886 TCAAGAACCAGCGATTAATGGGG 0: 1
1: 0
2: 0
3: 0
4: 77
1182149414_1182149423 11 Left 1182149414 22:28017829-28017851 CCCCCCATCCCCAGGGCTAACAC 0: 1
1: 0
2: 3
3: 20
4: 267
Right 1182149423 22:28017863-28017885 TTCAAGAACCAGCGATTAATGGG 0: 1
1: 0
2: 0
3: 6
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182149414 Original CRISPR GTGTTAGCCCTGGGGATGGG GGG (reversed) Intronic
900498335 1:2987097-2987119 GGGTCACCCCTGGGAATGGGGGG - Intergenic
900767145 1:4513179-4513201 GTTTTAGCCCTGCAGAGGGGAGG + Intergenic
900773021 1:4560959-4560981 GTTATGGCCCTGGAGATGGGTGG + Intergenic
900870118 1:5296382-5296404 GTCTTTGCCCTGTGCATGGGAGG + Intergenic
901474815 1:9482202-9482224 GTATAAGCCCTGGGTCTGGGAGG - Intergenic
901540618 1:9912848-9912870 CTGATAGCCCTGGGGGTCGGAGG - Intergenic
901928994 1:12584638-12584660 GGCTTAGCCAAGGGGATGGGTGG - Intronic
901974297 1:12932219-12932241 GTGTGAGGCCAGGGGAAGGGAGG - Intronic
902010878 1:13269549-13269571 GTGTGAGGCCAGGGGAAGGGAGG + Intergenic
902563548 1:17294848-17294870 CTGTTAGTCCTGGGGGCGGGGGG + Intergenic
902621715 1:17654697-17654719 GAGGTAGCCCTGTGGAAGGGAGG - Exonic
903139774 1:21332578-21332600 GTGTTAGTCCAGGGGGAGGGGGG + Intronic
903574670 1:24331755-24331777 GGGTTAGCCATGGGAAAGGGAGG - Intronic
903775809 1:25793002-25793024 GGGTTTGCTCTGGGGATGGCAGG - Intergenic
904613832 1:31739287-31739309 AGGTGAGTCCTGGGGATGGGTGG - Exonic
904865686 1:33577327-33577349 GTGGTAGCCCTGGGGGTGCCGGG + Exonic
905483783 1:38281260-38281282 GGCTTAGCCATGAGGATGGGAGG + Intergenic
905693320 1:39958039-39958061 GTGTTAGAGCTGGGGTTGGGGGG + Intronic
906390767 1:45413744-45413766 GTGCTGGCCCCGGGTATGGGAGG - Intronic
906725188 1:48039401-48039423 GTGTCAGCCCTTGGGCAGGGTGG + Intergenic
907487624 1:54788379-54788401 GTGTGCGCCCTGGGGTTGGGGGG - Intronic
909251614 1:73364145-73364167 GTGGTTGCCCTGAGGATGAGGGG - Intergenic
912433786 1:109644134-109644156 GGGTTTGACCTGGGGTTGGGGGG - Intergenic
912804400 1:112744007-112744029 GGGCCAGCCCTGGGGCTGGGAGG + Intergenic
913344266 1:117792597-117792619 CTGGGAGCCCTGGAGATGGGAGG + Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915063070 1:153202852-153202874 GTGTTAGGAGTGGCGATGGGAGG - Intergenic
915338981 1:155166166-155166188 CTTTCAGCCCTGGGGGTGGGAGG + Intergenic
916105335 1:161425853-161425875 GTGGTTGGCTTGGGGATGGGCGG + Intergenic
919914975 1:202133663-202133685 GTGGGGGCCCTGGGGAGGGGCGG + Exonic
920370933 1:205478938-205478960 ATGTTGGCCCTTGGCATGGGAGG + Intergenic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
921152889 1:212415646-212415668 GTGTTGGCCCTGTGGCAGGGTGG + Intergenic
923956306 1:239025565-239025587 GTGGTAGGCCTGGTGATGGATGG - Intergenic
1063421102 10:5912993-5913015 CTTTTCGCTCTGGGGATGGGGGG + Intronic
1063567302 10:7182004-7182026 GTGACAGACCTGGGGATGGCTGG + Intronic
1063688198 10:8258477-8258499 GAGTTAGCCCTGAGGATGGGAGG - Intergenic
1063974049 10:11401446-11401468 GTGGTGGCCCTGTGGCTGGGCGG - Intergenic
1064275522 10:13901782-13901804 CTGTTCTCCCTGGGGCTGGGAGG - Intronic
1068684893 10:59860224-59860246 GTCTGAGTCCTGGGGATGGGAGG - Intronic
1069928593 10:71868226-71868248 GTGTTTACCCTGGGGAGGGTGGG - Intergenic
1070775677 10:79108450-79108472 CTTTCAGCACTGGGGATGGGAGG + Intronic
1070842427 10:79496511-79496533 GTGTTAGCCCTGAGCAGGGCAGG - Intergenic
1071555834 10:86600682-86600704 GTATTAGCCCTGGGAAGAGGGGG + Intergenic
1072452246 10:95547798-95547820 ATGTTAGCCCCAGGGATGGGAGG - Intronic
1072989254 10:100175248-100175270 GTATTAGCTCTGGGGATAGTGGG - Intronic
1074273643 10:111980041-111980063 GTGGTTGCCTAGGGGATGGGAGG - Intergenic
1074580653 10:114716136-114716158 ATGTCAGCTCTTGGGATGGGTGG - Intergenic
1075638158 10:124044494-124044516 ACGTTAGCGCTGGGGTTGGGGGG - Intronic
1075646859 10:124102481-124102503 CTCTTAGACCTGGGGATGGCGGG - Intergenic
1076785080 10:132745655-132745677 GTGGTGGCCCTGGGCATGGTGGG + Intronic
1076785131 10:132745809-132745831 GTGGTGGCCCTGGGTATGGTGGG + Intronic
1076887782 10:133270502-133270524 ATGTCAGCCCTGTGGATGGACGG + Exonic
1077063247 11:626810-626832 GAGTTAGTCCTGGAGCTGGGGGG + Intronic
1077096448 11:801112-801134 GACTGAGGCCTGGGGATGGGAGG + Exonic
1077478407 11:2801866-2801888 GTGTTAACCCAGGGGCTGCGGGG - Intronic
1080878234 11:36296052-36296074 GTGTTACTCCTGGGGACAGGAGG - Intergenic
1081261878 11:40971420-40971442 GTGTTAGGCCTGGGGGAGGAGGG + Intronic
1081549257 11:44096419-44096441 GTGTTAGGCCGGGGACTGGGTGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083896150 11:65620775-65620797 GGGCGAGCCCTGGGGCTGGGTGG - Intronic
1084003968 11:66313656-66313678 GGGTGAGACCTGGGGAGGGGAGG - Intergenic
1084014617 11:66371319-66371341 GTGGTAGCTGTGGGGATCGGTGG + Exonic
1085521150 11:77139572-77139594 GGGCTAGCCATGGGGATGGGAGG + Intronic
1088433742 11:109787572-109787594 GAATTAGTCCTGGGGGTGGGTGG - Intergenic
1088811963 11:113398105-113398127 GTGATAGGCCTGGGGATGAGGGG - Intronic
1089497192 11:118913757-118913779 GGGTTAGCCCAGGGCAAGGGAGG + Intronic
1089533284 11:119145595-119145617 GGGTTTGTTCTGGGGATGGGAGG + Intergenic
1090653196 11:128824536-128824558 GGCTCAGCCCTGGGGGTGGGGGG + Intergenic
1090653376 11:128825071-128825093 GTGTAAGACCTGGGGGTAGGAGG + Intergenic
1090925892 11:131250194-131250216 CTGTTAGACCTGGGGAGGGTGGG - Intergenic
1090978786 11:131698281-131698303 GTGTGAGCACTGGGGTAGGGTGG - Intronic
1091412464 12:253045-253067 AAGTTAGTCCTGGGGATGGGGGG + Intronic
1091678067 12:2505770-2505792 GTGTTAGGCCTTGGCATGGCTGG - Intronic
1092575861 12:9782061-9782083 GTGTTGGCACTGGGGGGGGGTGG + Intergenic
1096179686 12:49543873-49543895 GAGTCAGCACTGGGGCTGGGGGG - Intronic
1096506560 12:52097420-52097442 GTGCTATCCATGGGGAAGGGGGG - Intergenic
1104785308 12:131444818-131444840 GCCATGGCCCTGGGGATGGGGGG - Intergenic
1105891436 13:24685204-24685226 GTAGCAGCCCTGAGGATGGGAGG - Intronic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1106443526 13:29801815-29801837 GTGTTCGGCCTGGGGTGGGGTGG - Intronic
1113741952 13:112717020-112717042 TTGTTGGCCCTGGTGATGAGTGG + Intronic
1113823844 13:113234757-113234779 CTGTGGGCCCTGGGGATGGGAGG + Intronic
1113856459 13:113448966-113448988 GTGCCAGGCCTGGGGAGGGGCGG - Intronic
1113893598 13:113749227-113749249 GTGTTCGCCGTGGGGCTGGGAGG + Intergenic
1113941968 13:114023136-114023158 GTGTTAGCCCCTGGGAGGGAGGG + Intronic
1114795306 14:25708433-25708455 GTGTTAGCCTTGAAGATGGAAGG - Intergenic
1116787772 14:49306988-49307010 ATGTTTGCGCTGGGGAGGGGAGG + Intergenic
1119151899 14:72368202-72368224 GTGTGTGAACTGGGGATGGGGGG + Intronic
1119938580 14:78616357-78616379 GAGTTAGCCTTTGGGAGGGGAGG - Intronic
1120473843 14:84961734-84961756 TTCTTAGCCCTGGGAATAGGAGG - Intergenic
1121049256 14:90809550-90809572 GTGTTTGCCCTTGGGGTTGGTGG - Intronic
1121328107 14:93033576-93033598 GTGGGAGCCTTGGGGCTGGGAGG + Intronic
1121695494 14:95908872-95908894 CTGTTAGTCCTGGGAATTGGAGG + Intergenic
1122969105 14:105145260-105145282 GGGTCCGCCCTGAGGATGGGCGG - Intronic
1123625352 15:22223400-22223422 GGGTGAGCCCTGCGGGTGGGGGG - Intergenic
1125715136 15:41815404-41815426 GTGTGAGCCCTGAGGCTGTGGGG + Exonic
1127265135 15:57355047-57355069 GTGTTGGCCCTGGGCAGGGAGGG + Intergenic
1127275611 15:57440850-57440872 ATGTTAACTCTGGGGAGGGGAGG - Intronic
1127715386 15:61644558-61644580 GGGCTAGCCCTGGAGATGGCAGG - Intergenic
1128252280 15:66171769-66171791 GGGTGAGCGCTGGGGGTGGGGGG - Intronic
1128989645 15:72248993-72249015 GGCTTGGCCCTGGGAATGGGTGG - Intronic
1129273520 15:74431749-74431771 CTGGTGGCCCTGGGGGTGGGGGG + Intronic
1132885763 16:2181299-2181321 GTGGTGGCCCTCGGGGTGGGTGG + Exonic
1132958670 16:2610299-2610321 CTGTGACCCCTGGAGATGGGTGG + Intergenic
1133091894 16:3411170-3411192 TTGTTAGGACTGGGGAAGGGAGG + Intronic
1133681634 16:8125449-8125471 ATGTTAGTCCTAGGAATGGGTGG + Intergenic
1134412971 16:14018679-14018701 GTGTTAGTGCTGGGGACTGGTGG - Intergenic
1136410926 16:30076482-30076504 TCGTTGGCCCTGGGGAAGGGAGG + Intronic
1137772037 16:51024254-51024276 GTGCCAGCCCATGGGATGGGAGG - Intergenic
1138537236 16:57666630-57666652 TTGTTGGCCCTGGGGTTGGGGGG + Intergenic
1139299895 16:65935969-65935991 GGCTTAGACCTGGGGATGAGAGG - Intergenic
1140388205 16:74561162-74561184 GTGTCAGAGCTGGGCATGGGGGG + Intronic
1144063500 17:11603973-11603995 GTGATAGCCATGGTGATAGGAGG - Intronic
1144560269 17:16315485-16315507 GAGTGAGCCCTGGGGACAGGGGG - Intronic
1144581927 17:16464003-16464025 GTGTCATGCCTGGGGGTGGGAGG + Intronic
1145039828 17:19569437-19569459 GTGGGGGCCCTGGGGATGTGAGG + Intronic
1145392890 17:22469677-22469699 GTGTCACCCCTGGGGCAGGGTGG + Intergenic
1146414992 17:32623429-32623451 GTGGTAGTGGTGGGGATGGGGGG + Intronic
1146578239 17:34013241-34013263 ATGTTGTCCCTGGGGTTGGGTGG + Intronic
1147235197 17:39051821-39051843 CTGTTAGCTCTGGGGGTAGGAGG + Intergenic
1150603744 17:66674136-66674158 GAGTGATCCCTGGGGATGCGAGG + Intronic
1151948520 17:77332695-77332717 GTGGTTGCCCTGGGGAAGGTGGG - Intronic
1152033280 17:77856723-77856745 GTATTAGCCCTGCGGGTGTGGGG + Intergenic
1152276243 17:79359233-79359255 CTGGCAGCCCTGGGGAGGGGCGG - Intronic
1152354600 17:79800691-79800713 GTGTTGGGGCGGGGGATGGGGGG + Intronic
1152532186 17:80925115-80925137 GGGTCGGCCCTGGGGATGGTGGG + Intronic
1152636612 17:81432863-81432885 AGGTTGGGCCTGGGGATGGGGGG - Intronic
1152745313 17:82036124-82036146 GTGTGTGCCCTGGGTAGGGGTGG - Intronic
1152858091 17:82677650-82677672 GTGCTGGCCCTGGAGACGGGTGG - Intronic
1155255502 18:23994549-23994571 GTGTAAGCCCTGGCTATGAGGGG - Intronic
1155619250 18:27757756-27757778 GTGTTGGCCCAGTGGATGTGGGG + Intergenic
1156720826 18:40067803-40067825 AAGTGAGCACTGGGGATGGGAGG + Intergenic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1159944292 18:74432344-74432366 ATGTGAGCCATGGGGAGGGGCGG - Intergenic
1160364418 18:78312331-78312353 GTGTTTGCCGTGGAAATGGGGGG + Intergenic
1161118339 19:2511837-2511859 GGGTTACCCCTGGGGAGGGTGGG + Exonic
1161407011 19:4096318-4096340 GGGCTAGGCCTGGGGTTGGGTGG - Intronic
1161452617 19:4354935-4354957 GTGGAAGTCCTGGGGAAGGGAGG - Exonic
1161572759 19:5039569-5039591 GGGTTGGCCCTGGTGCTGGGGGG + Intronic
1165095320 19:33406934-33406956 GTGTTGCTCCTGGGCATGGGGGG - Intronic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1165726906 19:38119346-38119368 GTGGTTCCACTGGGGATGGGGGG - Exonic
1165884097 19:39064944-39064966 CCGTTACCCCTGGGGGTGGGGGG + Intergenic
1166889255 19:45980382-45980404 GTGGGAGCCATGGGGGTGGGGGG + Intergenic
1167045103 19:47045242-47045264 GCGTTTGCCCTGGGTCTGGGGGG - Exonic
1167289053 19:48614687-48614709 GGGTGAGCCCCGGCGATGGGGGG - Intronic
1167490981 19:49792526-49792548 GTGTCAGAGATGGGGATGGGAGG - Intronic
1167597506 19:50435355-50435377 GGGTCAGCCCTGGGGCTGTGCGG - Intronic
1167984988 19:53307101-53307123 GTGTTAGACCTGGGGCCTGGTGG + Intergenic
925039152 2:716791-716813 CAGTGAGCCCTGGGGATGAGGGG + Intergenic
925675760 2:6359386-6359408 GAGTTAGCCCTGGGTGGGGGTGG + Intergenic
925995040 2:9285347-9285369 GTGTTTGAAGTGGGGATGGGGGG - Intronic
926081940 2:9994493-9994515 GTTTAAGCCCTGGGAATGGATGG - Intronic
926972984 2:18485252-18485274 GTCTGAGGCCTGGAGATGGGGGG + Intergenic
930356758 2:50330474-50330496 GTGAAATCCCTGGGGATGGGAGG - Intronic
933651813 2:84855817-84855839 GCGTTAGCCCAGGGGTTGAGGGG + Intronic
933674499 2:85042409-85042431 GTGGTAGCGCTGGAGATGAGGGG - Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934082229 2:88478681-88478703 GTGTTTGCATTAGGGATGGGAGG - Intergenic
938630802 2:133165067-133165089 GTGTCACAGCTGGGGATGGGAGG + Intronic
938940399 2:136164581-136164603 GGGGTGGGCCTGGGGATGGGCGG + Intergenic
939628753 2:144510350-144510372 GTGAGGGCCCTGGGGGTGGGAGG - Intronic
942055539 2:172179035-172179057 GTCTTATTCCTGGGGATGGGGGG - Intergenic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
944506792 2:200420874-200420896 GTGTTGGCGGTGGGGTTGGGGGG - Intronic
944511097 2:200467075-200467097 GTGTTTGGCTTGGGGATTGGTGG + Intronic
944912295 2:204322578-204322600 GTGTTTTCCCAGGGGATGGAAGG + Intergenic
946110682 2:217412654-217412676 TTGTTGGTCCTGGGGGTGGGTGG + Intronic
946126576 2:217568078-217568100 GTTATACCCCTGGGGGTGGGGGG + Intronic
947342442 2:229154262-229154284 GTGGTGGCGCTGGGGGTGGGGGG - Intronic
948281673 2:236751874-236751896 GTCTTTGCCCTGGGGCAGGGAGG + Intergenic
948345868 2:237297661-237297683 GTGTAAGCACTGGGGAGGGAAGG - Intergenic
948854263 2:240722761-240722783 GTCTTAGCCCAGGGGAGGGTGGG - Intronic
1169229249 20:3876233-3876255 GCCTTCTCCCTGGGGATGGGTGG + Intergenic
1170089951 20:12579864-12579886 GTGTGAGCTCTGGGGCAGGGTGG - Intergenic
1172282046 20:33714821-33714843 GTGTTAGAATTTGGGATGGGGGG - Intronic
1173787529 20:45805301-45805323 TTCAGAGCCCTGGGGATGGGGGG + Exonic
1174564853 20:51457259-51457281 CTTTTGGCCCCGGGGATGGGTGG + Intronic
1179414663 21:41188562-41188584 ATGTAAGCCCTGGGTCTGGGGGG - Intronic
1180235249 21:46455203-46455225 GTGATAGCACTGGGGATGATAGG - Intergenic
1181174363 22:21027435-21027457 CTGAGAGCCCTGGGGGTGGGAGG + Exonic
1181237289 22:21455480-21455502 GTGTAAGCCCTAGGCTTGGGTGG + Intergenic
1181288518 22:21772505-21772527 GTGCTGGCCCTGAGGATGGCCGG - Intronic
1182134368 22:27887559-27887581 CTGTTAGACCTGGGGAGGTGGGG - Intronic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
1182547107 22:31082775-31082797 GGGTAGGCCCTGTGGATGGGTGG + Intronic
1183248190 22:36710024-36710046 CTGTTGGCCCCGGGGCTGGGAGG + Intergenic
1183812357 22:40267784-40267806 GCCTAAGCCCTGGAGATGGGAGG + Intronic
1183960955 22:41411594-41411616 GTGTGAGCCCTGTGGAGGAGGGG - Intergenic
1183975376 22:41508932-41508954 GTGTTTCCCATGGGGCTGGGAGG - Intronic
1184306337 22:43605078-43605100 GTGTTGACCCTGGACATGGGAGG - Intronic
952414276 3:33076251-33076273 GTGTGAGGCCTGGGGGAGGGAGG + Intronic
953355598 3:42253851-42253873 GTGTGGGCCTTGGGGATGGTGGG + Intergenic
953695161 3:45152525-45152547 GAGTCAGCCCAGTGGATGGGAGG + Intergenic
953853470 3:46483602-46483624 GTGTTAACCTTGGGGAAGAGGGG + Intronic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
954324452 3:49855712-49855734 GCGTTACCCCTGGGAATGGTGGG - Intronic
955067309 3:55544400-55544422 GTGATAGAGCTGGGGGTGGGAGG - Intronic
956007947 3:64800459-64800481 GTGGTTCCCCAGGGGATGGGAGG - Intergenic
959151812 3:102617204-102617226 CTGTCAGCTCTGGGGATGGAGGG - Intergenic
959942653 3:112095773-112095795 ATGTTAGACGTGGGGGTGGGGGG + Intronic
963630116 3:147721807-147721829 GAGGTTTCCCTGGGGATGGGTGG - Intergenic
966177784 3:177158002-177158024 CTATTAGCCTTGGGGGTGGGGGG - Intronic
966226026 3:177598950-177598972 GTGTTAGGCATTGGGGTGGGTGG + Intergenic
966809800 3:183833395-183833417 GTCTCTGCCATGGGGATGGGGGG + Intronic
968448251 4:663301-663323 GTGTGAGCACTGGGGGAGGGCGG + Intronic
968877518 4:3280798-3280820 GTGTCTGCCCTGGGGAAGTGAGG - Intergenic
969274439 4:6125308-6125330 GTCTTTGCCCTTGGGATGGGAGG - Intronic
971763066 4:30794049-30794071 GTGTTCTCACTGGGGAGGGGAGG - Intronic
975320940 4:73010324-73010346 TTCTTAGCCCTGGCGATGGGTGG - Intergenic
977503695 4:97875605-97875627 GTGTTAGCACTGGGGATATAAGG - Intronic
981748448 4:148072211-148072233 CAGTCAGCCCTGGGGGTGGGGGG + Exonic
983400002 4:167250761-167250783 GTGTCAGGTATGGGGATGGGAGG - Intergenic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
984776223 4:183483396-183483418 GTGATAGCCACGGGGCTGGGCGG + Intergenic
985535154 5:460533-460555 CTGTGACCCCTGTGGATGGGCGG - Intronic
986156307 5:5179859-5179881 GTGTTACCACTGGGGGTGAGAGG - Intronic
986705319 5:10449791-10449813 CTGTCAGCCCTGGGGAGGGAAGG - Intronic
988727138 5:33937011-33937033 GTGTGCGCCCTGGGGTTGGCGGG + Exonic
990165259 5:52987697-52987719 GTTTTATCTCTGGGGGTGGGGGG - Intergenic
991216762 5:64165446-64165468 GTCCTAGGCATGGGGATGGGTGG + Intergenic
991403301 5:66276769-66276791 TTATTAGACCAGGGGATGGGTGG - Intergenic
996787229 5:127252647-127252669 TGGTTAACTCTGGGGATGGGTGG + Intergenic
997414760 5:133717583-133717605 TTGTTTGCCCTGGGGTTGGTGGG - Intergenic
997476664 5:134146431-134146453 GTGGGGGCCCTGGGGTTGGGAGG - Exonic
997776863 5:136616982-136617004 GTGTCAGTCCTGGGGATAGAGGG + Intergenic
998026285 5:138819299-138819321 GTGTGGGCCCTGGGGAGGGGAGG + Intronic
999684790 5:154092494-154092516 GTATTAGGCTTAGGGATGGGGGG + Intronic
1000332379 5:160215945-160215967 GTGTAAGTCCTGCAGATGGGAGG + Intronic
1001751683 5:174136278-174136300 GTGTTGGCCCCTGGGCTGGGTGG - Intronic
1002635905 5:180608666-180608688 GTGTGTGCCCTGGGCATGGTGGG + Intronic
1003306122 6:4931184-4931206 TTGTATGCACTGGGGATGGGTGG + Intronic
1006578685 6:35064135-35064157 CTCTGAGCCCTGGGCATGGGGGG + Intronic
1006618254 6:35344024-35344046 CTGATAGCCCTGGGGCTGGCGGG + Intronic
1007222927 6:40293394-40293416 GAGTGAGCCCTTGGGAGGGGTGG + Intergenic
1007276596 6:40678751-40678773 GTGTCACCCCAGGGGATGGCTGG + Intergenic
1007902104 6:45422258-45422280 GTGTTTGGCCTGGGGAGGCGGGG - Intronic
1008647264 6:53527489-53527511 GGGTTAGTGCTGGGGGTGGGGGG - Intronic
1008945193 6:57089760-57089782 GTTTTAGCCCTGAAGGTGGGTGG - Intronic
1012323584 6:97884618-97884640 TTTTTAGACCTGGGGATGGGAGG + Intergenic
1014270511 6:119330800-119330822 GTATTAGACCTGAGGATGAGTGG - Intronic
1017001391 6:149999964-149999986 GTCCCAGCCATGGGGATGGGTGG + Intergenic
1019285829 7:222485-222507 GTGCCAGCCCTGGGCCTGGGGGG - Intronic
1024248411 7:47488266-47488288 GTGTCAGCACTGGGAATGAGGGG - Intronic
1024262013 7:47580508-47580530 GTGGTAGCACAGGGGGTGGGGGG - Intronic
1024527380 7:50360262-50360284 CTGCCAGCCCTGGGGATGAGAGG + Intronic
1026909285 7:74083345-74083367 GTGGTCGCCTTGGGGAGGGGAGG - Intronic
1035459675 7:159031164-159031186 ATGTTAGCCCTGGGAGGGGGTGG + Intronic
1037584061 8:20264522-20264544 GTGTTACCCTGGGGGAGGGGAGG + Intronic
1037801894 8:22040510-22040532 GGGTTAGCTCTGGGCATGGCTGG - Intergenic
1038742689 8:30229580-30229602 CTGTGAGCCAAGGGGATGGGAGG - Intergenic
1039508660 8:38071354-38071376 GTGTGAGCCCTGTGCATGGCTGG - Intergenic
1041544669 8:59029228-59029250 GTGGAAGTCATGGGGATGGGGGG - Intronic
1041723615 8:60998419-60998441 GTGTTTGCCCTGGTGGTGAGGGG + Intergenic
1042591572 8:70402982-70403004 GTGTCAGCCCCGGGGGTGGGGGG - Intronic
1042877124 8:73449644-73449666 CTGTCTGCCCTGGGGCTGGGTGG + Intronic
1044865394 8:96565785-96565807 GCGTTCCTCCTGGGGATGGGAGG + Intronic
1048029897 8:130621342-130621364 GTGGTGGCTCTGGGGTTGGGTGG - Intergenic
1048442657 8:134471391-134471413 GTGTTAGCCCTGGAGAAGGAAGG - Intergenic
1048588459 8:135798225-135798247 GTTCTTGCCCTGTGGATGGGAGG - Intergenic
1049156115 8:141067765-141067787 CTGTTGGGCCTGGAGATGGGAGG + Intergenic
1049339711 8:142105591-142105613 GTGAGAGCCCTGGTGGTGGGTGG - Intergenic
1049927242 9:421235-421257 GTGTTAGCCCTGTGCCTGTGAGG + Intronic
1049988898 9:974849-974871 TTGTAAGCTCTGGGGACGGGAGG - Intergenic
1050563504 9:6858511-6858533 GTGTTAGGGCTGGGCATGGTTGG + Intronic
1050585231 9:7103882-7103904 GTCTTAGCACTGAGGAAGGGAGG - Intergenic
1052857914 9:33418440-33418462 GTGTCAGCCATGGGGATGGGTGG - Intergenic
1057183177 9:93040651-93040673 GGGTAGGCCCTGGGGCTGGGCGG - Intergenic
1057217139 9:93235318-93235340 GTGTGAGCACTGGGGATGGGTGG - Intronic
1057443492 9:95098312-95098334 GAGCTAGTCCAGGGGATGGGAGG - Intergenic
1057779299 9:98036649-98036671 GTATTAGCCAGGGGGATTGGGGG + Intergenic
1058098324 9:100888788-100888810 GTCTTGGCCCTGGTGCTGGGTGG - Intergenic
1058271062 9:102971882-102971904 GTGTCAGCCTGGGGGAGGGGAGG + Intergenic
1060931182 9:127490447-127490469 ATTTTAGCCCTGGGCAGGGGTGG - Intronic
1061279115 9:129586922-129586944 GGGTTAGTCCTGGGGCAGGGAGG - Intergenic
1061863979 9:133482628-133482650 TTGATAGGTCTGGGGATGGGAGG + Intergenic
1062004378 9:134231934-134231956 GTGCTGGCCCTGGGGACAGGGGG - Intergenic
1062301426 9:135874031-135874053 GTGTTTGTCCTGGGGATGAAAGG + Intronic
1062532939 9:137009636-137009658 GGGCTCGTCCTGGGGATGGGTGG + Exonic
1185603867 X:1355815-1355837 GGGTTGGCCCTGGGCAGGGGTGG + Intronic
1185672556 X:1824460-1824482 GTGTTGGCGGTGGGGCTGGGTGG - Intergenic
1187377040 X:18764402-18764424 GTGGGTGTCCTGGGGATGGGTGG + Intronic
1187823215 X:23310113-23310135 GTATTAGCTCTGGGCATGAGGGG - Intergenic
1189286041 X:39853393-39853415 AGGCCAGCCCTGGGGATGGGTGG - Intergenic
1190113328 X:47609400-47609422 GGGGGAGCCCTGGGGCTGGGAGG - Intronic
1190298378 X:49042019-49042041 GTGTGAGCCCTGGGTGGGGGGGG - Intronic
1194667608 X:96693033-96693055 GTGATGGAGCTGGGGATGGGTGG + Intronic
1196124734 X:112085106-112085128 TTGTCAGCCTTGGGGCTGGGTGG + Intergenic
1199034885 X:143038476-143038498 ATGTTAGCTATGGGGATAGGAGG - Intergenic
1200114549 X:153764476-153764498 GTGGTAGCCCTGGGGTTAGGAGG + Intronic