ID: 1182161194

View in Genome Browser
Species Human (GRCh38)
Location 22:28123558-28123580
Sequence TTGAGAAGAACTGATACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182161194_1182161197 9 Left 1182161194 22:28123558-28123580 CCCGCTGTATCAGTTCTTCTCAA No data
Right 1182161197 22:28123590-28123612 TATTGCACACTTTACATTTTAGG 0: 1
1: 0
2: 3
3: 36
4: 335
1182161194_1182161198 10 Left 1182161194 22:28123558-28123580 CCCGCTGTATCAGTTCTTCTCAA No data
Right 1182161198 22:28123591-28123613 ATTGCACACTTTACATTTTAGGG 0: 1
1: 0
2: 3
3: 24
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182161194 Original CRISPR TTGAGAAGAACTGATACAGC GGG (reversed) Intronic
No off target data available for this crispr