ID: 1182159170

View in Genome Browser
Species Human (GRCh38)
Location 22:28104627-28104649
Sequence AAGGCTGCACAGTTGGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182159170_1182159177 15 Left 1182159170 22:28104627-28104649 CCAAGGTCCAACTGTGCAGCCTT 0: 1
1: 0
2: 1
3: 18
4: 149
Right 1182159177 22:28104665-28104687 CCTGGAACAAGACCCTACTGTGG 0: 1
1: 0
2: 1
3: 10
4: 68
1182159170_1182159174 -3 Left 1182159170 22:28104627-28104649 CCAAGGTCCAACTGTGCAGCCTT 0: 1
1: 0
2: 1
3: 18
4: 149
Right 1182159174 22:28104647-28104669 CTTCAGTTTCTAGGCCAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182159170 Original CRISPR AAGGCTGCACAGTTGGACCT TGG (reversed) Intronic
900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
900898074 1:5497721-5497743 GAGGAGGCAGAGTTGGACCTGGG - Intergenic
901596014 1:10385871-10385893 CAGGGTGCTCAGTTGGATCTAGG - Intergenic
901756578 1:11444919-11444941 ATGGCTGGACAGCTGGCCCTAGG + Intergenic
902611416 1:17599715-17599737 AAGGCAGCACATTTGGTCCTGGG - Intronic
902786982 1:18739048-18739070 AAGGGAGGACAGATGGACCTGGG - Intronic
906197419 1:43937461-43937483 CAGGCTGCTCACTTGGGCCTGGG + Intergenic
910445116 1:87291873-87291895 AAGCCTGAACAGGTGGACTTGGG + Intergenic
912871347 1:113310047-113310069 AAGGATATACAGTTTGACCTGGG - Intergenic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
915648000 1:157287639-157287661 AAGGCTGGACAGAGAGACCTGGG + Intergenic
917211009 1:172632024-172632046 ACGGCTTGACAGTGGGACCTTGG + Intergenic
918578609 1:186097376-186097398 ATGGATACACAGTTGGCCCTCGG - Intronic
919923552 1:202180361-202180383 AAGGCTGCAACGCTGAACCTGGG - Intergenic
921485617 1:215712439-215712461 AAGGCTGGTGAGTTGGCCCTCGG + Intronic
924661266 1:246019665-246019687 AAGATAGCACAGATGGACCTAGG - Intronic
1064216940 10:13408466-13408488 AAGGCTGCCCAGTGGTTCCTTGG + Intergenic
1065858986 10:29854916-29854938 ATGGCTTCACAGTTGTAACTTGG - Intergenic
1067107845 10:43377460-43377482 GAGTCTGCACAGGTGGACCTAGG + Intergenic
1069562512 10:69440822-69440844 AAAGATGCGCAGTTGCACCTGGG + Intergenic
1072181211 10:92982351-92982373 AAGTGTGCACAATTGGATCTTGG - Intronic
1072506547 10:96073547-96073569 TAAGCTGCACAGTTGGTTCTGGG + Intergenic
1074917276 10:117969485-117969507 AAGGTTGCAGAGGAGGACCTAGG + Intergenic
1075880342 10:125845739-125845761 AAGGCTGGACAGAAGGATCTTGG - Intronic
1077134935 11:993783-993805 GACGCTGCACAGGTGGAACTTGG - Exonic
1077616255 11:3676201-3676223 AAGGCTGCGCAGTTCGTCCATGG + Exonic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1080238628 11:30100700-30100722 AAGGAGGCACAGTTTGACTTGGG - Intergenic
1081876599 11:46412681-46412703 AAGGATAAACAGTTGGCCCTTGG - Intronic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1083240660 11:61385693-61385715 AAGGCTGCACACTGGAACCCGGG + Intergenic
1086027802 11:82315327-82315349 AAGGCTTCGCAGTTTGACTTTGG + Intergenic
1086268358 11:85028798-85028820 GTGGCTGCACAGTTGCACCCAGG + Intronic
1088750273 11:112837007-112837029 AAGGCTGCAGACTTGGACTCAGG + Intergenic
1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1091450446 12:569411-569433 CAGGGGGCACAGTTGAACCTGGG - Intronic
1092731640 12:11540352-11540374 AAGGCTGCAGGGTTGGCCCCGGG - Intergenic
1097682062 12:62658266-62658288 AAGCCTGCACAGTTTTGCCTGGG + Intronic
1102295523 12:111733669-111733691 AAGGCTGCAGAGAAGGAGCTGGG + Intronic
1102741788 12:115213886-115213908 AAGTCTGCAGATGTGGACCTGGG + Intergenic
1104951939 12:132445092-132445114 AAGGCTGCAGAGTAGGAACTAGG - Intergenic
1105081580 13:16126618-16126640 AAGGGCTCAGAGTTGGACCTTGG - Intergenic
1113782408 13:112984141-112984163 AGGGCAGCACAGGTGGACCCTGG - Intronic
1113891060 13:113735858-113735880 GAGCCTGCACAGAGGGACCTGGG - Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1115328657 14:32169826-32169848 AAGGCTGCACAGTAAGATGTTGG + Intergenic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1117761415 14:59032734-59032756 AAGGAAGAACAGTTGGAGCTGGG - Intergenic
1120881134 14:89416480-89416502 AAGTCTGCACAGTTTGGCCGGGG + Intronic
1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG + Intergenic
1121320166 14:92987482-92987504 ATGGCTGCACAGGTGGCCCCTGG + Intronic
1121438938 14:93936725-93936747 GAGGCTGCACAGTCCCACCTGGG + Intronic
1122266307 14:100548520-100548542 AAGGCTGCTCAGTGAGGCCTGGG - Intronic
1125336397 15:38630691-38630713 AAAGCTGCACTGTTGGCCCTTGG - Intergenic
1129175915 15:73839614-73839636 AAGGCTGCACAGGTGGAGGTGGG + Intergenic
1129945605 15:79536955-79536977 CAGGCTGCTCAGATGGTCCTGGG + Intergenic
1130743640 15:86627444-86627466 AAGTCTTCACATTTGTACCTTGG - Intronic
1132449510 15:101958822-101958844 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
1138670962 16:58614262-58614284 AGGCTTGCACAGTTGGCCCTTGG + Intronic
1139914757 16:70421167-70421189 AAGACTGCTCAGCTGGAGCTCGG - Intronic
1140795455 16:78433604-78433626 AGGCCTTCACAGTTGGACCTAGG + Intronic
1141998090 16:87647774-87647796 ACGGCTGCACAGGTGCGCCTAGG + Intronic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1143758896 17:9087095-9087117 AAGGTTACACAGTTTGACCAAGG + Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1146668562 17:34721235-34721257 AGGGCTGCATAGTTACACCTTGG + Intergenic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1157393985 18:47326641-47326663 AGGGCTGCACAGCTTGGCCTTGG + Intergenic
1157486431 18:48090628-48090650 AAGGCTGGACAGATAGGCCTGGG - Intronic
1160635745 19:73728-73750 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1161009559 19:1953745-1953767 AAGGCTGCACAATGGCAGCTGGG - Intronic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1163040289 19:14597052-14597074 GAGGGTGCACAGGAGGACCTGGG + Intronic
1163950637 19:20581552-20581574 AGGGTTACACAGTTGAACCTGGG + Intronic
1163967434 19:20760499-20760521 AGGGTTACACAGTTGAACCTGGG - Intronic
1166309682 19:41955977-41955999 CTGGGTGCACAGTTGGTCCTTGG + Intergenic
1166827909 19:45620983-45621005 GAGGCAGCACAGTTGGAGCAGGG + Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934493583 2:94779138-94779160 ATGCCTGGACAGTTGTACCTTGG - Intergenic
934582850 2:95459687-95459709 AAAGCTGAGCAGTTGGACCTGGG + Intergenic
934596600 2:95617027-95617049 AAAGCTGAGCAGTTGGACCTGGG - Intergenic
934786168 2:97008536-97008558 AAAGCTGAGCAGTTGGACCTTGG + Intronic
935686976 2:105692619-105692641 GAGGCTGCTCTGTTGGACTTGGG + Intergenic
936506288 2:113110240-113110262 AAGGCTTCAGAGTAGGACCTGGG - Intronic
936565730 2:113581322-113581344 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
937079362 2:119129326-119129348 AAGGATGCACTGTTGGATCTAGG - Intergenic
937930536 2:127201624-127201646 AAGGCTGCAGAGGAGGACCCTGG + Intronic
942310295 2:174650159-174650181 AAGGGGGCACAGCTGTACCTGGG - Intronic
942378548 2:175362311-175362333 AAGGCTATAAAGTTAGACCTAGG + Intergenic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
1172358592 20:34296645-34296667 AAGTCTGCAAACTTTGACCTAGG - Intronic
1173162545 20:40663459-40663481 AAGGTGACACAGTTGGACCCAGG - Intergenic
1173503665 20:43570866-43570888 AAGGCTGGGCACTTGGACCTCGG - Intronic
1173556284 20:43968341-43968363 AAGGTGGCACAGATGGACCTGGG + Intronic
1173718784 20:45235508-45235530 AAGGCTGTCCAGCTGGACTTGGG + Intergenic
1174157746 20:48527772-48527794 AAGGCTGCAGAGGTGGACCCAGG + Intergenic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183174644 22:36213844-36213866 AAGTGTGCAAAGGTGGACCTGGG + Intergenic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1183411130 22:37655553-37655575 AACCCTGCACAGGTGGACCTGGG + Exonic
1183700429 22:39448132-39448154 CAGGCTGTCCAGCTGGACCTGGG - Intergenic
1183929419 22:41227583-41227605 AGGGCTGCTCAGAGGGACCTGGG - Intronic
1185221307 22:49630404-49630426 ATGGCTGCACCCTTGGCCCTTGG + Intronic
1185341107 22:50291540-50291562 AAGGCCCCACAGGTGGACCCAGG + Intronic
949517134 3:4818038-4818060 AAGGCTGCTCAGCTGGGGCTGGG + Intronic
950329818 3:12147398-12147420 AAGGCTGAACAAGTGGAGCTTGG - Intronic
950469640 3:13176581-13176603 AGGGCTGCACCCTGGGACCTGGG - Intergenic
952956872 3:38563062-38563084 AATGCTGCACAGTCTGGCCTTGG - Intronic
953538607 3:43794726-43794748 AAGGCCTTACAGTTGCACCTGGG + Intergenic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
954593998 3:51809904-51809926 AAGGCTAGACACTTGGACTTTGG - Intergenic
958176924 3:90007800-90007822 AAGGCTGCACAGGAGGCTCTGGG + Intergenic
963162138 3:142161730-142161752 AAGGCTGCAGAGGTGGGGCTGGG + Intergenic
963272371 3:143298523-143298545 AAGGCTGCTCAGTAGGGCATTGG + Intronic
967383684 3:188888681-188888703 AAGGCTGCACAGTACGACTCTGG - Exonic
968984059 4:3865901-3865923 AAAGCTGGACAGGTGGACATGGG + Intergenic
971153012 4:24053622-24053644 AAGGCTTCACAGTCAGACATAGG + Intergenic
971940666 4:33211248-33211270 AATGCTGAACAGTTGGCCATAGG - Intergenic
977202068 4:94129043-94129065 AAGCCTGCACATTAGGATCTTGG + Intergenic
980218102 4:129877564-129877586 GAGACTGCACAGTTGGAACCTGG + Intergenic
982089426 4:151867558-151867580 AATGTTGCACAGATGGAGCTGGG + Intergenic
983907993 4:173205279-173205301 AAGTCTGCAGGGTTGGTCCTGGG + Intronic
985064169 4:186105080-186105102 AAGGCTGCTGTGCTGGACCTTGG + Intronic
987683463 5:21166463-21166485 AAGAGTGCACAAATGGACCTAGG - Intergenic
988655831 5:33210457-33210479 AAGGATGCAAAGTTGCTCCTGGG - Intergenic
990295825 5:54400478-54400500 CAGGCTGTGGAGTTGGACCTGGG + Intergenic
999385389 5:151150666-151150688 AGAGCTGCACAGTTGTACCAAGG - Intronic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1001580058 5:172792094-172792116 AAGGCCCCACAGTTGGTCCCTGG - Intergenic
1004595232 6:17093445-17093467 CAGGGTACACAGTTGGCCCTTGG - Intergenic
1007677998 6:43614081-43614103 AATGCTTTACAGTTGGACCATGG - Exonic
1018698463 6:166408602-166408624 CAGTCTGCACTGTTGGTCCTTGG - Intergenic
1019800457 7:3084512-3084534 AAAGCTCCACCCTTGGACCTGGG + Intergenic
1023045998 7:36210651-36210673 AAGGCAGGACAGCTGGAGCTGGG - Intronic
1024465547 7:49708642-49708664 AAGTCTACACAATTGGACCTGGG + Intergenic
1029933987 7:104403275-104403297 AAGGGTTGACCGTTGGACCTGGG + Intronic
1031452687 7:121941261-121941283 AAGACTGGAAACTTGGACCTGGG + Intronic
1032472138 7:132186238-132186260 GGGGCTGCACAGTAGGACCAGGG + Intronic
1032955308 7:136963727-136963749 AATGCTCCACAGTGGGACCTGGG - Intronic
1033231243 7:139599853-139599875 CAGAGTGCACAGTTAGACCTAGG - Intronic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1037969979 8:23164831-23164853 AAGGTCAGACAGTTGGACCTGGG - Intergenic
1042042266 8:64605080-64605102 AAGGCAGCAGTGTTGTACCTGGG + Intronic
1048865007 8:138753970-138753992 GAGGCTGCACAGTCAGATCTAGG + Intronic
1049184931 8:141245233-141245255 AAGGCTACACACTTGGAACATGG + Intronic
1049412298 8:142478680-142478702 CAGGGTGCACAGTGGGACTTGGG + Intronic
1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1051684405 9:19642246-19642268 GGGTCTGCACAGCTGGACCTGGG + Intronic
1055681614 9:78721499-78721521 AAGGTAGCACACTGGGACCTGGG - Intergenic
1057054047 9:91948570-91948592 AAGGCTGCACAGTCTTTCCTGGG - Intronic
1058318444 9:103599120-103599142 ATGGCTTGACAGTGGGACCTTGG + Intergenic
1061549586 9:131325657-131325679 TTGGCTGCAGAGTTGGAGCTGGG + Intergenic
1062575359 9:137204601-137204623 AAGGCTGCAAAGCTGGACTCAGG - Exonic
1190815006 X:53922133-53922155 AAGGCGGCACAACTGGACCAGGG - Intergenic
1193587780 X:83347396-83347418 AAGGCTGGACAGTTTTTCCTAGG + Intergenic
1193823339 X:86193447-86193469 AATGCAGCCCAGTTTGACCTGGG - Intronic
1199089292 X:143672162-143672184 AAGGCTGCACATTTCGACCATGG - Intergenic
1200089069 X:153625947-153625969 GTGGCTCCACAGTTGGCCCTGGG - Intergenic
1200324990 X:155228295-155228317 GAGATTGCACAGTTGAACCTAGG - Intronic