ID: 1182153026

View in Genome Browser
Species Human (GRCh38)
Location 22:28043719-28043741
Sequence TTGGGGAGGATTGCTGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 189}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182153010_1182153026 23 Left 1182153010 22:28043673-28043695 CCCATATAACCTTATTAGAAATC 0: 1
1: 0
2: 0
3: 11
4: 205
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1182153012_1182153026 14 Left 1182153012 22:28043682-28043704 CCTTATTAGAAATCCCCCTCTTT 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1182153014_1182153026 1 Left 1182153014 22:28043695-28043717 CCCCCTCTTTGGATTAAGCAAGG No data
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1182153009_1182153026 28 Left 1182153009 22:28043668-28043690 CCTCACCCATATAACCTTATTAG 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1182153018_1182153026 -2 Left 1182153018 22:28043698-28043720 CCTCTTTGGATTAAGCAAGGTTT 0: 1
1: 0
2: 1
3: 16
4: 261
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1182153011_1182153026 22 Left 1182153011 22:28043674-28043696 CCATATAACCTTATTAGAAATCC 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1182153017_1182153026 -1 Left 1182153017 22:28043697-28043719 CCCTCTTTGGATTAAGCAAGGTT 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1182153016_1182153026 0 Left 1182153016 22:28043696-28043718 CCCCTCTTTGGATTAAGCAAGGT 0: 1
1: 0
2: 1
3: 15
4: 283
Right 1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG 0: 1
1: 0
2: 2
3: 11
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182153026 Original CRISPR TTGGGGAGGATTGCTGTTGG GGG Intronic
902645342 1:17793853-17793875 GTGGGGAGAATTGGTATTGGGGG + Intronic
903787404 1:25870445-25870467 TTGGGGAGGAGAGGTGTGGGAGG - Intronic
908478667 1:64514542-64514564 TGGGGGAGGAATGCAGTTGTAGG + Intronic
910637800 1:89428536-89428558 GTTGAGAGGGTTGCTGTTGGTGG + Intergenic
911671993 1:100618080-100618102 TTGGGGATGTTTCCTGTTTGGGG + Intergenic
916011582 1:160711175-160711197 TTGGAAAGGATTGCTGTCTGGGG - Intronic
917918491 1:179728614-179728636 TTTGGGAGGGTTGATGTTTGTGG + Intergenic
918965309 1:191338477-191338499 TTGGTGAGGAGTGGTGTTTGGGG + Intergenic
919689380 1:200515550-200515572 ATGGGCAGAATTGCGGTTGGGGG - Intergenic
920096863 1:203492097-203492119 TTGGGGAGGAACGATGGTGGGGG + Intergenic
923021370 1:230166830-230166852 TGGGGGAGAATTGCTGTAGTGGG + Intronic
924506265 1:244687779-244687801 CTTGGGAGTATTGCTGTGGGTGG + Intronic
1064567844 10:16660888-16660910 TTTGGGAGGTTTGCAGTGGGTGG - Intronic
1066033273 10:31451785-31451807 TTTGGGAGGATGGCTCTTGTTGG + Intronic
1066690145 10:38018360-38018382 TTGGGCAGGAATGTGGTTGGTGG + Intronic
1067508415 10:46875873-46875895 TTGGGGAGGCTTCCTGGAGGAGG + Intergenic
1067653834 10:48175976-48175998 TTGGGGAGGCTTCCTGGAGGAGG - Intronic
1067693456 10:48519277-48519299 CTGGGCAGGAATGCTGTTGCTGG - Intronic
1068082258 10:52333742-52333764 TAGGAGAGGTTTGCTTTTGGGGG - Intergenic
1068095220 10:52482954-52482976 TTGGGAAGGTTTTCTTTTGGGGG + Intergenic
1069492069 10:68869539-68869561 ATGGGGAAGAGTGCTGTAGGTGG + Intronic
1071767797 10:88689044-88689066 GTGGGGAGGATGACTGGTGGGGG - Intergenic
1072563183 10:96595935-96595957 TTGGTGAGGACAGCTGTTTGGGG - Intronic
1075497737 10:122941481-122941503 TTGGGCAGGACTTCTCTTGGGGG - Intronic
1076006380 10:126950923-126950945 GTTGGTAGTATTGCTGTTGGCGG + Intronic
1079305152 11:19315353-19315375 TTGGGGAGGGTAGATGTTGGTGG + Intergenic
1080067387 11:28033728-28033750 TTGGGGAGGATGGTTAATGGGGG + Intronic
1080471803 11:32552993-32553015 CTGGGAAGGTTTCCTGTTGGAGG + Intergenic
1085741018 11:79078444-79078466 GTGGGGAGGATGGCTTGTGGTGG + Intronic
1087051246 11:93888441-93888463 TGGGAAAGGATTGATGTTGGTGG + Intergenic
1089846303 11:121461228-121461250 TTGGCAAGGTGTGCTGTTGGTGG + Intronic
1090221087 11:125026587-125026609 TTGGGGAGGATGATTGGTGGAGG + Intronic
1090793242 11:130110782-130110804 TTGGGGAGGATTTCTCTTAGGGG + Intronic
1091775722 12:3183474-3183496 TTGGGGAGAGTTGCTGGCGGAGG + Intronic
1091777386 12:3193389-3193411 TGGGGCAGGATTGCTGTAGCTGG + Intronic
1092072122 12:5639891-5639913 TGGAGGAGGATTTCTGATGGTGG + Intronic
1093278703 12:17162518-17162540 GTGGGTGGGATTGGTGTTGGTGG + Intergenic
1096407864 12:51357085-51357107 TTGAGGAGGCTAGCTGCTGGGGG - Intronic
1096790117 12:54039250-54039272 TTGTGGAGAGGTGCTGTTGGGGG + Intronic
1098935094 12:76469659-76469681 TAGGGGATGATTGCTGTTTTGGG - Intronic
1101422851 12:104563758-104563780 TTGTGGATGTTTGCTCTTGGTGG + Intronic
1102410821 12:112716744-112716766 TAGGGGAGGAAAGATGTTGGGGG + Intronic
1102423183 12:112820138-112820160 TTAGGGAGCAATGCTGGTGGAGG + Intronic
1103475391 12:121214435-121214457 TGAGGGAGGGTTGCTGTAGGAGG - Intronic
1103676003 12:122656222-122656244 ATGGGGAGGATTGTTTTTGATGG - Intergenic
1106180314 13:27364036-27364058 TTGTGGATGAATGCTGTTGCTGG + Intergenic
1107617535 13:42185986-42186008 TGGGGGAGGAGTGGTGGTGGTGG + Intronic
1110240839 13:73264931-73264953 AAGGGAAGGATTGCAGTTGGGGG + Intergenic
1111172101 13:84541054-84541076 GAGGGAAGGATTGCTTTTGGGGG + Intergenic
1112916095 13:104552344-104552366 TTGGCAAGGATTGCTGTTAATGG - Intergenic
1113040805 13:106102061-106102083 TTGGGGATGGTTACAGTTGGAGG + Intergenic
1114382060 14:22217103-22217125 TTGGGTAGTAGTGCTGTTGCTGG - Intergenic
1114636439 14:24189640-24189662 CTGGGGAGGATTACCGCTGGTGG - Exonic
1117979495 14:61328495-61328517 TTGGAGAGGAATGAGGTTGGTGG + Intronic
1119389136 14:74278612-74278634 TTGGGGATGAGTGCTGTGGTGGG - Intergenic
1119681683 14:76597032-76597054 CTGGGGAGGATGGCTGGTGCTGG + Intergenic
1121315946 14:92961107-92961129 CTGGGGAGCATTTCTGTTGGTGG + Intronic
1122128941 14:99593999-99594021 TTGGGGAGGTTTGATTTTGCTGG + Intronic
1122138835 14:99650219-99650241 TGGGGGAGGATTGGGGATGGGGG - Intronic
1123167246 14:106337669-106337691 TTGGGGAAGATCTCTCTTGGAGG - Intergenic
1123169864 14:106362380-106362402 TTGGGGAAGATCTCTCTTGGAGG - Intergenic
1123199236 14:106646057-106646079 TTGGGGAAGATCTCTCTTGGAGG - Intergenic
1125468352 15:39977054-39977076 TTGGTGGGGATTAATGTTGGGGG - Intronic
1126133254 15:45364799-45364821 TCTGGGATGATTGGTGTTGGAGG + Exonic
1129987789 15:79933894-79933916 TTTGGGAGGATTGTTGTGGTAGG - Intergenic
1130845394 15:87739401-87739423 TTGGGCAGGGTTGATCTTGGAGG + Intergenic
1130852231 15:87805796-87805818 ATGGGAAGGTTTTCTGTTGGTGG + Intergenic
1132353382 15:101154457-101154479 TTGGTGAGGAGTGCAGATGGGGG + Intergenic
1136631061 16:31489521-31489543 TGGGGGAGGCTTGATGTTGATGG + Exonic
1137782922 16:51113298-51113320 TTGGGGAAGCTTGCTGTGAGCGG + Intergenic
1138458335 16:57133679-57133701 TGGGGGAGGAATGCCTTTGGAGG + Intronic
1140061700 16:71576094-71576116 TTGGAGAAGATGGCAGTTGGGGG - Intronic
1140220393 16:73039609-73039631 TTGGGGATAATTGTTTTTGGGGG - Intronic
1141132863 16:81446977-81446999 TCAGGGAGGATTGCTGGTCGCGG + Intronic
1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG + Intergenic
1141755600 16:85988686-85988708 ATGAGGAGGGTTCCTGTTGGGGG + Intergenic
1141880547 16:86856092-86856114 CTGGGGAGGCTTGCTGAAGGAGG + Intergenic
1143061829 17:4208416-4208438 TTGGGGCGCATTCCTGTTAGAGG - Intronic
1144678529 17:17177139-17177161 GTAGGGAGGCTTGCTGTGGGCGG - Intronic
1144765839 17:17731973-17731995 TGGAGGAGGATTGCTGGGGGAGG + Intronic
1145934076 17:28704934-28704956 TTGGGGTGGACAGCTGGTGGTGG - Intronic
1147387017 17:40088898-40088920 GTGGGGAGGACTGAGGTTGGTGG - Intronic
1149023153 17:51993516-51993538 CTGGGGAGGATTTCTGTTCATGG - Intronic
1149298747 17:55285023-55285045 CTGGGGAGCTTTGCTGTTGTGGG - Intronic
1149401345 17:56299427-56299449 TTGGGGAGGCTTTATGTAGGAGG - Intronic
1151042625 17:70881245-70881267 TTGGAGAGGATTACAGATGGGGG + Intergenic
1152319129 17:79598084-79598106 TTGGGGAGAATTGCTAGTGAGGG - Intergenic
1153653350 18:7260969-7260991 TTGGGAATGATTTCTGTTGAAGG + Intergenic
1157883989 18:51348654-51348676 ATGTGGAGGATTTCTGTGGGGGG - Intergenic
1159018586 18:63123735-63123757 TTGGGGAAGCTTTCTTTTGGTGG - Exonic
1159111570 18:64064696-64064718 TTGGGGAAGTCTGGTGTTGGAGG - Intergenic
1160256046 18:77249897-77249919 TTTGGGAGGCTTCCTGGTGGTGG - Intergenic
1163784480 19:19267751-19267773 TGGGGGAGGCTTCCTGTGGGAGG - Intronic
1165748109 19:38242732-38242754 TTGATGAAGATTGCTGTGGGCGG + Intergenic
1166082818 19:40455183-40455205 TTGGGGAGGATTGTTTTTTATGG - Intronic
1166396398 19:42444326-42444348 TGGGGGAGGATTTGGGTTGGTGG + Intergenic
1167663439 19:50810138-50810160 TTGGGGTGGGTTGTGGTTGGGGG + Intergenic
1168689837 19:58369582-58369604 TTGGGGAGGAACGGTGATGGCGG - Intronic
925574033 2:5341540-5341562 TTGGGGAGGACTGCGATTTGGGG - Intergenic
925621379 2:5796577-5796599 TAGGGAAGGATTGCTGGAGGTGG + Intergenic
925838660 2:7970008-7970030 CTGGGGAGGGCTGCTGTGGGCGG + Intergenic
927152285 2:20203039-20203061 TTGGGGTGAATTGCTGCTGTGGG - Intronic
927652713 2:24921809-24921831 TTGGGGGGGATTTTTTTTGGAGG + Intergenic
928345644 2:30492296-30492318 TTGGGTAGGGTTACTGTAGGAGG + Intronic
928594946 2:32850992-32851014 TTGGGAAGGAATGGGGTTGGGGG + Intergenic
928603927 2:32926851-32926873 CAGGGGAGGAATGCTGATGGGGG - Intergenic
934730302 2:96652284-96652306 TCTGGGAGTATTGCTATTGGAGG + Intergenic
937919132 2:127118025-127118047 CTGGTGAGGATTGGAGTTGGGGG + Intergenic
937939728 2:127275626-127275648 TGGAGGAGCATTGCTGTGGGAGG + Intronic
941372273 2:164680393-164680415 TTTTGGATGATTTCTGTTGGTGG - Intronic
942199352 2:173555167-173555189 TTCAGAACGATTGCTGTTGGTGG - Intergenic
942357654 2:175135897-175135919 TTGGGGAGCATTGCTATTGAAGG - Intronic
942884891 2:180911199-180911221 TTGGGGAGGAAAGCGGATGGAGG - Intergenic
944272391 2:197797755-197797777 GTGGGGAGGGTTGATGTGGGTGG + Intergenic
944288088 2:197974737-197974759 TTTGGGAAGAATGCCGTTGGGGG + Intronic
947048894 2:226019821-226019843 TATGGGAGGAATGCTGTGGGAGG - Intergenic
947946813 2:234110813-234110835 TTTGTGAGGATTGTGGTTGGGGG + Intergenic
1169066166 20:2695216-2695238 TGGGTGAGGAGTGCTGATGGGGG + Intronic
1171341201 20:24431087-24431109 TTGGGCTGGAAGGCTGTTGGGGG - Intergenic
1174890991 20:54392803-54392825 TTGTGGGGGATTGCTGTAGTAGG + Intergenic
1175150327 20:56928520-56928542 TTGGGCAGGATTGAGGTGGGAGG - Intergenic
1175815917 20:61883147-61883169 CTCGGGAGGAATGCTGTAGGCGG - Intronic
1176120018 20:63450154-63450176 TGGGGGAGGAGTGGTGGTGGAGG - Intronic
1179551464 21:42146489-42146511 TTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179551479 21:42146543-42146565 TTGGGGAGGAGGGCTGTGGTGGG + Intergenic
1179791770 21:43759915-43759937 CTGGGGAGGGTGGCTGTGGGAGG + Exonic
1180738687 22:18037825-18037847 TTGGGTAGGAGAGCTGGTGGCGG + Intergenic
1181943688 22:26498797-26498819 TTGGGAAGGATTGCTGAAGGTGG - Intronic
1182153026 22:28043719-28043741 TTGGGGAGGATTGCTGTTGGGGG + Intronic
1182797058 22:32998607-32998629 ATGGGGAGGAGGGCTGTTGGGGG - Intronic
1183124208 22:35759894-35759916 TAGGCGGGGATGGCTGTTGGAGG + Exonic
1183125904 22:35781807-35781829 TTGGGGATGATTGCTGTGGGGGG - Intronic
1183379097 22:37481846-37481868 GAGGGGAGCATTGCAGTTGGAGG - Intronic
953749790 3:45600511-45600533 GTGGGGAGGATGGCTGGAGGAGG - Intronic
955149356 3:56351664-56351686 TTGGGGAGGTTTGTTGGAGGAGG + Intronic
956497117 3:69839888-69839910 TTGGGGAGGAGGGGTGTGGGGGG - Intronic
956502043 3:69897236-69897258 TTTTGGAGGAATGCAGTTGGAGG + Intronic
957436810 3:80188153-80188175 TTGCAGAGGATTGCTGTTGTGGG + Intergenic
958678590 3:97296541-97296563 TGGGGGTGGGTTGCTGTTAGTGG + Intronic
958867627 3:99519505-99519527 TTGGGGAGGATGGATAGTGGAGG - Intergenic
961482440 3:127192839-127192861 TTGGGGAGGAGTCCTGCAGGCGG - Intergenic
962774848 3:138649646-138649668 AAGGGCAGGATTGCAGTTGGTGG + Intergenic
962869561 3:139476346-139476368 ATGGGGAGGGTAGCTGTTGTTGG - Intronic
963527607 3:146433897-146433919 ATGGGGAGAGTGGCTGTTGGAGG + Intronic
964788855 3:160431263-160431285 TTGGGGAGGATTGTTTTAGGGGG + Intronic
967817857 3:193814507-193814529 TTGGTGAGGACTTCTGTGGGGGG - Intergenic
971164807 4:24172070-24172092 TAGTAGAGGACTGCTGTTGGAGG - Intergenic
972142135 4:35974064-35974086 TTGAGGAAGATAGCTTTTGGGGG + Intronic
972466878 4:39366130-39366152 TGGGGGAGGATGGCGGTGGGTGG - Intronic
976770993 4:88652756-88652778 TTGGGTGGGTTTGGTGTTGGGGG + Intronic
981877186 4:149560939-149560961 GTGTGAAGGGTTGCTGTTGGGGG - Intergenic
985667429 5:1188532-1188554 TTGGGGTGGATTGCTGTGATGGG - Intergenic
985688855 5:1295749-1295771 TTGGGGTGGTTTGCTCATGGTGG - Intergenic
991074719 5:62522262-62522284 GTGGGGAGGCTTGCTGATTGTGG + Intronic
991442857 5:66669444-66669466 TTGAGGATGGTTGCTGTGGGAGG + Intronic
995306554 5:110657589-110657611 CTGGGGAGGGTTGAGGTTGGAGG + Intronic
995423498 5:111993016-111993038 TTGGGGAGGGTTGCGTTGGGAGG - Intronic
997754408 5:136382785-136382807 TGAGGGAGGATTGCTGTGGGAGG - Intronic
997926488 5:138035108-138035130 TAGGGTAGGAATGCTGCTGGAGG - Intronic
997953979 5:138264209-138264231 CTGGGGAAGATGGCTCTTGGGGG - Intronic
998383444 5:141742198-141742220 TTGGGGCAGATTGATGGTGGGGG + Intergenic
999872176 5:155764312-155764334 TTGGGGACGTTTTTTGTTGGTGG - Intergenic
1000158489 5:158575709-158575731 CTGACAAGGATTGCTGTTGGTGG - Intergenic
1000611746 5:163382685-163382707 CTTGGGAGGGTTGCTGTTGCTGG - Intergenic
1001101859 5:168820940-168820962 TTGGGGGGGACGGCTGGTGGTGG - Intronic
1003096474 6:3146498-3146520 TTGGGGTGGAGTGCTGGTGTGGG + Intronic
1018369726 6:163156555-163156577 TTGGGGAGGACTGAAGTGGGAGG - Intronic
1019300775 7:302448-302470 CTGGGATGGATGGCTGTTGGGGG - Intergenic
1030485166 7:110156423-110156445 TTGGGGAATAATGCTGTTGAAGG - Intergenic
1030987971 7:116264417-116264439 TTGGGGAGGATTTAGGTTTGGGG - Intergenic
1032163387 7:129527257-129527279 TCGGGGAGGGCTGCTCTTGGAGG - Intergenic
1032405711 7:131653832-131653854 AAGGGGAGGAGTGCTGTGGGGGG + Intergenic
1032590925 7:133191722-133191744 TTGGGGAGGGTGGCGGATGGGGG + Intergenic
1032610607 7:133408343-133408365 GTGGGGTGGATTGGTGATGGTGG + Intronic
1035345480 7:158194441-158194463 TTTGGGAGCATTGCTGAGGGCGG - Intronic
1037165346 8:15821379-15821401 TTGGGGAGTAGTCCTGTTTGTGG + Intergenic
1038802467 8:30761818-30761840 TAGGGGTGGTTTGCTGTTGGGGG + Intronic
1041476930 8:58277576-58277598 TTGGCCGGCATTGCTGTTGGTGG - Intergenic
1041863828 8:62545340-62545362 TTTGGGAGGCTTGAAGTTGGTGG + Intronic
1043574803 8:81645139-81645161 TTGGGGATGAGTTCTTTTGGGGG - Intergenic
1045224786 8:100233875-100233897 CCGGCAAGGATTGCTGTTGGAGG + Intronic
1045671856 8:104564228-104564250 TTGAGAAGCATTGCTGTAGGAGG - Intronic
1046463513 8:114572022-114572044 GTGGGGAAGATTGTTGGTGGAGG + Intergenic
1047251611 8:123185312-123185334 GTGGGGACCAATGCTGTTGGGGG + Intronic
1047916804 8:129592194-129592216 CTCAGGAGAATTGCTGTTGGAGG - Intergenic
1051302781 9:15670937-15670959 TGGGGGAGGATTGCTTTTGGTGG + Intronic
1055697039 9:78896394-78896416 TTGGGGAAGATTGCTTTCTGAGG + Intergenic
1060118499 9:120965916-120965938 TTGGGGAAGATTGCTGGTTTTGG - Intronic
1061367896 9:130182039-130182061 TAGGGGAGTATTGTGGTTGGGGG + Intronic
1061941748 9:133887635-133887657 TTGGGGAGGGTCTCTGCTGGGGG - Intronic
1062312687 9:135947733-135947755 GTGTGGGGGATTGCTGTGGGGGG - Intronic
1188304092 X:28541257-28541279 TAGGGGAGGAGTGGTGGTGGAGG + Intergenic
1192282975 X:69703723-69703745 TTGCTGAGGCATGCTGTTGGTGG + Intronic
1192343502 X:70282432-70282454 TTGGGAAAGATTGGAGTTGGAGG + Intronic
1199274497 X:145925735-145925757 TTGGGGAGGGGTGGTGTTGGTGG - Intergenic
1199873265 X:151915286-151915308 TCGAGGAGGAGTGCTGGTGGGGG - Intronic
1199873792 X:151917330-151917352 TCGAGGAGGAGTGCTGGTGGGGG - Intronic
1199873970 X:151918005-151918027 TCGAGGAGGAGTGCTGGTGGGGG - Intronic
1200683095 Y:6235934-6235956 TTGGGGAGGCTGGCTGTAAGGGG + Intergenic
1200832855 Y:7704476-7704498 TTGGGGAGCAAGGCTGTTTGGGG - Intergenic
1201049538 Y:9918452-9918474 TTGGGGAGGCTGGCTGTAAGGGG - Intergenic
1202176783 Y:22105641-22105663 TTGGGAGGGATTGATGCTGGTGG - Intergenic
1202214578 Y:22480743-22480765 TTGGGAGGGATTGATGCTGGTGG + Intergenic