ID: 1182158571

View in Genome Browser
Species Human (GRCh38)
Location 22:28099092-28099114
Sequence GTCTCTAGTCTGTAAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182158571 Original CRISPR GTCTCTAGTCTGTAAACAGC TGG (reversed) Intronic
902402815 1:16167396-16167418 GTCTCTCGTCTCTCAGCAGCAGG - Intergenic
908090992 1:60685686-60685708 GTCCCTAGGCTGCACACAGCAGG - Intergenic
909250211 1:73344135-73344157 GTCCCTAGGCTGCACACAGCAGG - Intergenic
909265946 1:73558449-73558471 GTCCCTAGGCTGCACACAGCAGG - Intergenic
912206038 1:107510573-107510595 GTCCCTAGGCTGCACACAGCAGG - Intergenic
913668412 1:121071458-121071480 GTTCCTAGGCTGTACACAGCAGG + Intergenic
914020155 1:143858901-143858923 GTTCCTAGGCTGTACACAGCAGG + Intergenic
914658656 1:149766813-149766835 GTTCCTAGGCTGTACACAGCAGG + Intergenic
915791230 1:158673669-158673691 ATCTCTAGACTGTAAACTCCAGG - Intronic
915874611 1:159599153-159599175 TTCTTTAGGCTGTAAACAACAGG - Intergenic
918908044 1:190525271-190525293 ATATCTATTCTGTAAACAGTAGG + Intergenic
919291955 1:195643853-195643875 GTCTCTAGGTTGCACACAGCAGG + Intergenic
920573732 1:207039754-207039776 GGCTCTACACTGCAAACAGCAGG - Intronic
922414305 1:225406580-225406602 GTTTCAAGTATGTAGACAGCAGG + Intronic
1062859221 10:797067-797089 GTCCCTAGGCTGTACACAGCAGG - Intergenic
1063381771 10:5590265-5590287 TTCTCTAGTCTGGAAACTGTGGG - Intergenic
1064044059 10:11995452-11995474 TCCTCTAGACTGTAAACTGCAGG - Intronic
1064095102 10:12418294-12418316 ATCTCTAATCAGTCAACAGCTGG - Intronic
1065271893 10:24041669-24041691 GTGCCTGTTCTGTAAACAGCAGG + Intronic
1069295493 10:66838814-66838836 GTCTGTATTCTGGAACCAGCAGG + Intronic
1069339851 10:67397753-67397775 GTCCCAAGTCTGCATACAGCAGG - Intronic
1071818315 10:89254451-89254473 GTCCCTAGGCTGCACACAGCAGG + Intronic
1071873473 10:89819161-89819183 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1073942367 10:108713404-108713426 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1074622373 10:115138634-115138656 GTCCCTAGGCTGTACAGAGCAGG + Intronic
1075382778 10:122032465-122032487 GTCTTTAATCTGTGAACAGGAGG - Intronic
1075543700 10:123337472-123337494 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1075918986 10:126194322-126194344 TTCTCTAGTCTGCACACAGGTGG - Intronic
1076288767 10:129327547-129327569 GACCCTAGTCTGTTAACATCAGG + Intergenic
1078308955 11:10219367-10219389 GTCCCTAGACTGCACACAGCAGG + Intronic
1079838685 11:25367034-25367056 GTCTCTATGCTGCACACAGCAGG + Intergenic
1081401789 11:42652221-42652243 GTCTCGAGTTTGTAAGCATCTGG + Intergenic
1084730220 11:71068261-71068283 GTTTCTGGGCTCTAAACAGCAGG - Intronic
1086006735 11:82047127-82047149 GTATCTAGGCTGCACACAGCAGG - Intergenic
1086769520 11:90744848-90744870 GTCCCTAGGTTGTACACAGCAGG - Intergenic
1089641486 11:119850553-119850575 GTGTTTAGTCTGTGAACATCTGG + Intergenic
1090692557 11:129199416-129199438 GTCCCTAGGCTGCACACAGCAGG - Intronic
1091350689 11:134891827-134891849 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1092036880 12:5343870-5343892 TTCTCTAGTATGTTAACTGCAGG - Intergenic
1092643066 12:10537899-10537921 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1093514280 12:19967599-19967621 CTCTCTCTTTTGTAAACAGCAGG - Intergenic
1094752061 12:33421698-33421720 GCATCTAGTTTGGAAACAGCTGG + Intronic
1097445611 12:59667858-59667880 GTCCCTAGGCTGTACACAGCAGG - Intronic
1098327379 12:69316586-69316608 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1098761831 12:74434786-74434808 ATCTCTAGACTGCACACAGCAGG - Intergenic
1099490743 12:83284893-83284915 GTCCCTAGACTGCAGACAGCAGG - Intergenic
1099641463 12:85291798-85291820 CTCTGTAGTCTATAAACAGAGGG - Intronic
1108796208 13:54033617-54033639 GTCCCTAGACTGCACACAGCAGG + Intergenic
1109324679 13:60853026-60853048 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1110044314 13:70809840-70809862 GTCTCTAGGCTGCACAGAGCAGG - Intergenic
1111307501 13:86434435-86434457 GTCACTAGGCTGCACACAGCTGG - Intergenic
1111427214 13:88102747-88102769 GTCTCTATTCTGAATACAGCAGG + Intergenic
1111716681 13:91887298-91887320 GTCTCTAGGCTGCACACAGCAGG + Intronic
1111799102 13:92960362-92960384 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1112769674 13:102781810-102781832 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1114942476 14:27631158-27631180 GTATCTAGTCTTTTAACAGCTGG - Intergenic
1114986714 14:28238791-28238813 GTCCCTAGTCTGCACAGAGCAGG - Intergenic
1116138665 14:40959778-40959800 GTCCCTAGGCTGCATACAGCAGG + Intergenic
1116296687 14:43119850-43119872 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1116356473 14:43937148-43937170 GTCCCTAGGCTGGACACAGCAGG + Intergenic
1116389650 14:44377182-44377204 GTCCCTAGGCTGTACACAGCAGG + Intergenic
1116825266 14:49667393-49667415 ATCTCTATTCTTTAAACAGAAGG - Intronic
1117084138 14:52181491-52181513 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1118591720 14:67406930-67406952 GTTTCTTGTCTGTAATCCGCTGG + Intronic
1120378021 14:83733940-83733962 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1120485907 14:85112959-85112981 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1120582916 14:86276379-86276401 GTCTCTAGTTTGTCCACTGCTGG + Intergenic
1123737593 15:23200327-23200349 GTCTCAAGGCTGCACACAGCAGG + Intergenic
1124062346 15:26306033-26306055 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1124211257 15:27766887-27766909 CTCTCCAGTTTGTAAAGAGCAGG - Intronic
1124288804 15:28428989-28429011 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1124294420 15:28488324-28488346 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1126399850 15:48257684-48257706 GTCCCTAGGCTGCACACAGCAGG + Intronic
1127164709 15:56232376-56232398 GTCTCTAGGTTGCAAAGAGCAGG + Intronic
1129692726 15:77722970-77722992 GTCTCCACTCTGTGAACTGCAGG - Intronic
1129900498 15:79144452-79144474 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1130422062 15:83757467-83757489 GTCCCTAGGCTGCACACAGCAGG + Intronic
1130791434 15:87160168-87160190 GTCCCTAGGCTGCATACAGCAGG - Intergenic
1131872084 15:96773635-96773657 GCCTCTAGTCTGTGAATGGCTGG - Intergenic
1131921415 15:97332714-97332736 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1132121953 15:99183921-99183943 GTCCCTAGGCTGCACACAGCAGG - Intronic
1133003709 16:2865469-2865491 GTCTCATGCCTGTAAAGAGCTGG + Intergenic
1135919066 16:26631958-26631980 GTCCCTAGGCTGCACACAGCGGG + Intergenic
1136709918 16:32228671-32228693 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1136757991 16:32700740-32700762 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1136810115 16:33169635-33169657 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1136816591 16:33279715-33279737 GTCTCTAGGCTGCACACAGCAGG - Intronic
1203060142 16_KI270728v1_random:961089-961111 GTCTCTAGGCTGCACACAGCAGG + Intergenic
1144500158 17:15779262-15779284 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1147767146 17:42844785-42844807 GGCTCAGGTCTGCAAACAGCTGG - Exonic
1147768339 17:42851514-42851536 GGCTCAGGTCTGCAAACAGCTGG - Exonic
1147770931 17:42867446-42867468 GGCTCAGGTCTGCAAACAGCTGG - Intergenic
1149064641 17:52465592-52465614 GTCGCTAGGCTGCACACAGCAGG - Intergenic
1149112387 17:53048921-53048943 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1149371002 17:55993256-55993278 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1149902341 17:60492015-60492037 GTCCCTAGTCTGCACACAGCAGG - Intronic
1153846047 18:9050853-9050875 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1156243573 18:35276477-35276499 GTCCCTAGGCTGCACACAGCAGG - Intronic
1156892325 18:42204689-42204711 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1158020618 18:52837118-52837140 GTCCCTAGGCTGCACACAGCAGG + Intronic
1158822622 18:61178804-61178826 GTTTCTAGGCTGCACACAGCAGG - Intergenic
1159180302 18:64893617-64893639 GTCCCTAGAATGCAAACAGCAGG + Intergenic
1159712736 18:71783245-71783267 TTCTCTACTATGTAAGCAGCTGG - Intronic
1159805862 18:72957682-72957704 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1162466806 19:10847161-10847183 GTTTCTGGGCTGTAAACAGGAGG + Intronic
1164851186 19:31485517-31485539 GTCCCTAGACTGCACACAGCAGG + Intergenic
1166252767 19:41582737-41582759 GTCTCTAGGCCGCACACAGCAGG + Intronic
1168702409 19:58449062-58449084 GTCTGTAGGCTGCACACAGCAGG - Intergenic
926840137 2:17070981-17071003 GTCCCTAGGCTGCACACAGCAGG - Intergenic
926929639 2:18023950-18023972 GTCCCTAGGCTGCACACAGCAGG + Intronic
928474841 2:31615854-31615876 GTCCCTAGGCTGCACACAGCAGG - Intergenic
929211278 2:39359843-39359865 GTCCCTAGGCTGCACACAGCAGG + Intronic
929979821 2:46667853-46667875 GTCTATAGACTGTAAACACGTGG + Intergenic
930427877 2:51234363-51234385 GTCCCTAGGCTGCACACAGCAGG + Intergenic
931941459 2:67256258-67256280 GTTCCTAGTCTGTAAAGAGAAGG + Intergenic
932933647 2:76075379-76075401 GCCACAAGTCTGAAAACAGCAGG - Intergenic
933085084 2:78045946-78045968 GTCCCTAGGCTGTACACAGCAGG - Intergenic
934054965 2:88243855-88243877 GTCCCTAGGCTGCACACAGCAGG - Intergenic
934900116 2:98153094-98153116 GTCTCTAGCCTGTACTCACCTGG + Intronic
935642384 2:105303361-105303383 GACTGTGGTCTGTAAACATCAGG + Intronic
936257512 2:110929711-110929733 GTCCCTAGGCTGCACACAGCAGG - Intronic
936685538 2:114822357-114822379 GTCCCTAGGCTGCACACAGCAGG + Intronic
936887888 2:117334886-117334908 TTGCCTAGTCTGTAATCAGCAGG - Intergenic
936897564 2:117445686-117445708 GTCTCTAGGCTGCACACAGAAGG - Intergenic
939498312 2:142949622-142949644 GTCCCTAGTCTGCACACTGCAGG + Intronic
940426793 2:153540153-153540175 GTCTCTAGGCTGCACACAGCAGG - Intergenic
940505317 2:154546503-154546525 GTCCCTAGGCTGCACACAGCAGG - Intergenic
941512987 2:166437178-166437200 GTCCCTAGGCTGCACACAGCAGG - Intronic
942016059 2:171817074-171817096 ATTCCTAGTCTGTAGACAGCAGG - Intronic
942904769 2:181167091-181167113 GTCCCTAGGCTGCACACAGCAGG + Intergenic
943176704 2:184484907-184484929 GTCTCTGGTCTGGAAACAACTGG - Intergenic
944272244 2:197796555-197796577 GTCTCTAGGCTGCACACAGTAGG + Intergenic
945495313 2:210501136-210501158 GTCTCTAGGCTGCACACATCGGG + Intronic
946108278 2:217391140-217391162 GTCCCTAGGCTGCACACAGCAGG + Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
947886543 2:233576558-233576580 GTCCCTAGGCTGCACACAGCAGG + Intergenic
947893461 2:233646198-233646220 GTCCCTAGGCTGCACACAGCAGG + Intronic
948687879 2:239681691-239681713 GTCTCTAATGTATAAACAGATGG + Intergenic
949028535 2:241777460-241777482 GTCTCCCTTCTGTAAACAGAGGG + Intronic
1169592811 20:7163940-7163962 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1169593961 20:7176960-7176982 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1170410049 20:16079744-16079766 TTCTATAGCCTGTGAACAGCAGG + Intergenic
1173467030 20:43291375-43291397 ATCTCTAATCTGTAGAGAGCTGG + Intergenic
1173793252 20:45841538-45841560 CTCTCCAGCCTATAAACAGCCGG + Exonic
1176812840 21:13562062-13562084 GTCTCTCATCTGTCATCAGCTGG - Intergenic
1177471323 21:21563995-21564017 GTCCCTAGTGTGCACACAGCAGG - Intergenic
1177881714 21:26702549-26702571 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178011359 21:28290354-28290376 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178037428 21:28600450-28600472 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178355717 21:31909291-31909313 GTTTCTAGTCTCTCACCAGCAGG + Intronic
1178682029 21:34680322-34680344 GTCCCTAGGCTGCACACAGCAGG + Intronic
1179271980 21:39858586-39858608 GTCTCGAGGCTGCACACAGCAGG + Intergenic
1182158571 22:28099092-28099114 GTCTCTAGTCTGTAAACAGCTGG - Intronic
1183297670 22:37041045-37041067 CTCTCTACTCATTAAACAGCAGG - Intergenic
949261443 3:2106587-2106609 GTCCCTAGGCTGTACACAGCAGG + Intronic
950806136 3:15604403-15604425 GTCCCTAGGCTGCAAACAGCAGG + Intronic
951033977 3:17912829-17912851 GTCTGCAGTCTGTAAACAGAAGG + Intronic
951446178 3:22782789-22782811 GTCCCTAGACTGCACACAGCAGG + Intergenic
951801767 3:26603916-26603938 GTCCCTAGGCTGCACACAGCAGG + Intergenic
952234760 3:31467603-31467625 GTCTGTAGTCTGTCACCAGTTGG + Intergenic
952624905 3:35392347-35392369 GTCCCTAGGCTGCACACAGCAGG + Intergenic
953270417 3:41437466-41437488 ATCTCTGGTGTGTAAACAGCTGG + Intronic
953718940 3:45338681-45338703 GTATCTACTCTCTCAACAGCAGG + Intergenic
955826268 3:62951269-62951291 GTCCCTAGGCTGCACACAGCAGG - Intergenic
958050315 3:88335960-88335982 GTCCCTAGGCTGCATACAGCAGG + Intergenic
958857162 3:99398967-99398989 GTCACTAGGCTGCACACAGCAGG + Intergenic
959803553 3:110524748-110524770 GTCCCTAGGCTGCACACAGCAGG - Intergenic
959846570 3:111040391-111040413 GTCCCTAGGCTGCACACAGCAGG - Intergenic
960341345 3:116478929-116478951 GTCCCTAGGCTGCACACAGCAGG - Intronic
962460985 3:135612564-135612586 GTCCCTAGGCTGCACACAGCAGG - Intergenic
963322695 3:143826517-143826539 CTCTCTACCCTGTACACAGCAGG + Intronic
965305569 3:167059488-167059510 GTCCCTAGACTGCACACAGCAGG + Intergenic
965854647 3:173073439-173073461 GTCCCTAGGCTGCACACAGCAGG - Intronic
967532409 3:190564189-190564211 GTCCCTAGTCTATAGTCAGCAGG + Intronic
968175898 3:196549288-196549310 GTCCCTAGGCTGCACACAGCAGG - Intergenic
970307990 4:14752761-14752783 GTCTCTAGGCTGTATACAGCAGG + Intergenic
970818917 4:20190585-20190607 GTCTCTAGGCTGCACAGAGCAGG - Intergenic
971649684 4:29256541-29256563 GCCTCTAGGCTGTACACATCAGG - Intergenic
971681517 4:29706844-29706866 GTCCCTAGGCTGCACACAGCAGG + Intergenic
972301205 4:37787320-37787342 GTCCCTAGGCTGCACACAGCAGG - Intergenic
974171235 4:58269958-58269980 GTCCCTAGGCTGCACACAGCAGG - Intergenic
974832853 4:67210942-67210964 GTCTCTAGGCTGCAAACAGCAGG - Intergenic
979700041 4:123656892-123656914 GTCCCTAGGCTGCACACAGCAGG + Intergenic
979867630 4:125776369-125776391 GTCCCTAGGCTGCACACAGCAGG - Intergenic
980292421 4:130860283-130860305 GTCCCTAGGCTGCACACAGCAGG - Intergenic
980313119 4:131161532-131161554 TTCTCAATTCTGAAAACAGCAGG - Intergenic
980386046 4:132089035-132089057 GTCCCAAGTCTGCACACAGCAGG - Intergenic
980670208 4:135994979-135995001 GTCCCTAGGCTGCATACAGCAGG + Intergenic
981355816 4:143787925-143787947 GAGTCCAGGCTGTAAACAGCTGG + Intergenic
982075982 4:151737700-151737722 GTCCCTAGACTGCACACAGCAGG - Intronic
982098642 4:151946912-151946934 GTCCCTAGGCTGTACACAGCAGG - Intergenic
984318591 4:178161460-178161482 CTCTCAAGTCTGCACACAGCAGG + Intergenic
986177304 5:5363507-5363529 GCCTCTTGTCTGGAAACTGCTGG + Intergenic
986537487 5:8805881-8805903 GTCCCTAGGCTGCAAACAGAAGG - Intergenic
989787104 5:45345216-45345238 GTCCCTAGGCTGCACACAGCAGG + Intronic
990264521 5:54061152-54061174 GTCCCTAGGCTGCACACAGCTGG - Intronic
990903611 5:60779583-60779605 GTCCCTAGGCTGCACACAGCAGG + Intronic
991039157 5:62158595-62158617 GTCCCTAGGCTGCACACAGCAGG - Intergenic
993015690 5:82532235-82532257 GTCCCTAGGCTGCACACAGCAGG + Intergenic
993711591 5:91230549-91230571 GTCCCTAGTCTGTACACAGCAGG + Intergenic
993776967 5:92012044-92012066 GTCCCTAGGCTGCACACAGCAGG - Intergenic
994092213 5:95819560-95819582 GTATCTAGTAGGTAATCAGCAGG - Intronic
994338747 5:98600788-98600810 GTCTCTAGGCTACACACAGCAGG - Intergenic
994808222 5:104479216-104479238 GTCTCAAGGCTGTACAGAGCAGG - Intergenic
995212028 5:109551468-109551490 GTCCCTAGGCTGCACACAGCAGG - Intergenic
995393195 5:111661343-111661365 GTCCCTAGGCTGCACACAGCAGG + Intergenic
995630544 5:114127500-114127522 GTCGCTAGGCTGCACACAGCAGG + Intergenic
995702800 5:114955084-114955106 GTCCCTAGGCTGCATACAGCAGG - Intergenic
995761058 5:115562286-115562308 GGCTCTAGTGTGAAAACAGAGGG - Intergenic
995774646 5:115712118-115712140 GTCCCGAGGCTGTACACAGCAGG + Intergenic
1000337716 5:160253954-160253976 GAATCTAGTTTGTGAACAGCTGG - Intronic
1003121331 6:3321216-3321238 GTCTCATGTCTGTAAAAAGTGGG - Intronic
1005984161 6:30860118-30860140 GTCTCCAGGCTGCACACAGCAGG + Intergenic
1006110610 6:31742634-31742656 GTCACTAGGCTGTAAACCCCTGG - Intronic
1006836324 6:37001050-37001072 GTCTTCAGTCTGTCTACAGCCGG - Intergenic
1007223445 6:40296534-40296556 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1008332765 6:50262687-50262709 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1009620012 6:66063600-66063622 ATCTCTAGGCTGCACACAGCAGG - Intergenic
1009982436 6:70741989-70742011 GTCCCTAGGCTGCACACAGCAGG + Intronic
1010055101 6:71556072-71556094 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1010339917 6:74737367-74737389 GCCTCTAGTCAGTAAACTGAGGG + Intergenic
1010631838 6:78207707-78207729 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1010810440 6:80293463-80293485 GTCCCTAGACTGCACACAGCAGG + Intronic
1011041124 6:83031770-83031792 GTCCCTAGGCTGCACACAGCAGG - Intronic
1011129736 6:84041069-84041091 GTCTCTAGACTGCACGCAGCAGG - Intronic
1011264107 6:85497535-85497557 GTCCCTAGGCTGGACACAGCAGG + Intergenic
1011347676 6:86389689-86389711 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1011513693 6:88128824-88128846 GTATCTAGGCTGTAAATAGCAGG + Intergenic
1012351119 6:98251773-98251795 GTCTCTGTTTTGTAAACAGTGGG - Intergenic
1012690787 6:102308354-102308376 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1013558797 6:111283827-111283849 GTCCCTAGACTGCACACAGCAGG + Intergenic
1014951177 6:127558055-127558077 GTCCCTAGGCTGCACACAGCAGG - Intronic
1015028924 6:128570651-128570673 TTCTCAAGTCTGGAAGCAGCAGG + Intergenic
1015045209 6:128768353-128768375 GTCTCCAGGCTGTACACAGCAGG + Intergenic
1016175206 6:141071517-141071539 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1016841254 6:148527827-148527849 CTCTCTTGTCTGTACACAGAAGG - Intronic
1016917872 6:149261939-149261961 GACTCTTGTCTCTAAGCAGCTGG + Intronic
1016987868 6:149908702-149908724 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1020958762 7:14776472-14776494 GTCCCTAGGCTGCACACAGCAGG - Intronic
1021326347 7:19273708-19273730 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1021573332 7:22086233-22086255 GTCCCTAGGTTGTACACAGCAGG + Intergenic
1021754003 7:23833629-23833651 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1022607824 7:31833974-31833996 GTCCCTAGGCTGCACACAGCAGG - Intronic
1024415966 7:49107647-49107669 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1027458567 7:78424146-78424168 GTCTGTAGACTGCACACAGCAGG - Intronic
1028048363 7:86152136-86152158 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1028708096 7:93874395-93874417 GTCCCTAGGCTGCACACAGCAGG - Intronic
1030851079 7:114487335-114487357 GTCCCTAGGCTGCACACAGCAGG + Intronic
1030987047 7:116253901-116253923 TTCACTAGACTGTAAGCAGCTGG + Intronic
1031193627 7:118586644-118586666 GTCCCTAGGCTGTACTCAGCAGG - Intergenic
1031230195 7:119096046-119096068 GTCCCTAGGCTGCATACAGCAGG + Intergenic
1032738589 7:134715197-134715219 GTCTCTAGTATGTTAAAATCTGG - Intergenic
1033658596 7:143389060-143389082 ATGTCCTGTCTGTAAACAGCAGG + Intronic
1034040766 7:147874520-147874542 GTCCCTAGGCTGCACACAGCAGG + Intronic
1034739654 7:153462320-153462342 GTCTCTAGGTTGCACACAGCAGG - Intergenic
1037108374 8:15137541-15137563 GTCCCTAGGCTGCACACAGCAGG - Intronic
1039511345 8:38094590-38094612 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1039789860 8:40866707-40866729 CTCTCTGGTGTGTAAATAGCTGG + Intronic
1041497539 8:58503351-58503373 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1041573484 8:59365790-59365812 ATCTCTAGTTTGGAAACAACAGG - Intergenic
1042080630 8:65047136-65047158 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1043426080 8:80150088-80150110 GTCCCTAGGCTGCACACAGCAGG - Intronic
1044282643 8:90374802-90374824 GTCCCTAGTCTGCACACAGCAGG + Intergenic
1044320408 8:90794577-90794599 GTCTCTAGTTTCCAACCAGCTGG - Intronic
1045207387 8:100056533-100056555 GTCCCTAGGCTGTACACAGCAGG - Intronic
1045785724 8:105918444-105918466 GTCTCAAGGCTGCACACAGCAGG - Intergenic
1046600863 8:116315489-116315511 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1048660877 8:136599841-136599863 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1048669057 8:136695916-136695938 GTCTCTAGGCTGCACACAGCAGG - Intergenic
1049208648 8:141375233-141375255 GTTTCTCGTCTGTAAAATGCAGG - Intergenic
1049290686 8:141800068-141800090 GGCTCTGGTCTGTCCACAGCAGG + Intergenic
1050849276 9:10263889-10263911 GTCCCTAGGCAGCAAACAGCAGG - Intronic
1053384203 9:37673855-37673877 GTCCCTAGGCTGCACACAGCAGG + Intronic
1057631835 9:96725512-96725534 GTCTTTAGTCTTTCAGCAGCCGG + Intergenic
1058086493 9:100753388-100753410 GTCCCTAGGCTGTACACAGCGGG + Intergenic
1058393684 9:104525160-104525182 GTCTTTAGGCTGCACACAGCAGG + Intergenic
1059045444 9:110861593-110861615 GTCCCTAGGCTGCACACAGCTGG - Intergenic
1188187331 X:27130977-27130999 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1188325555 X:28797120-28797142 GTCCCTAGACTGCACACAGCAGG + Intronic
1188748249 X:33873491-33873513 GTCACTAGGCTGCACACAGCAGG + Intergenic
1189784084 X:44543574-44543596 GTCTCAACTCTGAATACAGCAGG - Intergenic
1191688169 X:63913942-63913964 GTCCCTAGGCTGCAGACAGCAGG - Intergenic
1192713609 X:73616778-73616800 GTCCCTAGGCTGCACACAGCAGG + Intronic
1192742403 X:73905976-73905998 GTCTCTAGACTGCACACAGCAGG - Intergenic
1193210485 X:78801729-78801751 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1193320374 X:80114740-80114762 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1193865093 X:86721051-86721073 GTCCCTAGGCTGCACACAGCAGG + Intronic
1193887980 X:87006696-87006718 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1193890946 X:87045627-87045649 GTCCCTAGGCTGCATACAGCAGG - Intergenic
1193950263 X:87788515-87788537 GTCCCTAGGCTGTACACAGCAGG + Intergenic
1194253998 X:91613861-91613883 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1196565188 X:117196721-117196743 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1197128236 X:122972819-122972841 GTCCCTAGCCTGCACACAGCAGG - Intergenic
1197442868 X:126512101-126512123 GTCTCTAGGCTGCACATAGCAGG + Intergenic
1199580745 X:149357792-149357814 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1199776144 X:151013527-151013549 GTCTCAAGGCTGTAAACAGCAGG + Intergenic
1200572782 Y:4853438-4853460 GTCCCTAGGCTGCACACAGCAGG + Intergenic