ID: 1182160375

View in Genome Browser
Species Human (GRCh38)
Location 22:28115522-28115544
Sequence CTCTAGATACAGATTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 631
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 618}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182160375 Original CRISPR CTCTAGATACAGATTTAGCC AGG (reversed) Intronic
900667304 1:3824245-3824267 CTAAAAATACAGAATTAGCCAGG - Intronic
901571862 1:10167276-10167298 CTAAAAATACAGAATTAGCCGGG + Intronic
901578334 1:10219297-10219319 CTAAAAATACAAATTTAGCCGGG + Intronic
902192055 1:14770635-14770657 CTGGAGAAACAAATTTAGCCTGG + Intronic
903086416 1:20863603-20863625 CTAAAAATACAGAATTAGCCAGG - Intronic
903240453 1:21979231-21979253 CTAAAAATACAGAATTAGCCGGG - Intronic
904053047 1:27651994-27652016 CTAAAAATACAAATTTAGCCAGG - Intergenic
904080206 1:27867726-27867748 CTAAAAATACAGAATTAGCCAGG + Intergenic
904234613 1:29107020-29107042 CTAAAAATACAGAATTAGCCAGG + Intronic
904543934 1:31253677-31253699 CTAAAAATACAGAATTAGCCAGG - Intergenic
904654085 1:32029494-32029516 CTAAAGATACAAAATTAGCCGGG + Intronic
905641544 1:39593329-39593351 CTCAAAATACAAAATTAGCCAGG - Intergenic
906261375 1:44393857-44393879 CTAAAGATACAAAATTAGCCAGG + Intergenic
906324760 1:44838400-44838422 CTCCAAATACAAAATTAGCCAGG - Intronic
906393730 1:45442095-45442117 CTAAAAATACAGAATTAGCCAGG - Intronic
907454799 1:54568523-54568545 CTAAAGATACAAAATTAGCCAGG - Intronic
908096486 1:60744490-60744512 CTAAAGATACAAAATTAGCCAGG - Intergenic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
908750512 1:67418134-67418156 CTAAAGATACAAAATTAGCCTGG - Intronic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
909400375 1:75222115-75222137 CTAAAGATACAAAATTAGCCGGG - Intronic
909636089 1:77818771-77818793 CTCTAGATAAAAAATTAGCAGGG + Intronic
909753577 1:79194687-79194709 CTAAAAATACAAATTTAGCCGGG + Intergenic
910521173 1:88124049-88124071 CTAAAAATACAGAATTAGCCGGG - Intergenic
910578453 1:88794204-88794226 CTAAAAATACAGAATTAGCCAGG + Intronic
911206726 1:95098898-95098920 CTCTAAATACAAAATTAGCCGGG + Intergenic
912843755 1:113061678-113061700 CTCAAAATACAAAATTAGCCAGG - Intergenic
912939026 1:114028860-114028882 CTAAAAATACAAATTTAGCCAGG - Intergenic
913271438 1:117097566-117097588 CTATAGATACAGATCTAAGCAGG + Intronic
914699647 1:150119945-150119967 CTAAAAATACAGAATTAGCCAGG + Intronic
914719183 1:150275197-150275219 CTAAAGATACAAAATTAGCCGGG - Intronic
914749101 1:150520960-150520982 CTAAAAATACAGAATTAGCCAGG - Intergenic
914822600 1:151116228-151116250 CTAAAAATACAGAATTAGCCGGG + Intronic
914922478 1:151856784-151856806 CTAAAAATACAGAATTAGCCGGG + Intergenic
915209065 1:154293105-154293127 CTAAAAATACAGAATTAGCCAGG + Intergenic
915374100 1:155377066-155377088 CTAAAAATACAGAATTAGCCGGG - Intronic
915966254 1:160311275-160311297 CTCAAAATACAAAATTAGCCAGG + Intronic
916340849 1:163732416-163732438 CTAAAGATACAAAATTAGCCAGG - Intergenic
917830528 1:178879629-178879651 CTAAAAATACAGAATTAGCCGGG + Intronic
919146492 1:193642561-193642583 CTCTAAACACTGCTTTAGCCTGG + Intergenic
919269333 1:195318765-195318787 CTCTAAATACAAAATTAGCTGGG - Intergenic
919684000 1:200464700-200464722 AAATAGCTACAGATTTAGCCAGG + Intergenic
920137395 1:203781029-203781051 CTACAAATACAGAATTAGCCGGG + Intergenic
920141641 1:203819693-203819715 CTAAAAATACAGAATTAGCCAGG - Intronic
920348565 1:205322430-205322452 CTAAAGATACAAAATTAGCCGGG + Intergenic
921119037 1:212120660-212120682 CTAAAAATACAGAATTAGCCAGG + Intergenic
921641820 1:217563881-217563903 CTCAAAATACAAAATTAGCCAGG + Intronic
922138792 1:222860213-222860235 CTAAAGATACAAAATTAGCCGGG - Intergenic
922247044 1:223809985-223810007 CTAAAAATACAGAATTAGCCGGG - Intronic
922611547 1:226933133-226933155 CTAAAAATACAAATTTAGCCAGG - Intronic
922649758 1:227327600-227327622 CTAAAAATACAGAATTAGCCAGG + Intergenic
922679579 1:227580767-227580789 CTAAAAATACAGAATTAGCCAGG + Intronic
923159467 1:231304212-231304234 CTAAAGATACAAAATTAGCCAGG - Intergenic
923568065 1:235091504-235091526 CTCTAGAGAGAGATGTGGCCAGG + Intergenic
924471953 1:244350477-244350499 CTAAAAATACAGAATTAGCCGGG - Intergenic
924514703 1:244756245-244756267 CTAAAGATACAAAATTAGCCAGG - Intergenic
924535161 1:244929254-244929276 CTCTAAATACAGATCAGGCCAGG - Intergenic
924939142 1:248799598-248799620 CTAAAAATACAGAATTAGCCGGG + Intergenic
1064996779 10:21303052-21303074 CTAAAGATACAAAATTAGCCAGG + Intergenic
1065013870 10:21443669-21443691 CTCAAAATACAAAATTAGCCAGG + Intergenic
1065124156 10:22557114-22557136 CTCTAAGGACAGATTTGGCCAGG + Intronic
1065619069 10:27560451-27560473 CTAAAGATACAAAATTAGCCGGG + Intergenic
1065884077 10:30061379-30061401 CTAAAAATACAGAATTAGCCGGG + Intronic
1066125043 10:32333177-32333199 CTAAAAATACAAATTTAGCCGGG + Intronic
1067072967 10:43149904-43149926 CTAAAAATACAGAATTAGCCAGG + Intronic
1067608752 10:47690867-47690889 CTCTAGATAGAGCTTCAGACTGG - Intergenic
1069016320 10:63433255-63433277 CTAAAAATACAGAATTAGCCGGG - Intronic
1069036895 10:63655032-63655054 CTAAAAATACAGAATTAGCCAGG + Intergenic
1070822576 10:79369776-79369798 CTATAAATACAAAATTAGCCAGG - Intergenic
1070841232 10:79489374-79489396 CTCTGGGAACAGATTGAGCCAGG - Intergenic
1071280619 10:84099370-84099392 CTAAAGATACACAATTAGCCAGG + Intergenic
1071313021 10:84361799-84361821 CTCAAAATACAAAATTAGCCAGG - Intronic
1071530070 10:86383222-86383244 CTAAAAATACAGAATTAGCCGGG - Intergenic
1071624336 10:87152515-87152537 CTCTAGATAGAGCTTCAGACTGG - Exonic
1072136859 10:92555334-92555356 CTAAAAATACAGAATTAGCCAGG + Intronic
1072448522 10:95520151-95520173 CTCTACATACAAAATTAGCCAGG + Intronic
1072523539 10:96251825-96251847 CTCGAGATTCAGACTTACCCAGG - Intronic
1073283533 10:102372352-102372374 CTAAAAATACAGAATTAGCCAGG + Intronic
1073866432 10:107809581-107809603 CTCTACATAAACAATTAGCCAGG + Intergenic
1074096159 10:110314845-110314867 CTAAAAATACAAATTTAGCCGGG - Intergenic
1074219080 10:111418670-111418692 TTATAGATACTGATTTAGCTTGG - Intergenic
1074595429 10:114860511-114860533 CTCAAAATACAAAATTAGCCCGG - Intronic
1074995841 10:118756133-118756155 CTCTAAAAACAAAATTAGCCTGG + Intergenic
1075288513 10:121208300-121208322 CTAAAAATACAAATTTAGCCAGG + Intergenic
1075953895 10:126505791-126505813 CTAAAAATACAGAATTAGCCAGG + Intronic
1076635423 10:131879159-131879181 CTAAAAATACAGAATTAGCCGGG + Intergenic
1077421664 11:2453210-2453232 CTAAAAATACAGAATTAGCCGGG + Intronic
1077813629 11:5664038-5664060 CTGAAAATACAAATTTAGCCAGG + Exonic
1078155806 11:8798986-8799008 CTCTAAATACAAAATTAGCCGGG - Intronic
1078225520 11:9388336-9388358 CTAAAAATACAGAATTAGCCAGG - Intronic
1079204941 11:18406553-18406575 CTAAAAATACAGAATTAGCCAGG + Intronic
1079892482 11:26074056-26074078 CTCTAGAGACAGATGTAACTTGG + Intergenic
1080470052 11:32536727-32536749 CTCTAGAAAAAAAATTAGCCAGG - Intergenic
1080506152 11:32916060-32916082 CTCAAAATACAAAATTAGCCGGG - Intronic
1080554563 11:33404361-33404383 CTAAAGATACAAAATTAGCCAGG + Intergenic
1082072772 11:47952303-47952325 CTCAAAATACAAAATTAGCCAGG - Intergenic
1082751980 11:57029124-57029146 CTAAAGATACAAAATTAGCCAGG + Intergenic
1083463260 11:62829261-62829283 CTCAAAATACAAAATTAGCCAGG + Intronic
1083838677 11:65290085-65290107 CTAAAAATACAGAATTAGCCAGG + Intronic
1084124594 11:67090804-67090826 CTCTACAAACAAAATTAGCCTGG + Intergenic
1084442807 11:69185106-69185128 ATATATATACAGAATTAGCCGGG - Intergenic
1084716260 11:70875993-70876015 CTAAAAATACAGAATTAGCCAGG + Intronic
1085115716 11:73929893-73929915 CTAAAAATACAGAATTAGCCGGG + Intergenic
1085604524 11:77885236-77885258 CTAAAGATACAAAATTAGCCGGG - Intronic
1085864289 11:80270397-80270419 CTCTAGAAATAGAATTAACCTGG - Intergenic
1086146664 11:83559890-83559912 CTCTACCTACAGATTTACCAAGG - Intronic
1086186368 11:84021906-84021928 CTAAAAATACAGAATTAGCCAGG - Intronic
1087643054 11:100775996-100776018 CTCAAAATACAAAATTAGCCAGG + Intronic
1088471293 11:110189920-110189942 CTAAAAATACAGAATTAGCCAGG + Intronic
1090361625 11:126176681-126176703 CTAAAAATACAGAATTAGCCGGG - Intergenic
1091510534 12:1119709-1119731 CTAAAAATACAGAATTAGCCAGG - Intronic
1092189127 12:6505225-6505247 CTAAAGATACAAAATTAGCCAGG - Intronic
1092457492 12:8657256-8657278 CTGTAAATACAAAATTAGCCTGG + Intronic
1092883904 12:12909166-12909188 CTCAAGGTACAGATGCAGCCTGG + Exonic
1092885315 12:12919591-12919613 CTAGAAATACAGAATTAGCCGGG - Intergenic
1092916294 12:13192491-13192513 CTAAAAATACAGAATTAGCCGGG + Intergenic
1094167318 12:27456052-27456074 CTAAAAATACAGAATTAGCCAGG + Intergenic
1094621962 12:32088444-32088466 CTAAAGATACAAAATTAGCCAGG + Intergenic
1094654603 12:32408327-32408349 CTAAAAATACAGAATTAGCCAGG - Intronic
1095957618 12:47815770-47815792 CTAAAAATACAAATTTAGCCAGG - Intronic
1096120011 12:49082544-49082566 CTAAAGATACAAAATTAGCCAGG - Intergenic
1096480922 12:51940483-51940505 CTATAAATACAAAATTAGCCAGG - Intergenic
1096725110 12:53555156-53555178 CTAAAAATACAGAATTAGCCGGG + Intronic
1096828684 12:54298344-54298366 CTATAAATACAAAATTAGCCGGG + Intronic
1096967407 12:55639199-55639221 CTGAAAATACAGAATTAGCCGGG - Intergenic
1097052054 12:56229571-56229593 CTAAAAATACAGAATTAGCCAGG + Exonic
1097063754 12:56304963-56304985 CTAAAAATACAGAATTAGCCGGG + Intronic
1097103829 12:56608728-56608750 CTATAAATACAAAATTAGCCAGG - Intronic
1097875791 12:64641901-64641923 CTAAAGATACAAAATTAGCCGGG - Intronic
1098341055 12:69451642-69451664 CTCAAAATACAAAATTAGCCGGG - Intergenic
1098846074 12:75537691-75537713 CTAAAAATACAGAATTAGCCAGG - Intergenic
1099515956 12:83597027-83597049 CTCTATATTCAGATTTAAACTGG - Intergenic
1099579929 12:84432821-84432843 CTCTAGTTACAGTAATAGCCTGG + Intergenic
1099922596 12:88977938-88977960 CTAAAAATACAGAATTAGCCAGG + Intergenic
1101364783 12:104061813-104061835 CTAAAAATACAGAATTAGCCAGG + Intronic
1101397134 12:104358309-104358331 CTAAAAATACAGAATTAGCCGGG - Intergenic
1101670958 12:106872505-106872527 CTGAAAATACAAATTTAGCCGGG + Intronic
1101882521 12:108635062-108635084 CTATAAATACAAAATTAGCCGGG - Intergenic
1101895756 12:108755249-108755271 CTAAAAATACAGAATTAGCCGGG + Intergenic
1102874029 12:116435827-116435849 CTATAAATACAAAATTAGCCAGG + Intergenic
1103387431 12:120544064-120544086 CTAAAAATACAGAATTAGCCAGG + Intronic
1103409427 12:120700222-120700244 CTCTAGATTCAGGTTTGGGCAGG + Exonic
1103612889 12:122134833-122134855 CTGAAGATACAAAATTAGCCAGG - Intronic
1103638743 12:122331173-122331195 CTAAAGATACAAAATTAGCCGGG - Intronic
1103693719 12:122797037-122797059 CTAAAAATACAAATTTAGCCGGG - Intronic
1103831926 12:123787097-123787119 ATATAGATACAGATATAGACAGG - Intronic
1104025691 12:125024636-125024658 CTAAAGATACAAAATTAGCCGGG + Intronic
1105041086 12:132962000-132962022 CTAAAAATACAAATTTAGCCAGG - Intergenic
1105601682 13:21893410-21893432 CTCAAAATACAAAATTAGCCGGG - Intergenic
1105731364 13:23220288-23220310 CTAAAAATACAGAATTAGCCGGG + Intronic
1106001117 13:25724291-25724313 CTCCAGAGAAAGATTCAGCCTGG + Intronic
1106795112 13:33197327-33197349 TTCTATAGACAGATTTAGGCAGG + Intronic
1107179790 13:37445756-37445778 CTAAAAATACAAATTTAGCCGGG + Intergenic
1107494567 13:40913308-40913330 CTAAAAATACAGAATTAGCCGGG + Intergenic
1109071672 13:57777321-57777343 CTCTAGATATAGATATAGAATGG - Intergenic
1109269411 13:60237610-60237632 CTAAAAATACAAATTTAGCCGGG + Intergenic
1109637827 13:65146172-65146194 CTATAAATACAAAATTAGCCGGG - Intergenic
1110224406 13:73104758-73104780 CTAAAAATACAGAATTAGCCGGG + Intergenic
1110454263 13:75672400-75672422 CTAAAAATACAAATTTAGCCAGG - Intronic
1110854891 13:80285621-80285643 CTAAAGATACAAAATTAGCCGGG + Intergenic
1110953078 13:81519683-81519705 CTAAAAATACAGAATTAGCCAGG + Intergenic
1111990055 13:95107628-95107650 CTGTAGATAAAGATATAGGCTGG + Intronic
1112121273 13:96414641-96414663 CTAAAAATACAGAATTAGCCAGG - Intronic
1113494728 13:110717664-110717686 CTGAAAATACAGAATTAGCCGGG + Intronic
1114181985 14:20375315-20375337 CTAAAGATACAAAATTAGCCAGG - Intronic
1114511445 14:23264980-23265002 CTAAAAATACAGAATTAGCCAGG - Intronic
1115226484 14:31108249-31108271 CTGAAAATACAGAATTAGCCAGG - Intronic
1115605801 14:35001310-35001332 CTAAAAATACAGAATTAGCCGGG - Intronic
1115615566 14:35091526-35091548 CTAAAAATACAGAATTAGCCAGG - Intronic
1117538697 14:56725852-56725874 CTAAAAATACAGAATTAGCCAGG + Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1117689634 14:58293396-58293418 CTAAAAATACAGAATTAGCCGGG - Intronic
1118283860 14:64453408-64453430 CTAAAAATACAGAATTAGCCGGG + Intronic
1118483461 14:66190005-66190027 CTCTATAAAAACATTTAGCCAGG - Intergenic
1118688849 14:68318683-68318705 CTCTAGCTACAGCTGCAGCCTGG - Intronic
1118848467 14:69566204-69566226 CTAAAAATACAAATTTAGCCAGG + Intergenic
1119238465 14:73039266-73039288 CTAAAGATACAAAATTAGCCGGG + Intergenic
1119254832 14:73186216-73186238 CTAAAAATACAGAATTAGCCAGG + Intronic
1119374338 14:74177157-74177179 CTAAAGATACAAAATTAGCCGGG - Intronic
1119489425 14:75017982-75018004 CTAAAAATACAGAATTAGCCGGG + Intronic
1119490073 14:75024360-75024382 CTAAAGATACAAAATTAGCCAGG - Intronic
1119613943 14:76086081-76086103 CTCCAGATACAGAACTAGACAGG + Intergenic
1120371989 14:83647395-83647417 TTTTAGATACATATTTAGTCAGG + Intergenic
1120726892 14:87953652-87953674 CTCTAGATAGAGCTTCAGACTGG - Intronic
1122472115 14:101976066-101976088 CTAAAAATACAGAATTAGCCAGG - Intronic
1123127997 14:105963268-105963290 CTAAAAATACAGAATTAGCCGGG + Intergenic
1123408510 15:20039411-20039433 CTAAAAATACAGAATTAGCCGGG + Intergenic
1123480621 15:20628227-20628249 CTCTGTATGCAGATTTAGCAAGG + Intergenic
1123517835 15:21046052-21046074 CTGAAAATACAGAATTAGCCGGG + Intergenic
1123637390 15:22372140-22372162 CTCTGTATGCAGATTTAGCAAGG - Intergenic
1125431481 15:39599084-39599106 CTAAAAATACAGAATTAGCCAGG - Exonic
1125962844 15:43846859-43846881 CTAAAGATACAAAATTAGCCGGG + Intronic
1126138664 15:45418046-45418068 CCCAAGAGAGAGATTTAGCCGGG + Intronic
1127426397 15:58863210-58863232 CTGAAAATACAGAATTAGCCAGG - Intergenic
1128137353 15:65273713-65273735 CTAAAGATACAAAATTAGCCGGG + Intronic
1128166371 15:65469134-65469156 CTCAAAATACAAAATTAGCCAGG - Intronic
1130425369 15:83792620-83792642 CTAAAGATACAAAATTAGCCAGG + Intronic
1130570504 15:85038958-85038980 CTAAAGATACAAAATTAGCCAGG + Intronic
1130656914 15:85798234-85798256 CTAAAAATACAGAATTAGCCAGG - Intergenic
1131364348 15:91825565-91825587 CTTTAGATTCTGATTTAGTCAGG + Intergenic
1131898284 15:97058571-97058593 CTAAAAATACAGAATTAGCCAGG - Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133969283 16:10555746-10555768 CTAAAAATACAGAATTAGCCAGG - Intronic
1134148260 16:11784995-11785017 CTAAAAATACAGAATTAGCCGGG + Intronic
1134151148 16:11805952-11805974 CTAAAAATACAAATTTAGCCAGG + Intergenic
1134229972 16:12421322-12421344 GTCCAGACAAAGATTTAGCCAGG + Intronic
1134318526 16:13141521-13141543 CTGAAAATACAAATTTAGCCAGG + Intronic
1135309663 16:21395661-21395683 CTAGAAATACAGAATTAGCCAGG - Intergenic
1135375796 16:21946153-21946175 CTAAAAATACAGAATTAGCCAGG + Intergenic
1135376039 16:21948203-21948225 CTAAAGATACAAAATTAGCCAGG - Intergenic
1135710218 16:24710062-24710084 CTCAAAATACAAAATTAGCCAGG + Intergenic
1135748851 16:25040155-25040177 CTAAAGATACAAAATTAGCCGGG + Intergenic
1136149239 16:28335974-28335996 CTAGAAATACAGAATTAGCCAGG - Intergenic
1136306407 16:29374785-29374807 CTAGAAATACAGAATTAGCCAGG - Intergenic
1137376706 16:47957995-47958017 CTAAAAATACAGAATTAGCCAGG + Intergenic
1137653713 16:50142182-50142204 CTAAAAATACAGAATTAGCCAGG - Intergenic
1137952667 16:52798352-52798374 CGCTGGATACAGTTTAAGCCTGG + Intergenic
1138001702 16:53287564-53287586 CTAAAGATACAGAATTAGCCAGG + Intronic
1138379165 16:56588623-56588645 CTAAAGATACAAAATTAGCCCGG - Intergenic
1139625315 16:68183844-68183866 CTAAAAATACAGAATTAGCCGGG + Intronic
1139813175 16:69640818-69640840 CTAAAAATACAGAATTAGCCGGG + Intronic
1139873331 16:70125213-70125235 CTAAAAATACAAATTTAGCCAGG + Intronic
1140103227 16:71936646-71936668 CTAAAAATACAAATTTAGCCGGG - Intronic
1140320192 16:73943201-73943223 CTAAAAATACAGAATTAGCCGGG - Intergenic
1140362452 16:74356091-74356113 CTAAAAATACAAATTTAGCCAGG - Intergenic
1142320588 16:89380271-89380293 CTAAAAATACAGAATTAGCCAGG - Intronic
1142463035 17:108752-108774 CTGAAAATACAGAATTAGCCAGG - Intergenic
1142832829 17:2562058-2562080 CTAAAGATACAAACTTAGCCAGG + Intergenic
1143212933 17:5202905-5202927 CTAAAAATACAGAATTAGCCAGG - Intergenic
1144496274 17:15747613-15747635 CTGAAGATACAAAATTAGCCAGG + Intronic
1145044985 17:19606636-19606658 CTAAAAATACAGAATTAGCCGGG - Intergenic
1145219283 17:21075093-21075115 CTAAAAATACAGAATTAGCCAGG - Intergenic
1145866126 17:28242775-28242797 CTATAAATACAAAATTAGCCGGG + Intergenic
1146191737 17:30773938-30773960 CTATAAATACAAAATTAGCCGGG - Intronic
1146201491 17:30862600-30862622 CTAAAAATACAGAATTAGCCGGG - Intronic
1146385503 17:32368842-32368864 CTAAAAATACAGAATTAGCCGGG + Intronic
1146606578 17:34263602-34263624 CTAAAAATACAGAATTAGCCCGG - Intergenic
1146714470 17:35072880-35072902 CTCAAAATACAAAATTAGCCAGG + Intronic
1147365146 17:39954124-39954146 CTAAAGATACAAATTTAGCCAGG + Intergenic
1147408773 17:40233900-40233922 CTAAAAATACAAATTTAGCCAGG + Intronic
1148569286 17:48654911-48654933 CTTTAGACACAGATTCAGACTGG - Intergenic
1148951637 17:51318495-51318517 CTAAAGATACAAAATTAGCCAGG - Intergenic
1149463753 17:56856935-56856957 CTAAAAATACAAATTTAGCCGGG + Intronic
1149794759 17:59508928-59508950 CTCAAAATACAAAATTAGCCAGG + Intergenic
1149803050 17:59588491-59588513 CTAAAAATACAGAATTAGCCAGG - Intronic
1149843437 17:59986989-59987011 CTAAAAATACAGAATTAGCCAGG + Intergenic
1149999341 17:61423694-61423716 CTATAGATACAAAACTAGCCAGG + Intergenic
1150000019 17:61429039-61429061 CTCTAAAAACAAATTTTGCCAGG - Intergenic
1150262157 17:63802747-63802769 CTAAAAATACAGAATTAGCCAGG + Intronic
1150332541 17:64305853-64305875 CTAAAAATACAAATTTAGCCAGG + Intergenic
1150341786 17:64374326-64374348 CTAAAAATACAAATTTAGCCAGG + Intronic
1150372711 17:64654666-64654688 CTAAAAATACAGAATTAGCCGGG + Intronic
1150742671 17:67792095-67792117 CTAAAAATACAGAATTAGCCAGG - Intergenic
1151609944 17:75166312-75166334 CTAAAAATACAGAATTAGCCAGG + Intronic
1151731281 17:75912877-75912899 CTAAAAATACAGAATTAGCCAGG + Intronic
1151906429 17:77052372-77052394 CTCAAAATACAAAATTAGCCGGG + Intergenic
1152678259 17:81652734-81652756 CTAAAAATACAAATTTAGCCAGG - Intronic
1154414541 18:14169937-14169959 CTATAAATACAAAATTAGCCGGG + Intergenic
1155606186 18:27608662-27608684 CTGAAAATACAGAATTAGCCCGG + Intergenic
1155906204 18:31454831-31454853 CTAAAGATACAAAATTAGCCGGG + Intronic
1155961350 18:31998003-31998025 CTGAAAATACAGAATTAGCCAGG - Intergenic
1156316810 18:35977062-35977084 CTAAAAATACAGAATTAGCCAGG + Intronic
1156317907 18:35988094-35988116 CTAAAAATACAGAATTAGCCGGG - Intronic
1156422599 18:36971466-36971488 CTAAAAATACAGAATTAGCCAGG + Intronic
1156442750 18:37207968-37207990 CTGCAAATACAGAATTAGCCAGG - Intronic
1156972749 18:43176808-43176830 CTCAAGATGCTTATTTAGCCAGG - Intergenic
1157676961 18:49575997-49576019 CTAAAGATACAAAATTAGCCAGG - Intronic
1158088618 18:53683641-53683663 CTAAAAATACAAATTTAGCCTGG - Intergenic
1158235026 18:55302762-55302784 CTCCAGATGCAGCTTTATCCAGG - Intronic
1158364910 18:56723329-56723351 GTGTAGATATAGATTTTGCCTGG + Intronic
1159252308 18:65895536-65895558 CTAAAAATACAGAATTAGCCAGG + Intergenic
1159505546 18:69330558-69330580 GTCTAGATACTGATTTATCATGG + Intergenic
1160201388 18:76798784-76798806 CTAAAAATACAGAATTAGCCAGG - Intronic
1160698570 19:495970-495992 CTAAAGATACAAAATTAGCCAGG + Intronic
1160714221 19:568460-568482 CTAAAAATACAGAATTAGCCGGG - Intergenic
1160936466 19:1598381-1598403 CTAAAAATACAGAATTAGCCTGG + Intronic
1161107171 19:2449912-2449934 CTAAAAATACAGAATTAGCCGGG + Intronic
1161181444 19:2885715-2885737 CTAAAAATACAGAATTAGCCGGG - Intergenic
1161215262 19:3091896-3091918 CTGAAAATACAGAATTAGCCAGG - Intergenic
1161409985 19:4111790-4111812 CTAAAAATACAAATTTAGCCGGG + Intronic
1161539403 19:4840782-4840804 CTAAAGATACAAAATTAGCCGGG + Intronic
1161788371 19:6342936-6342958 CTAAAGATACAAAATTAGCCGGG - Intergenic
1161813420 19:6484057-6484079 CTAAAGATACAAAATTAGCCGGG + Intergenic
1161886991 19:7004757-7004779 CTAAAAATACAGAATTAGCCAGG + Intergenic
1161918596 19:7249539-7249561 CTCTAGACAAATATTTAGTCTGG + Intronic
1162236412 19:9313115-9313137 CTAAAAATACAGAATTAGCCGGG - Intergenic
1162360131 19:10214714-10214736 CTAAAAATACAGAATTAGCCGGG - Intronic
1162425637 19:10593766-10593788 CTAAAAATACAGAATTAGCCGGG + Intergenic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1162650470 19:12084856-12084878 CTAAAGATACAAAATTAGCCGGG + Intergenic
1163412864 19:17167638-17167660 CTAAAGATACAAAATTAGCCAGG - Intronic
1163526941 19:17827138-17827160 CTCAAAATACAAAATTAGCCAGG - Intronic
1163526994 19:17827506-17827528 CTAAAAATACAGACTTAGCCAGG - Intronic
1163620496 19:18356875-18356897 CTAAAAATACAGAATTAGCCAGG + Intronic
1163723971 19:18912009-18912031 CTAAAAATACAGAATTAGCCAGG - Intronic
1163962110 19:20706465-20706487 CTAAAAATACAAATTTAGCCAGG - Intronic
1164079356 19:21849325-21849347 CTCAAAATACAAAATTAGCCAGG + Intronic
1164526198 19:29015305-29015327 CTCAGGATGCAGATTCAGCCTGG - Intergenic
1165545530 19:36532258-36532280 CTAAAAATACAAATTTAGCCGGG - Intergenic
1165594283 19:36998847-36998869 CTAAAAATACAGAATTAGCCAGG + Intergenic
1165684327 19:37805840-37805862 CTAAAAATACAAATTTAGCCAGG - Intronic
1166200616 19:41235188-41235210 CTAAAAATACAGAATTAGCCGGG + Intronic
1166521576 19:43484088-43484110 CTATAAATACAAAATTAGCCAGG + Intronic
1166786658 19:45371165-45371187 CTAAAGATACAAAATTAGCCGGG + Intergenic
1167051095 19:47079188-47079210 CTAAAAATACAGAATTAGCCAGG - Intronic
1167158610 19:47754114-47754136 CTAAAGTTACAGAATTAGCCGGG + Intronic
1167225532 19:48236934-48236956 CTAAAAATACAGAATTAGCCGGG - Intronic
1167339774 19:48908289-48908311 CTAAAGATACAAAATTAGCCAGG - Intronic
1167479179 19:49718920-49718942 CTCAAAATACAAAATTAGCCCGG + Intergenic
1167905369 19:52656224-52656246 CTCTATATATATATATAGCCAGG + Intronic
1167947492 19:53000632-53000654 CTAAAAATACAGAATTAGCCGGG + Intergenic
1168016808 19:53580669-53580691 CTATAAATACAAAATTAGCCAGG + Intergenic
1168092140 19:54093028-54093050 CTCAAAATACAAAATTAGCCAGG + Intergenic
1168574997 19:57502101-57502123 CTAAAGATACAAAATTAGCCGGG - Intronic
925242182 2:2341149-2341171 CTCAAAATACAAAATTAGCCGGG - Intergenic
926716476 2:15928301-15928323 CTAAAAATACAGAATTAGCCAGG - Intergenic
928516533 2:32049799-32049821 CTAAAAATACAGAATTAGCCTGG - Intergenic
928638708 2:33275521-33275543 CTAAAAATACAGAATTAGCCAGG + Intronic
928794970 2:35007107-35007129 CTCAAAATACAAAATTAGCCGGG + Intergenic
928968394 2:37000236-37000258 CTAAAAATACAGAATTAGCCGGG - Intronic
928976395 2:37091161-37091183 CTAAAAATACAGAATTAGCCGGG + Intronic
929158305 2:38807805-38807827 CTGAAGATACAAAATTAGCCAGG - Intronic
929325825 2:40609713-40609735 CTCAAAATACAAAATTAGCCTGG + Intronic
930786221 2:55273954-55273976 CTAAAAATACAGAATTAGCCGGG + Intergenic
931287582 2:60845689-60845711 CTCAAAATACAAAATTAGCCAGG - Intergenic
931291401 2:60877115-60877137 CTAAAGATACAAAATTAGCCCGG - Intergenic
931763158 2:65433701-65433723 CTAAAAATACAGAATTAGCCGGG + Intergenic
932010493 2:67972893-67972915 CTCAAAATACAAAATTAGCCGGG - Intergenic
933149392 2:78895757-78895779 CTCTAGAAAAACATTTAGCTGGG - Intergenic
933919759 2:87033442-87033464 CTAAAAATACAGAATTAGCCAGG - Intergenic
934003236 2:87736452-87736474 CTAAAAATACAGAATTAGCCAGG + Intergenic
934932944 2:98443246-98443268 CTAAAAATACAAATTTAGCCAGG + Intergenic
935017286 2:99195919-99195941 CTGAAAATACAGAATTAGCCAGG + Exonic
935077032 2:99755426-99755448 CTAAAAATACAGAATTAGCCAGG - Intronic
936378367 2:111962344-111962366 CTAAAAATACAGAATTAGCCGGG + Intronic
937092114 2:119213343-119213365 CTAAAGATACAAAATTAGCCAGG + Intergenic
937756032 2:125539991-125540013 CTAGAAATACAGAATTAGCCAGG + Intergenic
938035294 2:128029682-128029704 CTAAAGATACAAAATTAGCCGGG + Intergenic
938889910 2:135693842-135693864 CTAAAAATACAGAATTAGCCGGG + Intronic
941794959 2:169588797-169588819 CTAAAAATACAAATTTAGCCGGG + Intronic
942160857 2:173185078-173185100 CTAAAAATACAAATTTAGCCAGG + Intronic
943838769 2:192551251-192551273 CTAAAGATACAAAATTAGCCAGG - Intergenic
944235682 2:197439529-197439551 CTAAAGATACAAAATTAGCCGGG + Intergenic
944723763 2:202449145-202449167 CTAAAAATACAGAATTAGCCGGG + Intronic
945238941 2:207659124-207659146 CTAAAAATACAGAATTAGCCAGG + Intergenic
946241853 2:218360989-218361011 CTAAAAATACAGAATTAGCCGGG - Intronic
947210951 2:227708023-227708045 CTCCAAATACAGATTCAGGCTGG - Intronic
947504854 2:230700290-230700312 CTAAAAATACAGAATTAGCCAGG + Intergenic
948123548 2:235548490-235548512 CTAAAAATACAGAATTAGCCAGG + Intronic
948957497 2:241305282-241305304 CTAAAAATACAGAATTAGCCGGG - Intronic
1169168496 20:3443875-3443897 CTCTAGAAACAGATTCACACAGG + Intergenic
1170688673 20:18592313-18592335 CTTGAAATACAGATTTAGCTGGG + Intronic
1171477775 20:25426684-25426706 CTAAAGATACAAAATTAGCCAGG - Intronic
1171954158 20:31447099-31447121 CTAAAAATACAGAATTAGCCAGG + Intronic
1172261928 20:33574462-33574484 CTAAAAATACAGAATTAGCCAGG + Intronic
1172277902 20:33690643-33690665 CTAAAGATACAAAATTAGCCGGG - Intergenic
1172370250 20:34384003-34384025 CTATAAATACAAAATTAGCCGGG - Intronic
1172558884 20:35868130-35868152 CTAAAGATACAAAATTAGCCAGG + Intronic
1172576914 20:36016626-36016648 CTAAAAATACAGAATTAGCCAGG + Intronic
1172904782 20:38360999-38361021 CTAAAAATACAGAATTAGCCGGG + Intronic
1173373497 20:42461164-42461186 CTAAAAATACAAATTTAGCCGGG + Intronic
1173523118 20:43713546-43713568 CTAAAGATACAAAATTAGCCGGG - Intronic
1173556043 20:43966591-43966613 CTAAAAATACAAATTTAGCCAGG + Intronic
1173963696 20:47094656-47094678 CACTAGCTACAGAGTTAGTCAGG + Intronic
1173994787 20:47329563-47329585 CTAAAAATACAGAATTAGCCAGG - Intronic
1174609028 20:51783857-51783879 CTCAAAATACAAAATTAGCCGGG + Intergenic
1174623922 20:51898752-51898774 CTATAAATACAAAATTAGCCAGG - Intergenic
1175149237 20:56920104-56920126 CTAAAGATACAAAATTAGCCAGG - Intergenic
1176858490 21:13988308-13988330 CTATAAATACAAAATTAGCCAGG - Intergenic
1177058064 21:16334313-16334335 CTCAAAATACAAAATTAGCCGGG - Intergenic
1177725290 21:24959083-24959105 CTAAAAATACAGAATTAGCCAGG + Intergenic
1177939344 21:27389742-27389764 CTAAAGATACAAAATTAGCCGGG - Intergenic
1178157113 21:29867631-29867653 CTAAAAATACAGAATTAGCCAGG + Intronic
1178956791 21:37030017-37030039 CTAAAGATACAAAATTAGCCAGG + Intergenic
1179775702 21:43660400-43660422 CTAAAAATACAGAATTAGCCGGG + Intronic
1181502474 22:23325206-23325228 CTAAAAATACAGAATTAGCCAGG - Intergenic
1182160375 22:28115522-28115544 CTCTAGATACAGATTTAGCCAGG - Intronic
1182333550 22:29568320-29568342 CTAAAGATACAAAATTAGCCAGG + Intronic
1183142043 22:35951404-35951426 CTAAAAATACAGAATTAGCCGGG - Intronic
1183804365 22:40195618-40195640 CTCTACAGAAAAATTTAGCCAGG - Intronic
1183847079 22:40551010-40551032 CTAAAGATACAAAATTAGCCAGG - Intronic
1184323010 22:43757384-43757406 CTAAAAATACAGAATTAGCCGGG + Intronic
1184497958 22:44853864-44853886 CTAAAAATACAGAATTAGCCAGG + Intronic
949346735 3:3083886-3083908 CTAAAGATACAAAATTAGCCAGG + Intronic
949942285 3:9164156-9164178 CTGAAAATACAGAATTAGCCAGG - Intronic
950038763 3:9906086-9906108 CTAAAGATACAAAATTAGCCGGG + Intronic
950604088 3:14062874-14062896 CTAAAAATACAAATTTAGCCAGG + Intronic
951879998 3:27471531-27471553 CTAAAAATACAGAATTAGCCAGG - Intronic
952278991 3:31904792-31904814 CTGTAGACACAGATTTTGACAGG - Intronic
952867665 3:37865010-37865032 CTTTAGATACAGATTTACAAAGG + Intronic
953668646 3:44944305-44944327 CTAAAGATACAAAATTAGCCGGG - Intronic
954185623 3:48915057-48915079 CTAAAGATACAAAATTAGCCAGG + Intergenic
955273871 3:57528562-57528584 CTAAAAATACAGAATTAGCCAGG + Intronic
955310850 3:57885231-57885253 CTAAAAATACAAATTTAGCCGGG - Intronic
958458009 3:94357721-94357743 CTAAAAATACAGAATTAGCCAGG - Intergenic
959666908 3:108932758-108932780 CTAAACATACAGAATTAGCCGGG + Intronic
959936636 3:112036405-112036427 CTACAAATACAGAATTAGCCAGG + Intronic
960895844 3:122504249-122504271 CACCAGATACTGAATTAGCCAGG - Intronic
960902758 3:122568146-122568168 CTAAAGATACAAAATTAGCCGGG + Intronic
960909583 3:122635706-122635728 TTCTAAATGCAGTTTTAGCCAGG - Intronic
961283757 3:125783634-125783656 CTCTAGACAGAGATTTGGGCAGG + Intergenic
961708151 3:128805811-128805833 CTATAAATACAAAATTAGCCAGG - Intronic
962533962 3:136310200-136310222 CTAAAAATACAGAATTAGCCAGG + Intronic
962800336 3:138884960-138884982 CTCAAAATACAAAATTAGCCAGG - Intergenic
963086136 3:141438381-141438403 CTCAAAATACAAAATTAGCCGGG - Intronic
963862555 3:150325716-150325738 CTATAGAGACAGATTTACCAAGG + Intergenic
963971491 3:151435033-151435055 CTCAAGATACAGAATTAACAGGG - Exonic
967917952 3:194592773-194592795 CTAAAGATACAAAATTAGCCGGG - Intronic
968147531 3:196312039-196312061 CTAAAGATACAAAATTAGCCAGG - Intronic
968584193 4:1408323-1408345 CTCTATATCCAAATTTAGCTGGG - Intergenic
968837978 4:2979550-2979572 CTAAAGATACAAAATTAGCCGGG + Intronic
969263849 4:6051381-6051403 ATCTAAATACAAAATTAGCCCGG - Intronic
969665804 4:8556999-8557021 CTAAAAATACAGAATTAGCCGGG - Intergenic
969699108 4:8756435-8756457 CTCAAAATACAAAATTAGCCGGG - Intergenic
970186630 4:13461767-13461789 CTCTACATACAGTATAAGCCCGG + Intronic
971413634 4:26402047-26402069 CTAAAAATACAGAATTAGCCAGG - Intronic
971935678 4:33144066-33144088 CTAAAAATACAGAATTAGCCAGG - Intergenic
972481037 4:39496438-39496460 CTATAAATACAAAATTAGCCGGG - Intergenic
972596448 4:40533974-40533996 CTAAAAATACAGAATTAGCCGGG - Intronic
973200597 4:47497292-47497314 CTAAAAATACAGAATTAGCCGGG + Intronic
973740996 4:53919366-53919388 CTAGAGATACAAACTTAGCCAGG + Intronic
974146937 4:57960494-57960516 CTAAAAATACAAATTTAGCCAGG - Intergenic
974394226 4:61314368-61314390 CTAAAAATACAGAATTAGCCGGG - Intronic
975602044 4:76111701-76111723 CTAAATATACAGAATTAGCCGGG - Intronic
976233975 4:82876269-82876291 CTAAAAATACAGAATTAGCCGGG - Intronic
976402270 4:84620897-84620919 CTAAAAATACAGAATTAGCCGGG + Intronic
976702576 4:87987214-87987236 CTAAAAATACAGAATTAGCCAGG + Intergenic
977019763 4:91744802-91744824 CTAAAGATACAAAATTAGCCAGG - Intergenic
977258592 4:94769447-94769469 CTAAAAATACAGAATTAGCCAGG + Intronic
977527373 4:98161457-98161479 CTAAAGATACAAAATTAGCCGGG - Intergenic
977534492 4:98241186-98241208 CTAAAAATACAAATTTAGCCGGG + Intergenic
977661935 4:99598822-99598844 CTAAAAATACAGAATTAGCCGGG - Intronic
977814439 4:101398025-101398047 CTAAAAATACAGAATTAGCCGGG + Intergenic
978129734 4:105180798-105180820 CTAAAAATACAGAATTAGCCAGG - Intronic
978398441 4:108307031-108307053 CTAAAAATACAGAATTAGCCTGG - Intergenic
979222974 4:118250643-118250665 CTAAAGATACAAAATTAGCCGGG - Intronic
980169841 4:129275766-129275788 ATATAGATAGAGATTTATCCTGG - Intergenic
981399316 4:144294581-144294603 CTGAAGAAACAGATTTAGACAGG + Intergenic
981716979 4:147761310-147761332 CTCTATATAGAGATTACGCCGGG - Intronic
983201077 4:164861129-164861151 CTAAAGATACAAAGTTAGCCGGG - Intergenic
983757457 4:171357915-171357937 CTAAAGATACAAAATTAGCCGGG - Intergenic
984242796 4:177237468-177237490 GACTGGATACAGATTTAGCAAGG - Intergenic
984781111 4:183526636-183526658 CTAAAGATACAAAATTAGCCGGG - Intergenic
984909347 4:184657830-184657852 CTATAAATACAAAATTAGCCGGG + Intronic
986946988 5:13033440-13033462 CTCAAAATACAAAATTAGCCAGG - Intergenic
988590530 5:32544940-32544962 CTCAAAATACAAAATTAGCCAGG - Intronic
989389387 5:40884718-40884740 CTAAAAATACAGAATTAGCCAGG - Intergenic
989490889 5:42051606-42051628 CTCTAGATAAGGAATTAGCTGGG + Intergenic
989570487 5:42941941-42941963 CTCAAAATACAAAATTAGCCGGG - Intergenic
990586285 5:57214422-57214444 CTACAGATACAAAATTAGCCAGG + Intronic
991056928 5:62331248-62331270 CTAAAAATACAGAATTAGCCAGG + Intronic
992063907 5:73085959-73085981 CTAAAAATACAGAATTAGCCAGG + Intronic
992577954 5:78138807-78138829 CTAAAAATACAGAATTAGCCAGG + Intronic
994877645 5:105446404-105446426 CTAAAAATACAAATTTAGCCCGG + Intergenic
995107288 5:108389053-108389075 CTAAAGATACAAAATTAGCCAGG - Intergenic
995158904 5:108951398-108951420 CACTAGATTAAGATTTGGCCGGG - Intronic
995659549 5:114465449-114465471 CTAAAAATACAGAATTAGCCAGG + Intronic
996722995 5:126648076-126648098 CTAAAAATACAAATTTAGCCGGG + Intergenic
996730986 5:126717466-126717488 CTCAAAATACAAAATTAGCCGGG - Intergenic
996876819 5:128249597-128249619 CTAAAAATACAGAATTAGCCTGG - Intergenic
997505541 5:134413764-134413786 CTAAAGATACAAAATTAGCCGGG - Intergenic
997617185 5:135255569-135255591 CTCTTGCTACAGACTTAGGCAGG - Intronic
997671846 5:135681134-135681156 CTAAAGATACAAAATTAGCCGGG - Intergenic
997728932 5:136150208-136150230 CTGGAGATACAGGTTTAGCCAGG - Intronic
997952682 5:138254346-138254368 CTAAAAATACAGAATTAGCCAGG - Intronic
999329893 5:150665872-150665894 CTATAAATACAAAATTAGCCAGG + Intronic
999789260 5:154923217-154923239 CTAAAGATACAAAATTAGCCAGG + Intronic
1000217533 5:159176643-159176665 CTCTGTATGCAGATTTAGCAAGG + Exonic
1000314402 5:160074583-160074605 CTAAAAATACAGAATTAGCCAGG + Intronic
1000736482 5:164908054-164908076 CTAAAAATACAGAATTAGCCGGG + Intergenic
1001610897 5:173001167-173001189 CTAAAAATACAGAATTAGCCGGG + Intronic
1001616064 5:173044709-173044731 CTCAAAATACAAAATTAGCCGGG - Intergenic
1001976421 5:176003494-176003516 CTAAAAATACAGAATTAGCCAGG + Intronic
1002208333 5:177579713-177579735 CTAAAAATACAGAATTAGCCAGG - Intergenic
1002241002 5:177840274-177840296 CTAAAAATACAGAATTAGCCAGG - Intergenic
1002506463 5:179682547-179682569 CTCAAAATACAAAATTAGCCGGG + Intronic
1003559351 6:7168092-7168114 CTAAAAATACAAATTTAGCCGGG + Intronic
1003879242 6:10465309-10465331 CTAAAAATACAAATTTAGCCAGG + Intergenic
1004226685 6:13791198-13791220 CTCTACAAAAAGATTTAGCCGGG - Intronic
1005045437 6:21637956-21637978 CTATAAATACACAATTAGCCAGG - Intergenic
1005256800 6:24011896-24011918 GTTTAAATACAAATTTAGCCAGG + Intergenic
1005526005 6:26649862-26649884 CTAAAAATACAGAATTAGCCAGG - Intronic
1006074174 6:31519296-31519318 CTAAAAATACAGAATTAGCCAGG + Intergenic
1006477307 6:34264936-34264958 CTCTAAATACAAAATTAGCCGGG + Intergenic
1007384932 6:41514064-41514086 CTAAAGATACAAAATTAGCCGGG + Intergenic
1007428299 6:41761142-41761164 CTATAAATACAAAATTAGCCAGG + Intergenic
1007643845 6:43365509-43365531 CCCTAGTTACAAAGTTAGCCAGG + Intronic
1007669584 6:43540226-43540248 CTGAAGATACAAAATTAGCCAGG + Intronic
1008276961 6:49553089-49553111 CTAAAAATACAGAATTAGCCGGG - Intronic
1008421006 6:51299075-51299097 CTAAAAATACAGAATTAGCCAGG - Intergenic
1009479473 6:64139026-64139048 ATCTAGATAAAGAGTTGGCCTGG + Intronic
1011502064 6:88001644-88001666 CTAAAAATACAGAATTAGCCGGG + Intergenic
1011590605 6:88966827-88966849 CTAAAAATACAGAATTAGCCAGG + Intergenic
1012925474 6:105263031-105263053 CTATAAATACAAAATTAGCCAGG - Intergenic
1013340582 6:109211093-109211115 CTAAAAATACAAATTTAGCCAGG - Intergenic
1013517429 6:110901109-110901131 CTAAAAATACAAATTTAGCCAGG + Intergenic
1013801421 6:113949940-113949962 CTAAAGATACAAAATTAGCCTGG - Intronic
1014232797 6:118922869-118922891 CTAAAAATACAGAATTAGCCAGG + Intronic
1014237690 6:118978122-118978144 CTAAAAATACAGAATTAGCCAGG - Intronic
1014607934 6:123501011-123501033 CTCTACAAACAGATTTAGATGGG + Intronic
1015242865 6:131045420-131045442 CTCAAGAGAAAGACTTAGCCTGG + Intronic
1016013119 6:139158910-139158932 CTAAAAATACAGAATTAGCCAGG + Intronic
1016310804 6:142731436-142731458 CTAAAAATACAGAATTAGCCCGG + Intergenic
1016406000 6:143731446-143731468 CTAAAAATACAGAATTAGCCGGG - Intronic
1017098610 6:150827436-150827458 CTATAAATACAAAATTAGCCGGG - Intronic
1017465650 6:154691341-154691363 CTAAAAATACAGAATTAGCCGGG + Intergenic
1018469610 6:164083832-164083854 CTAAAGATACAAAATTAGCCAGG + Intergenic
1020087108 7:5316438-5316460 CTGAAAATACAGAATTAGCCAGG - Intronic
1020234893 7:6348069-6348091 CTAAAAATACAGAATTAGCCGGG - Intronic
1020797772 7:12697373-12697395 CTAAAAATACAGAATTAGCCAGG - Intergenic
1021264858 7:18507650-18507672 CTAAAAATACAAATTTAGCCAGG - Intronic
1021280948 7:18717590-18717612 CTAAAAATACAGAGTTAGCCAGG - Intronic
1022163309 7:27733246-27733268 CTCTAGAAACAGATTTCTCTGGG - Intergenic
1022387231 7:29913183-29913205 CTAAAAATACAGAATTAGCCAGG + Intronic
1022598535 7:31735235-31735257 CTAAAGATACAAAATTAGCCAGG + Intergenic
1022838469 7:34139265-34139287 CTCTTGATACAGACTTCGGCTGG - Intronic
1023112039 7:36823739-36823761 CTAAAAATACAGAATTAGCCGGG + Intergenic
1023285212 7:38612235-38612257 CTAAAAATACAGAATTAGCCGGG - Intronic
1023290297 7:38660969-38660991 CACTACATTCAGATTTTGCCAGG - Intergenic
1023475736 7:40575782-40575804 CTCAAAATACAGAATTAGCCGGG + Intronic
1023554641 7:41408652-41408674 CTAAAAATACAGAATTAGCCAGG - Intergenic
1023853869 7:44168604-44168626 CTGAAAATACAGAATTAGCCAGG - Intronic
1023946548 7:44807466-44807488 CTCAAAATACAAAATTAGCCAGG + Intronic
1024644475 7:51359661-51359683 CTAAAAATACAAATTTAGCCGGG - Intergenic
1024997723 7:55286578-55286600 CTAAAGATACAAAATTAGCCAGG + Intergenic
1025070338 7:55892709-55892731 CTGAAGATACAAAATTAGCCGGG + Intronic
1025207198 7:57000720-57000742 CTAAAAATACAGAATTAGCCGGG + Intergenic
1025664736 7:63576170-63576192 CTAAAAATACAGAATTAGCCGGG - Intergenic
1025741006 7:64195556-64195578 CTCAAAATACAAAATTAGCCAGG + Intronic
1026104218 7:67408226-67408248 TTCTTGCTACACATTTAGCCAGG - Intergenic
1026902322 7:74044078-74044100 CTCTACAAAAAAATTTAGCCAGG + Intronic
1027138699 7:75641656-75641678 CTATAAATACAAAATTAGCCGGG - Intronic
1027246502 7:76371170-76371192 CTAAAGATACAAAATTAGCCAGG - Intergenic
1027928262 7:84496216-84496238 CTAAAGATACAAAATTAGCCGGG + Intergenic
1028793295 7:94877477-94877499 CTAAAAATACAGAATTAGCCAGG - Intergenic
1029542406 7:101191850-101191872 CTAAAAATACAGAATTAGCCGGG - Intergenic
1030001871 7:105072752-105072774 CTATAAATACAAAATTAGCCAGG + Intronic
1030244260 7:107363792-107363814 CTAAAAATACAGAATTAGCCAGG + Intronic
1030727483 7:112942541-112942563 CTATAAATACAGAATTAGCCGGG - Intergenic
1030982563 7:116204123-116204145 CTCAAAATACAAAATTAGCCAGG - Intergenic
1031054933 7:116983057-116983079 CTCAAAATACAAAATTAGCCAGG - Intronic
1031168189 7:118256621-118256643 CTATAAATACAAAATTAGCCGGG + Intergenic
1031748259 7:125534820-125534842 CTCTGGATCCAGATTTGTCCTGG + Intergenic
1031884628 7:127232996-127233018 CTCTAAATACAAAATTAGCTGGG - Intronic
1033197437 7:139340042-139340064 CTAAAAATACAGAATTAGCCGGG - Intronic
1033310510 7:140258498-140258520 CTAAAAATACAGAATTAGCCGGG + Intergenic
1033420202 7:141198805-141198827 CTCCAGGTACAGTTTCAGCCAGG - Intronic
1033474616 7:141679549-141679571 CTAAAAATACAGAATTAGCCAGG + Intronic
1033801933 7:144912087-144912109 CTCAAAATACAAAATTAGCCAGG - Intergenic
1033919517 7:146372198-146372220 CTCAAGATAAAGATATGGCCAGG - Intronic
1034607878 7:152334289-152334311 CTAAAAATACAGAATTAGCCGGG + Intronic
1035408159 7:158614441-158614463 CTAAAAATACAGAATTAGCCTGG - Intergenic
1035703404 8:1654498-1654520 CTAAAGATACAAAATTAGCCAGG + Intronic
1036412131 8:8512165-8512187 TTATAGATACAGATTTTCCCAGG - Intergenic
1036837354 8:12084639-12084661 CTAAAGATACAAATTTAGCTGGG + Intergenic
1036859147 8:12330883-12330905 CTAAAGATACAAATTTAGCTGGG + Intergenic
1037043569 8:14268784-14268806 ATCTAGTTACATATTTAGTCTGG + Intronic
1037282405 8:17256811-17256833 CTAAAGATACAAAATTAGCCGGG - Intronic
1037335116 8:17784454-17784476 CTAAAAATACAGAATTAGCCGGG - Intronic
1037523890 8:19706303-19706325 ATACAGATACAGATTGAGCCTGG - Intronic
1037723344 8:21463474-21463496 CTAAAAATACAGAATTAGCCGGG + Intergenic
1037758513 8:21726911-21726933 CTATAAATACAAAATTAGCCGGG - Intronic
1038424065 8:27453271-27453293 CTCATGATACAGATGAAGCCCGG + Intronic
1039172678 8:34766315-34766337 CTAAAAATACAGAATTAGCCGGG + Intergenic
1039520847 8:38170199-38170221 CTAAAAATACAGAATTAGCCGGG - Intronic
1039750329 8:40472939-40472961 CAATAGATACAAAATTAGCCAGG + Intergenic
1039812229 8:41059343-41059365 CTGAAAATACAGAATTAGCCAGG + Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040569273 8:48593230-48593252 CTGCAGATACAGATTTCACCAGG + Intergenic
1041092089 8:54311707-54311729 CTAAAGATACAAAATTAGCCGGG + Intergenic
1041737131 8:61123106-61123128 CTAAAGATACAAAATTAGCCGGG + Intronic
1042543647 8:69931527-69931549 CTCTAGGTACAGTCTAAGCCGGG + Intergenic
1042635014 8:70864808-70864830 CTCTAGATACCGCATTACCCAGG + Intergenic
1043491397 8:80752700-80752722 CTAAAAATACAGAATTAGCCAGG - Intronic
1043599555 8:81920473-81920495 CTAAAGATACAAAATTAGCCAGG - Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1044210336 8:89542621-89542643 CTAAAAATACAGAATTAGCCGGG + Intergenic
1044591752 8:93919364-93919386 CTGAAAATACAGAATTAGCCGGG + Intronic
1044655400 8:94543067-94543089 CTAAAAATACAGAATTAGCCAGG - Intronic
1044658760 8:94574870-94574892 CTAAAAATACAAATTTAGCCGGG + Intergenic
1044676121 8:94730582-94730604 CTCAAAATACAAAATTAGCCAGG + Intronic
1044993588 8:97817972-97817994 CTAAAAATACAAATTTAGCCGGG - Intronic
1045497764 8:102722569-102722591 CTAAAAATACAGAATTAGCCGGG - Intergenic
1046204962 8:110982132-110982154 CTCAAAATACAGAATTAGCCGGG + Intergenic
1046647068 8:116797178-116797200 CTAAAAATACAGAATTAGCCAGG - Intronic
1046965153 8:120156328-120156350 CTAAAAATACAGAATTAGCCAGG - Intronic
1049972358 9:832435-832457 CTAAAGATACAAAATTAGCCAGG + Intergenic
1050470608 9:5985622-5985644 CTGAAAATACAGAATTAGCCGGG + Intronic
1052025440 9:23568766-23568788 CTCCAGATACAGAAATAGCATGG - Intergenic
1052927713 9:34031330-34031352 CTGAAAATACAAATTTAGCCAGG + Intronic
1053203485 9:36167919-36167941 CTAAAAATACAGAATTAGCCGGG + Intergenic
1053265459 9:36709941-36709963 CTATAGATTCTGATTTAACCCGG + Intergenic
1054777823 9:69138754-69138776 CTCAAAATACAAAATTAGCCAGG + Intronic
1055517531 9:77048333-77048355 CTACAAATACAGAATTAGCCAGG - Intergenic
1055689686 9:78816141-78816163 CTAAAAATACAGATTTAGGCGGG + Intergenic
1056390644 9:86138146-86138168 CTAAAGATACAAAATTAGCCAGG + Intergenic
1056575057 9:87850055-87850077 CTAAAAATACAGAATTAGCCAGG - Intergenic
1057082899 9:92186246-92186268 CTAAAGATACAAAATTAGCCGGG + Intergenic
1057537950 9:95933681-95933703 CTAAAAATACAGAATTAGCCAGG + Intronic
1058041297 9:100304695-100304717 CTACAGATACAAAATTAGCCAGG + Intronic
1059707454 9:116838268-116838290 CTAAAAATACAGAATTAGCCAGG - Intronic
1060064317 9:120489966-120489988 CTAAAAATACAGAATTAGCCAGG - Intronic
1060627310 9:125125365-125125387 CTAAAGATACAAAATTAGCCAGG + Intronic
1061000659 9:127900397-127900419 CTAAAGATACAAAATTAGCCTGG + Intronic
1061148912 9:128817945-128817967 CTAAAGATACAAAATTAGCCGGG + Intergenic
1062667074 9:137680310-137680332 CTAAAAATACAAATTTAGCCAGG + Intronic
1186327651 X:8497540-8497562 CTAAAGATACAAAATTAGCCAGG - Intergenic
1187198152 X:17108332-17108354 CTAAAAATACAGAATTAGCCGGG - Intronic
1187394961 X:18911332-18911354 CTAAAGATACAAAATTAGCCAGG - Intronic
1187533905 X:20120400-20120422 CTAAAGATACAAAATTAGCCGGG + Intergenic
1189784854 X:44550147-44550169 CTAAAAATACAGAATTAGCCAGG + Intergenic
1190052394 X:47159974-47159996 CTAAAAATACAGAATTAGCCAGG + Intronic
1190742130 X:53296194-53296216 CTAAAAATACAGAATTAGCCGGG - Intronic
1190831867 X:54065766-54065788 CTAAAAATACAGAATTAGCCCGG - Intergenic
1190835620 X:54098200-54098222 CTAAAAATACAGAATTAGCCAGG - Intronic
1191838121 X:65487377-65487399 CTAAAAATACAGAATTAGCCGGG + Intronic
1192024670 X:67436864-67436886 CTCTAGCTACAGAATTGACCTGG + Intergenic
1192285980 X:69736488-69736510 CTAAAAATACAGAATTAGCCAGG - Intronic
1192371052 X:70513190-70513212 CTAAAAATACAGAATTAGCCAGG + Intergenic
1192469558 X:71385998-71386020 CTCAAAATACAAAATTAGCCGGG + Intronic
1192957803 X:76092302-76092324 CTCTAAACACTGCTTTAGCCAGG + Intergenic
1194808850 X:98365066-98365088 CTAAAAATACAGAATTAGCCGGG - Intergenic
1195106758 X:101610778-101610800 CTAAAAATACAGAATTAGCCGGG - Intergenic
1195324060 X:103743847-103743869 CTAAAGATACAAAATTAGCCGGG - Intergenic
1197473829 X:126895448-126895470 CTCTAAACACAGAATCAGCCTGG - Intergenic
1197773001 X:130101628-130101650 CTAAAAATACAGAATTAGCCGGG + Intronic
1197797102 X:130309547-130309569 CTAAAAATACAGAATTAGCCGGG - Intergenic
1198116568 X:133550174-133550196 CTCAAAATACAAAATTAGCCTGG - Intronic
1198136009 X:133750910-133750932 CTAAAAATACAGAATTAGCCAGG + Intronic
1200749621 Y:6933059-6933081 CTAAAAATACAGAATTAGCCGGG - Intronic
1201727338 Y:17168305-17168327 CTCTAGAAAGAGATTAAGGCTGG - Intergenic