ID: 1182159723

View in Genome Browser
Species Human (GRCh38)
Location 22:28109384-28109406
Sequence AGTAAGTATGTCCATACACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182159722_1182159723 -4 Left 1182159722 22:28109365-28109387 CCGTGACAATAACTAGGAAAGTA 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1182159723 22:28109384-28109406 AGTAAGTATGTCCATACACACGG 0: 1
1: 0
2: 1
3: 17
4: 134
1182159721_1182159723 -3 Left 1182159721 22:28109364-28109386 CCCGTGACAATAACTAGGAAAGT 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1182159723 22:28109384-28109406 AGTAAGTATGTCCATACACACGG 0: 1
1: 0
2: 1
3: 17
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182159723 Original CRISPR AGTAAGTATGTCCATACACA CGG Intronic
905546671 1:38805205-38805227 AGCAAGTTTGTGCACACACATGG - Intergenic
907438101 1:54462332-54462354 TGTAAGTGTGTCCATAAACCTGG + Intergenic
911907322 1:103587247-103587269 ATTAATTATGTACATACACATGG - Intergenic
915010764 1:152684172-152684194 AGCATGTATGTCCAAACATAGGG - Intergenic
915682011 1:157590471-157590493 TTTAATTATGTACATACACAGGG - Intronic
916691203 1:167191655-167191677 AGCAAATATGTACATACATAGGG - Intergenic
919369990 1:196711143-196711165 AGTAAATATGTATATAAACAAGG - Intronic
919382611 1:196877506-196877528 AGTAAATATGTATATAAACAAGG - Intronic
920257599 1:204666153-204666175 AGTAAATATGACCACATACAGGG - Intronic
921786289 1:219233900-219233922 TCTAAGTATGACCATACATAGGG + Intergenic
921949404 1:220914237-220914259 AGTAACTTTGCCCAGACACAGGG + Intergenic
923111231 1:230891997-230892019 AGCAAGTATGTCCATTTGCAAGG + Intergenic
1063837040 10:10027367-10027389 AGTAAGATTGTACATACACACGG + Intergenic
1068546912 10:58357706-58357728 AGGACGTATTTCCAGACACATGG + Intronic
1073235698 10:102013931-102013953 AATAAGTAAGACAATACACAAGG + Intronic
1075162218 10:120034294-120034316 TTTAATTATGTGCATACACATGG + Intergenic
1075433549 10:122412494-122412516 AGTAAGTGTGCCAATAAACAGGG + Intronic
1075538622 10:123293842-123293864 AGTAGGCAAGTCCATGCACAGGG + Intergenic
1078351270 11:10595886-10595908 AGTACATATGGCCATAAACAAGG - Intronic
1078578664 11:12522112-12522134 GGTACGTATGTCCATACACCAGG + Intronic
1079587560 11:22144780-22144802 AGTAAGTATACCCATACACCTGG - Intergenic
1079751364 11:24202998-24203020 AGAAAGTATTTCCACCCACAGGG + Intergenic
1080030245 11:27652808-27652830 AGAAGGAATGTCCATAAACATGG + Intergenic
1081329402 11:41785941-41785963 AGTAAGTTTGTGCAATCACAGGG - Intergenic
1088729073 11:112664802-112664824 AATTACTATGTCCAGACACATGG - Intergenic
1088816845 11:113427171-113427193 AGGTAGTATGGCCATAGACAGGG - Intronic
1092899113 12:13041916-13041938 TGTAAGTGTGTACATGCACATGG + Intergenic
1095625338 12:44307743-44307765 GGTGAGTTTGTCCATACAGAAGG + Intronic
1098727928 12:73993017-73993039 AGTAGGTAAGTCCATAAAAAGGG + Intergenic
1100842308 12:98625227-98625249 AGTAAGTATGTTCTTACATAAGG - Exonic
1101317048 12:103638860-103638882 AGGAAATGTGTCCATACAGAAGG + Intronic
1108781766 13:53845026-53845048 AGTATGTATTTTTATACACAGGG + Intergenic
1109358305 13:61262561-61262583 AGCAAATATGTCCAGACAAAAGG + Intergenic
1110460059 13:75735140-75735162 TGTATGTATGTACATACACATGG + Intronic
1113560267 13:111273079-111273101 TGTTTCTATGTCCATACACAGGG + Intronic
1115796755 14:36945494-36945516 ATAAAGTATATCCATACAAATGG + Intronic
1115870254 14:37792827-37792849 AGTAAGTAGGTTCATACAATGGG + Intronic
1120269199 14:82289436-82289458 AGTAAGTATATCTATAATCAGGG + Intergenic
1121913305 14:97812479-97812501 AGAAACTATGGCCATGCACATGG - Intergenic
1122753728 14:103960237-103960259 GGTAAGTATGTCAGTTCACATGG - Intronic
1123474223 15:20577665-20577687 ATTAAGGATGTCCATACAAAAGG - Intergenic
1123643788 15:22422688-22422710 ATTAAGGATGTCCATACAAAAGG + Intergenic
1123734524 15:23172677-23172699 ATTAAGGATGTCCATACAAAAGG - Intergenic
1124285031 15:28393985-28394007 ATTAAGGATGTCCATACAAAAGG - Intergenic
1124297666 15:28517629-28517651 ATTAAGGATGTCCATACAAAAGG + Intergenic
1124318899 15:28696722-28696744 ATTAAGGATGGCCATACAAAAGG + Intergenic
1131638700 15:94265471-94265493 AGTAAGTAAGTGCATACACATGG - Intronic
1137519351 16:49178894-49178916 AGTAAGCAGGTCCTTACACTGGG + Intergenic
1138625531 16:58248707-58248729 ACTTAATATGTCCATATACAAGG - Intronic
1142826481 17:2515007-2515029 AGAACCTATGTCCATCCACAGGG - Intergenic
1147758131 17:42781528-42781550 AGTGAGAATGTTCATACCCATGG - Intronic
1150953424 17:69827518-69827540 AGTAAATATGTGCATATTCAGGG + Intergenic
1153986121 18:10352396-10352418 AATAATTATGAGCATACACATGG - Intergenic
1156416156 18:36893223-36893245 AGAAAGTAAGTTCATACATACGG - Intronic
1156965632 18:43087987-43088009 TGTAATTGTGTCCATACACTAGG - Intronic
1158264701 18:55649259-55649281 AGAAAGACTGTGCATACACACGG - Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1160070068 18:75620829-75620851 AGCAAGAATCTCCATCCACATGG - Intergenic
925622636 2:5808666-5808688 AGTAAGTATGAGAAGACACAGGG + Intergenic
925833987 2:7924894-7924916 AGTAAATATATACATATACATGG - Intergenic
926528645 2:14013346-14013368 AGTAACAATGTCCAAAGACATGG - Intergenic
928919219 2:36509013-36509035 TGTAAGTATATCCAAATACAGGG + Intronic
930513195 2:52372352-52372374 AGTAATTTATTCCATACACAAGG + Intergenic
930739269 2:54813335-54813357 CTTAAAGATGTCCATACACATGG + Exonic
931670800 2:64644968-64644990 AGTAAGGATGCCCAAAGACAAGG + Intronic
934311723 2:91873161-91873183 AGTAAGTATGTACTGACACATGG + Intergenic
936145074 2:109975486-109975508 AGTAAGGCTATCCATGCACAAGG + Intergenic
936181762 2:110273448-110273470 AGTAAGGCTATCCATGCACAAGG + Intergenic
936199610 2:110395981-110396003 AGTAAGGCTATCCATGCACAAGG - Intergenic
936230804 2:110698231-110698253 AGTAAGGCTATCCATGCACAAGG - Intergenic
937706072 2:124922264-124922286 AATAGGTATATCCACACACACGG + Intergenic
941496668 2:166213786-166213808 AGTAAACATCTACATACACATGG + Intronic
942445754 2:176077195-176077217 AGTGTGTGTGTCGATACACATGG - Intergenic
942960509 2:181824886-181824908 AGGATGTATGTCCATATACCTGG - Intergenic
943201253 2:184827795-184827817 AATAAGTATATCCATTCACCTGG + Intronic
944902210 2:204226964-204226986 AGAAAGTATTTCCAAATACAGGG - Intergenic
945740445 2:213654226-213654248 ACTCAGTATGTCAATACAAAGGG + Intronic
946535599 2:220624628-220624650 AGTCTGAATGTCCACACACATGG - Intergenic
949040378 2:241845438-241845460 TGTGTGTATGTACATACACAGGG - Intergenic
1168732378 20:96530-96552 AGCAATTATGTCCATCCCCATGG - Exonic
1169177618 20:3532290-3532312 AGGAAGTGTGTACACACACACGG + Intronic
1173429791 20:42976823-42976845 AGTTTATATGTCCATAAACATGG + Intronic
1173659500 20:44723517-44723539 AGTAGGTCTGTACACACACAGGG - Intronic
1174822322 20:53737441-53737463 AGTAATTAACTCCATACAGAGGG + Intergenic
1179404052 21:41110903-41110925 AGGAAGTCTGTCCAGACAAATGG + Intergenic
1181613345 22:24034465-24034487 ATGAAGTATGTCCATATAAAGGG - Intronic
1182159723 22:28109384-28109406 AGTAAGTATGTCCATACACACGG + Intronic
1184025594 22:41853597-41853619 GGTAAGTATGTAAATACAGAAGG - Intronic
951828163 3:26892184-26892206 ACTATGTATGTCAATGCACAAGG + Intergenic
952585564 3:34887945-34887967 AGCACGTATTTCCAAACACAGGG - Intergenic
952950444 3:38520127-38520149 AGTATGTATGACCTTACAAATGG + Intronic
953301622 3:41782777-41782799 ACTAAGGATGTCCATACAAAAGG + Intronic
953557041 3:43954064-43954086 ACTAAGCATGGCCCTACACAGGG + Intergenic
955488070 3:59454776-59454798 AGGATGTATGTGCATACAGAGGG - Intergenic
957197486 3:77088570-77088592 AATAAATATGTCCACACACTGGG - Intronic
957875014 3:86133406-86133428 AGGAAGTATGTCCACACACTGGG + Intergenic
958725269 3:97897673-97897695 TGTAAGTATGTCCAAAAAAATGG - Intronic
969286372 4:6204948-6204970 GGAAAGTATTTCCAAACACAAGG + Intergenic
970064612 4:12078057-12078079 AGTAAATATGTCCATAAATAAGG + Intergenic
971100302 4:23459106-23459128 AGCAAGTAAGACCATACCCAAGG - Intergenic
971669949 4:29543366-29543388 AGTAAGAATGTAAATACAAATGG + Intergenic
971723312 4:30274945-30274967 AGTAAATATGGCCATATAGAAGG - Intergenic
972391799 4:38620812-38620834 AGTAAGTATGATTATATACAAGG + Intergenic
974425361 4:61736188-61736210 TGTATGTATGTACATACATATGG + Intronic
975509581 4:75179005-75179027 AATAAGTATGTATATACACTGGG - Intergenic
976042553 4:80905349-80905371 AGTGAGTTTGACCATAAACATGG + Intronic
978013521 4:103716908-103716930 AGTCAGTAAGTCCATGCAGAAGG + Intronic
979263640 4:118676153-118676175 GATAAGTATTGCCATACACAAGG + Intergenic
979892112 4:126111153-126111175 TGTATGTATGTGCATATACAAGG - Intergenic
980174247 4:129325549-129325571 AGAAAGAATTTCCATTCACATGG + Intergenic
983474886 4:168201848-168201870 AAAAAGTATGTCAATAGACATGG + Intergenic
986883835 5:12209482-12209504 ATTAAGTACATCCATACAAAGGG - Intergenic
988632117 5:32942682-32942704 AGAAGGCACGTCCATACACAAGG + Intergenic
991464428 5:66895053-66895075 AGAAAGTATGACCACACCCAGGG - Intronic
993191212 5:84684282-84684304 AGGACATATATCCATACACATGG + Intergenic
993391500 5:87323895-87323917 AGTAAGTAGGAGGATACACAGGG - Intronic
995654855 5:114414293-114414315 AGTAAGCAAGTCCATTAACATGG - Intronic
996742846 5:126817466-126817488 TATAAATATGTGCATACACATGG - Intronic
997213640 5:132093356-132093378 AGTAGGTGTGACCTTACACAAGG + Intergenic
999880707 5:155860711-155860733 AGTAAGCATACCCAAACACAGGG - Intergenic
1000390920 5:160722536-160722558 AGCAAGCATGTCAAAACACAGGG + Intronic
1008904700 6:56663440-56663462 TGTATGTGTGTGCATACACATGG - Intronic
1010185550 6:73139485-73139507 AGTCAGCATGTCCTTAAACATGG + Intronic
1012501663 6:99895374-99895396 TTTAAGTGTGTACATACACAAGG - Intergenic
1018347164 6:162912107-162912129 ACTGAGTATGTCCAGCCACAAGG + Intronic
1019154580 6:170030560-170030582 AGTACATATGCCCACACACACGG + Intergenic
1020153286 7:5700748-5700770 AGTAGGTGTGTCCTTCCACAAGG + Intronic
1025617267 7:63131557-63131579 AGTAAGTATACAGATACACATGG + Intergenic
1028682162 7:93548021-93548043 AGAAAGTATTTCCATAGACAGGG - Intronic
1029898382 7:104011310-104011332 AGAAAGTATTTGCATATACAAGG + Intergenic
1032921330 7:136551156-136551178 TGGAAGTATATCAATACACAGGG + Intergenic
1036982783 8:13489287-13489309 AGAAAGTATGTCAACCCACATGG - Intronic
1037406525 8:18548508-18548530 AGTAGATATGTCCATAGAAAAGG - Intronic
1041148042 8:54899445-54899467 AGTGAGTACATCCAGACACAGGG + Intergenic
1042409366 8:68445055-68445077 AGGAAGTATTTCCATAGATAAGG - Intronic
1044009100 8:86969613-86969635 ATTTATTATGTGCATACACATGG + Intronic
1045315208 8:101038040-101038062 AGTAAGTAAATCCATAGACATGG - Intergenic
1045988215 8:108275132-108275154 AGAAATGATGTCCAGACACAGGG + Intronic
1050520312 9:6490681-6490703 AGTAAGTATATTCAAAAACATGG - Intronic
1051609987 9:18951632-18951654 AGAAAATATGTGCACACACAGGG - Intronic
1051742896 9:20268409-20268431 AGTAAATTAGTCCATTCACAAGG - Intergenic
1055198870 9:73631809-73631831 AGTATGAATGGCCATGCACAGGG + Intergenic
1062418188 9:136464310-136464332 AGGACGTATGTCCAGAGACAAGG + Intronic
1187380300 X:18795416-18795438 ACTGAGTATGTCTATAAACATGG + Intronic
1192277731 X:69650367-69650389 AGTAAATATGTACTTACAAAGGG + Intronic
1193580798 X:83260276-83260298 AGTCAGTTTTTCCATGCACAGGG + Intergenic
1193815931 X:86104642-86104664 AGTAAGTATGCAGATAAACATGG + Intergenic
1193903819 X:87218171-87218193 TTTAATTATGTTCATACACATGG + Intergenic
1194442729 X:93953097-93953119 AGGAAGTTTCACCATACACAAGG - Intergenic
1194993090 X:100566109-100566131 AGTATGTATATCCATACAAGGGG + Intergenic
1196234889 X:113267778-113267800 TGTAAATATGTGTATACACAGGG - Intergenic
1196368053 X:114945131-114945153 AGTAAAAATCTCTATACACATGG - Intergenic
1196744975 X:119063502-119063524 AGCAAGTATGTTCATTAACAGGG - Intergenic