ID: 1182164122

View in Genome Browser
Species Human (GRCh38)
Location 22:28155067-28155089
Sequence CCAGCCAGGGAGACTGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 542}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182164122_1182164126 8 Left 1182164122 22:28155067-28155089 CCTGATTCAGTCTCCCTGGCTGG 0: 1
1: 0
2: 0
3: 36
4: 542
Right 1182164126 22:28155098-28155120 TGTATCTCATAGATGTTATTAGG 0: 1
1: 0
2: 3
3: 20
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182164122 Original CRISPR CCAGCCAGGGAGACTGAATC AGG (reversed) Intronic
900276301 1:1831133-1831155 CCAGCCTGGGTGACAGAATGAGG + Intronic
900738756 1:4317547-4317569 TCAGGGAGGGAGACAGAATCGGG - Intergenic
901482762 1:9537331-9537353 CCAGCCTGGGTGACAGAATGAGG + Intergenic
901770652 1:11528926-11528948 CCAGCCTGGGACCCTGACTCGGG + Intronic
902105844 1:14035487-14035509 CCAGCCTGGGAGACAGAATGAGG - Intergenic
903018586 1:20377904-20377926 CTAGCTAGGGAAACTGAGTCTGG + Intergenic
903450186 1:23448357-23448379 CCTGCCAGGGAGAATAAATCTGG + Intronic
903614330 1:24641207-24641229 GCTGCCAGGGAGGCTGAAGCAGG + Intronic
903629698 1:24758324-24758346 CCAGCCAGGGAGAAAGAACGAGG - Intronic
903769569 1:25755225-25755247 CCGGCCTGGGAGACTGAGGCAGG + Intronic
903882069 1:26517402-26517424 CCAGCCTGGGAGACAAAATGAGG - Intergenic
904118401 1:28178872-28178894 CCTGCCAGGGACACTGAAACAGG + Intronic
904124193 1:28224770-28224792 GCAACCAGGGAGGCTGAGTCAGG + Intronic
904326826 1:29731942-29731964 CCAGCCAGGGATAATGCAACTGG + Intergenic
904414806 1:30353526-30353548 CAATCCAGGGAGACAGAATGTGG - Intergenic
904513984 1:31039024-31039046 CCAGCCTGGGTGACAGAATGAGG - Intronic
906313157 1:44768230-44768252 CCAGCCTGGGAGACAGAGTAAGG + Intergenic
906605267 1:47165253-47165275 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
906649313 1:47501319-47501341 CCAGCCAGGGTGACAGAGCCAGG - Intergenic
907142920 1:52205102-52205124 CCAGCCTGGGCGACAGAATGAGG - Intronic
907523377 1:55039621-55039643 CCAGGCAGTGAGACTGGCTCGGG + Exonic
908499099 1:64725114-64725136 CCAGCCTGGGTGACAGAATGAGG - Intergenic
909732245 1:78907780-78907802 GCAGCCAGTGTGACTGAATATGG + Intronic
910367405 1:86481164-86481186 CCAGCCTGGGAGACACAATTGGG - Intronic
910661726 1:89680588-89680610 CCAGCCTGGGAGACAGAGTGAGG - Intronic
910758233 1:90712714-90712736 CCACCCAGGGAGAATGAAGGAGG - Intronic
911340629 1:96632496-96632518 CCAGCCAGGGAGACTACCCCAGG - Intergenic
911343021 1:96662485-96662507 CCAGCCTGGGTGACAGAATGAGG - Intergenic
912936424 1:114007306-114007328 CCAGCCAGGTAGACTCCAGCAGG + Intergenic
912993708 1:114512532-114512554 CCAGCCAGGGCGACAGAACGAGG - Intergenic
914718200 1:150268603-150268625 CAAGCCTGGGAGCCTGAATTGGG - Exonic
914939617 1:152011329-152011351 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
915216059 1:154341460-154341482 CCAGCCTGGGCGACAGAATGAGG + Intronic
916228971 1:162520138-162520160 GCACTTAGGGAGACTGAATCGGG - Intronic
917007782 1:170434527-170434549 CCAGCCAGGTATGCTGAATTAGG - Intergenic
918210057 1:182342542-182342564 CCAGCCAGGGAGCCCTGATCTGG - Intergenic
918296155 1:183159409-183159431 GCTGCCTGGGAGACTGAAGCAGG - Intergenic
918892191 1:190289436-190289458 TCAGATAGGGAGACTGAATATGG + Intronic
919000813 1:191828740-191828762 CCAGCCTGGGAGAATGATGCAGG + Intergenic
919099911 1:193082792-193082814 CCAGCCAGGGCAACAGAATGAGG - Intronic
919659376 1:200228960-200228982 CCAGCCTGGGTGACTGAGTGAGG + Intergenic
919982304 1:202649923-202649945 GCAGCCTGGGAGACTGAAGTTGG - Intronic
921096493 1:211891094-211891116 CCAGCCTGGGTGACTGAATGTGG - Intergenic
921228378 1:213043527-213043549 CCAGCCTGGGTGACAGAATGAGG + Intergenic
922226766 1:223652310-223652332 CCAGCCTGGGAGACAGAGCCAGG + Intronic
922239513 1:223746506-223746528 CCAGCCTGGGTGACAGAATGAGG - Intronic
922399776 1:225240030-225240052 AAAGCCAGGCAGTCTGAATCTGG - Intronic
922614791 1:226955351-226955373 GGAGCCAGGGAGAGTGAACCAGG - Intronic
923656007 1:235917710-235917732 CCAGCCCTGGAGACATAATCTGG + Intergenic
1062894567 10:1092966-1092988 CCAGCCTCAGAGAATGAATCAGG - Intronic
1063017814 10:2095953-2095975 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1063238443 10:4143530-4143552 CCAGCCTGGGAGACAGAGCCAGG - Intergenic
1063248596 10:4249735-4249757 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1063551829 10:7041098-7041120 CCAGCCAGGCATTCTGACTCTGG - Intergenic
1063633553 10:7758182-7758204 CCAGCTCGGGAGACTGAGGCAGG - Intronic
1065237043 10:23662732-23662754 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1065311195 10:24417277-24417299 CCAGCCAGGGAGGGTGAGGCAGG - Intronic
1065344873 10:24739067-24739089 CCAGCCAGGGAAACAGAATGAGG - Intergenic
1065745086 10:28832896-28832918 CCAGCCTGGGTGACTGAATGAGG + Intergenic
1065885337 10:30071746-30071768 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1066300052 10:34088407-34088429 CCAGCCTGGGAGACAGATTGAGG + Intergenic
1066372387 10:34828332-34828354 CCAGCCTGGGCGACAGAATGAGG + Intergenic
1066385906 10:34940975-34940997 CCAGCCAGGGTGACAGAGCCAGG + Intergenic
1067101670 10:43338831-43338853 CCAGCCGGGCAGACAGCATCTGG + Intergenic
1067934794 10:50600658-50600680 CCAGCCAGGAGGACTGAAGCTGG - Intronic
1067940552 10:50651351-50651373 CCAGCCAGGGAAACTCACTTGGG - Intergenic
1068344028 10:55747716-55747738 CCAGCCTGGGGGACAGAATGAGG - Intergenic
1068512655 10:57985725-57985747 CCAGCCAGGGCGACAGAGCCAGG + Intergenic
1069870341 10:71529138-71529160 CCACCCAGAGCTACTGAATCAGG - Intronic
1070936112 10:80296618-80296640 CCAGCCTGGGTGACTGAAGGAGG + Intergenic
1071032635 10:81203473-81203495 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1071947469 10:90661955-90661977 CCAGCCAGGTAGAATGCATTTGG - Intergenic
1072736068 10:97880514-97880536 CCAGCCAAGGGAACTGAAGCAGG - Intronic
1072946618 10:99816311-99816333 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1073311487 10:102545942-102545964 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1073373132 10:103008665-103008687 GCTACCAGGGAGACTGAAGCAGG + Intronic
1074124683 10:110518850-110518872 CCAGCTAGGGAGGCTGAGGCAGG - Intergenic
1074346566 10:112691870-112691892 CCATTCAGGGAGACTCAATTGGG + Intronic
1074751794 10:116593925-116593947 CCAGCCTGGGCGACAGAATGAGG + Intronic
1074774902 10:116760335-116760357 CCAGCCTGGGAGAGTGAAACAGG - Intergenic
1075103059 10:119519420-119519442 ACAGACAGGGAGACAGAAGCTGG - Intronic
1075103139 10:119519764-119519786 ACAGACAGGGAGACAGAAGCTGG - Intronic
1075143587 10:119863697-119863719 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1075378695 10:122000347-122000369 CCAGCCTGGGCGACAGAATGAGG + Intronic
1075473377 10:122711102-122711124 CCAGGCAGGGAGAGATAATCAGG - Intergenic
1076941554 10:133613390-133613412 CCTGCCAGGGTGACAGAGTCAGG + Intergenic
1078198099 11:9153313-9153335 CCAGCCTGGGTGACAGAATGAGG + Intronic
1078239609 11:9519239-9519261 CCAGCCAGGGTGACAGAGTGAGG - Intronic
1078371489 11:10750507-10750529 GCTACCAGGGAGACTGAAACAGG - Intergenic
1079087323 11:17455907-17455929 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1079126363 11:17720873-17720895 ACAGCAAGGGCGACTGAGTCAGG - Intronic
1079373321 11:19870499-19870521 CCAGCCAGGCAGGATGAAGCAGG - Intronic
1079544973 11:21622204-21622226 CCAGCCTGGGAGACAGAACGAGG + Intergenic
1081770336 11:45646445-45646467 CCAGCCAGGGGCACTGAGTGAGG + Intergenic
1082096569 11:48135509-48135531 CCAGCCTGGGCGACAGAATGAGG - Intronic
1082131152 11:48490887-48490909 CCACCCATGGAGACTGCATTTGG - Intergenic
1082245656 11:49919235-49919257 CCACCCATGGAGACTGCATTTGG + Intergenic
1082564646 11:54661751-54661773 CCACCCATGGAGACTGCATTTGG - Intergenic
1083390717 11:62347895-62347917 CCAGCCTGGGCGACAGAATGAGG + Intronic
1083750109 11:64756144-64756166 CCAATCAGGGTGACTGAATGTGG - Intronic
1083780782 11:64916278-64916300 CCAGGCAGGGACACTGAGCCGGG + Intronic
1083869543 11:65478313-65478335 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1083956443 11:65986129-65986151 CCAGCCTGGGTGACTGAGTGAGG + Intergenic
1084211961 11:67628538-67628560 CCAGCCATGCTGACTGACTCAGG + Intronic
1084606909 11:70177627-70177649 CCAGCCTGGGAGAATGAACGAGG - Intronic
1085777371 11:79378851-79378873 CCAGCCTGGGTGACAGAATGAGG + Intronic
1087591881 11:100199607-100199629 CAAGTCAGGGAGAATGAATATGG - Intronic
1088479481 11:110281439-110281461 CCAGCTATGGAGGCTGAAGCAGG - Intronic
1089035125 11:115381180-115381202 CCAGCTAGGGAGGCTGAGGCAGG + Intronic
1089141033 11:116284293-116284315 CCAACCTGGGAGACTGAGGCAGG - Intergenic
1089344116 11:117779115-117779137 CCAACCAGGGAGAGTGGTTCTGG - Intronic
1089597890 11:119593334-119593356 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1090184761 11:124730023-124730045 CCAGCCTGGGAGACAGAGCCTGG - Intergenic
1090997065 11:131876383-131876405 CTAGCCAGAGAGTCTGAATGTGG - Intronic
1091711317 12:2742474-2742496 CCAGCCAGAGAGCCAGGATCAGG - Intergenic
1091857837 12:3753329-3753351 CCACCTTGGGAGCCTGAATCGGG - Intronic
1092221723 12:6718346-6718368 CCAGCTAGGGAGGCTGAGGCAGG + Intergenic
1092376905 12:7963307-7963329 CCAGGCAGGGAGGCTGGATAAGG + Intergenic
1092395897 12:8126232-8126254 CCAGCCTGGGTGACAGAACCAGG - Intronic
1092762921 12:11825865-11825887 CCAGCCTGGGTGACAGAATGAGG - Intronic
1094558113 12:31523086-31523108 CCAGCCTGGGCGACAGAATGAGG - Intronic
1095047522 12:37524756-37524778 CCAGCCTGGGTGACTGAGTGAGG - Intergenic
1095415271 12:41969711-41969733 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1096006206 12:48174223-48174245 CCAGCCAGGGAGAGAGAGTGAGG + Intronic
1097644555 12:62220990-62221012 CCAGCTAGGGAGGCTGAGGCAGG + Intronic
1100417769 12:94396316-94396338 CCAGCCTGGGTGACAGAATGAGG - Intronic
1100534205 12:95491538-95491560 CCAGCCTGGGCGACAGAATGAGG - Intronic
1100612171 12:96200525-96200547 CCAGCCTGGGTGACAGAACCAGG - Intronic
1100630725 12:96386626-96386648 CCAGCCTGGGAGACAGAAAGAGG + Intronic
1101380667 12:104211487-104211509 CCAGCAAAGGAGACTGAGTAGGG + Intergenic
1101441293 12:104706054-104706076 CCAGCTGGGGAGACAGAATGAGG + Intronic
1102133668 12:110553971-110553993 CCAGCTAGGGAGGCTGAAGCAGG - Intronic
1102480911 12:113222279-113222301 CAACCCAGGCAGTCTGAATCAGG - Intronic
1102862599 12:116349708-116349730 CCAGCCTGGGTGACAAAATCAGG - Intergenic
1103543593 12:121683485-121683507 CCAGCCTGGGCGACAGAATGAGG + Intergenic
1103787003 12:123440125-123440147 CCAGCCAGGGCGACAGAACGAGG - Intergenic
1103933099 12:124460871-124460893 GCAGCCAGGGAGACAGTGTCGGG - Intronic
1104599982 12:130146214-130146236 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1105723807 13:23141586-23141608 CCAGCTTGGGAGACTGAGGCAGG + Intergenic
1106228776 13:27805631-27805653 CCAGCCCAGGAGTCTGACTCTGG + Intergenic
1106689816 13:32102990-32103012 ACAGCCAGGGAGACTTCCTCTGG - Intronic
1106804083 13:33288298-33288320 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1107119240 13:36779087-36779109 CCAGCCAGGAGGAATGGATCTGG - Intergenic
1108894979 13:55314903-55314925 CCAGGCAGGGTGTCTGCATCAGG - Intergenic
1110210905 13:72972062-72972084 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1110516079 13:76414151-76414173 CCAGCCTGGGTGACAGAATAAGG - Intergenic
1110759302 13:79213399-79213421 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1111627781 13:90811454-90811476 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1111640941 13:90968943-90968965 CCAGTCAGGGAGTCAGAATCCGG + Intergenic
1112015939 13:95331462-95331484 CCAGCCTGGGAGACAGCATGAGG + Intergenic
1112156395 13:96822166-96822188 GCTGCCAGTGAGACTGAATTGGG + Intronic
1112444666 13:99453349-99453371 TGAGCCAGGGAGACTGAACCTGG - Intergenic
1112576463 13:100640779-100640801 CCAGCCAGGGTGACAGAGTGAGG + Intronic
1113477173 13:110592314-110592336 CCAGCCTGGGCGACAGAATGAGG - Intergenic
1114229959 14:20772289-20772311 CCAGCCTGGGTGACAGAACCAGG + Intergenic
1114430098 14:22653372-22653394 CCTGACAGGCAGACTGACTCGGG + Intergenic
1114471143 14:22963472-22963494 GCAGCCTGGGTGACTGAAACCGG - Intronic
1116197281 14:41744326-41744348 CCAGCCCGGGTGACCGAATGAGG + Intronic
1116441231 14:44955754-44955776 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1116456989 14:45131515-45131537 CCAGCTCGGGAGGCTGAAGCAGG + Intronic
1116924969 14:50625043-50625065 CCAGCCTGGGGGACTGAGTGAGG + Intronic
1117015409 14:51512733-51512755 CCAGCCTGGGGGAAAGAATCCGG - Intronic
1117033260 14:51698074-51698096 CCACCCAGGGAGCCACAATCAGG - Intronic
1117939148 14:60941972-60941994 CCAGCCTGGGCGACAGAATGAGG + Intronic
1118237953 14:64028017-64028039 CCAACCCGGGAGGCTGAAGCAGG - Intronic
1119493751 14:75061035-75061057 CCAGCCTGGGTGACAGAATGAGG + Intronic
1120456702 14:84739702-84739724 CCAGCCTGGGTGACAGAATCAGG + Intergenic
1120815619 14:88854792-88854814 CCAGCTTGGGAGACTGAAGCAGG - Intronic
1120862356 14:89266249-89266271 CAAGCCAGGGAGACAGCCTCAGG - Intronic
1120921820 14:89762276-89762298 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1121654134 14:95582891-95582913 CCAGCAAGGGAGAAAGATTCAGG + Intergenic
1121934531 14:98005302-98005324 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1122153392 14:99736619-99736641 TCAGCTAGGGAGACTGAGGCGGG + Intergenic
1123133656 14:106008005-106008027 TCAGCCAGGGACACAGAACCAGG - Intergenic
1123165409 14:106320691-106320713 TCAGCCAGGGACACAGAACCAGG - Intergenic
1124030568 15:26007149-26007171 CCAGGCAGGGAGACTGATGAGGG - Intergenic
1124084034 15:26529859-26529881 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1124117507 15:26859809-26859831 CCAGCCTGGGAGGCAGAATGAGG + Intronic
1124707347 15:31976967-31976989 CCAGCCACAGACACTGAAGCTGG - Intergenic
1125563955 15:40660931-40660953 CCAGCCTGGGTGACAGAACCAGG + Intronic
1125806332 15:42496685-42496707 TCAGCCTGGGAGACAGAGTCAGG + Intronic
1126041229 15:44593223-44593245 CCAGCCTGGGCGACAGAATGAGG - Intronic
1126582703 15:50255768-50255790 CCAGCCTGGGAGACAGAACCAGG + Intronic
1126784843 15:52169288-52169310 CCAGCCTGGGTGACTGAGGCAGG + Intronic
1127981024 15:64035136-64035158 CCAGCCTGGGCGACAGAATGAGG + Intronic
1128897700 15:71390887-71390909 CCAGCCTGGGTGACTGAACAAGG - Intronic
1128998245 15:72312597-72312619 CCAGCCTGGGTGACAGAATGAGG + Intronic
1129014729 15:72456292-72456314 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1129895539 15:79102965-79102987 CCAGCCAGAGACAAGGAATCTGG - Intergenic
1130821703 15:87502943-87502965 TCAGCCAGAGAGGCTGAGTCAGG + Intergenic
1131091962 15:89630169-89630191 CCAGACTGGGGGACAGAATCAGG - Intronic
1131213329 15:90516685-90516707 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1131916524 15:97271648-97271670 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1132209122 15:100007530-100007552 CCAACCAGGGAGGCTGAGGCAGG - Intronic
1132428334 15:101739765-101739787 CCAGCCTGGGTGACAGAATAAGG + Intronic
1133208012 16:4245680-4245702 CTAGCCTGGGAGACAGAATGAGG - Intergenic
1133228080 16:4352291-4352313 CCAGCCTGGGTGACAGAGTCAGG + Intronic
1134032253 16:11001665-11001687 CCAGCCTGGGCGACAGAATGAGG - Intronic
1134280686 16:12814121-12814143 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1135686652 16:24503221-24503243 CCAGCCTGGGAGACTCTGTCTGG - Intergenic
1136846783 16:33582627-33582649 CCAGCCTGGGCGACAGAATGAGG - Intergenic
1137246675 16:46711538-46711560 CCAGCCTGGGTGACAGAATGAGG - Intronic
1137662552 16:50221224-50221246 CCAGCCTGGGTGACAGAATGAGG + Intronic
1137670540 16:50275846-50275868 CTAGCCAGGGCAACTGACTCTGG - Intronic
1138228862 16:55323732-55323754 GCAGCCAGGGAGCCTGAAGAAGG - Intergenic
1138563216 16:57814394-57814416 ACAGCATGGGAGCCTGAATCAGG - Intronic
1139767024 16:69239102-69239124 CCAGCCAGGGAGACAGTGTTAGG - Intronic
1140384834 16:74526642-74526664 TGAGCCTGGGAGACTGAAGCTGG + Intronic
1141646274 16:85369736-85369758 CCAGCCAGGGAGAGTGTGTTAGG - Intergenic
1141897552 16:86968241-86968263 CCAGCCTGGGAGGCAGAATTAGG - Intergenic
1142439249 16:90084336-90084358 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1203108491 16_KI270728v1_random:1431282-1431304 CCAGCCTGGGCGACAGAATGAGG - Intergenic
1142866413 17:2794271-2794293 CCAGCCAAGGGGACTGGTTCAGG - Intronic
1143233279 17:5375674-5375696 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1143350253 17:6282875-6282897 CTAGCCAGGAAGACAGAGTCAGG - Intergenic
1143436667 17:6933440-6933462 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1143520968 17:7444194-7444216 CGTGCCAGGGAGACAGAGTCTGG + Exonic
1143648547 17:8248268-8248290 CCAGCCTGGGCGACAGAACCAGG - Intronic
1144007748 17:11116387-11116409 GGAGCCAGGGAGACTGAATAGGG + Intergenic
1144313995 17:14041411-14041433 CCAGCTAGGGAGGCTGAGGCAGG - Intergenic
1144323734 17:14156764-14156786 CCAGCTAGGGAGACAGAAAAGGG - Intronic
1145376066 17:22350125-22350147 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1145406912 17:22607844-22607866 CCAGCCTGGGGGACAGAATGAGG - Intergenic
1145706828 17:26878784-26878806 CCAGCCAGGGTGACAGAGTGAGG + Intergenic
1145946943 17:28783622-28783644 CCAGCTAGGGAGGCTGAAGCAGG - Intronic
1146206045 17:30906406-30906428 CCAGCCAGGGACTCGGGATCCGG - Exonic
1146437177 17:32861178-32861200 CCAGCTCGGGAGGCTGAAGCAGG - Intronic
1147046124 17:37753760-37753782 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1147154170 17:38535100-38535122 CCAGCCTGGGTGACAGAATGAGG + Intronic
1147366081 17:39960173-39960195 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1147496117 17:40917346-40917368 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1147888567 17:43701076-43701098 CCAGCCAGGGAGACAGACTGAGG + Intergenic
1148823106 17:50372273-50372295 CCAGCCTGGGTGACAGAATGGGG - Intronic
1148831531 17:50435438-50435460 CCAGCCAGGGTGACAGAGTGAGG - Intronic
1148832343 17:50441868-50441890 CCAGCCTGGGAGACAGAGTAAGG - Intronic
1148893296 17:50823495-50823517 CCAGCATGGGAGCATGAATCGGG + Intergenic
1149356842 17:55847950-55847972 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1149976168 17:61268610-61268632 CCAGCCTGGGCGACAGAATGAGG - Intronic
1150001701 17:61444384-61444406 CCAGCTTTGGAGACTGAATGAGG + Intergenic
1150151322 17:62810964-62810986 CCAGCCTGGGTGACAGACTCTGG - Intergenic
1150253629 17:63725461-63725483 GCTGCTAGGGAGACTGAAGCAGG - Intronic
1150695807 17:67403990-67404012 CCAGCCTGGGCGACTGAGCCAGG + Intronic
1150761971 17:67970285-67970307 CCAGCCCGAGAGACTGAGGCAGG + Intronic
1151726363 17:75887121-75887143 CCAGCCAGGGTGACAGAGTGAGG + Intronic
1151934018 17:77250261-77250283 CCAGCCTGGGTGACAGAGTCAGG - Intergenic
1152122587 17:78427852-78427874 CCAGCCTGGGAGGCTGAGCCAGG + Intronic
1153653673 18:7263326-7263348 GCATTGAGGGAGACTGAATCAGG - Intergenic
1153793468 18:8600998-8601020 CCAGCTCTGGAGACTGAAGCAGG - Intergenic
1154213623 18:12399813-12399835 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1154323844 18:13375771-13375793 CCTGCCAGGGAGCCTGCACCTGG + Intronic
1155869554 18:31009078-31009100 CCAGCCTGGGTGACAGAATGAGG - Intronic
1155929748 18:31693931-31693953 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1156470210 18:37373103-37373125 CAAGCCAGAGAGACTGAGGCTGG + Intronic
1157024609 18:43828204-43828226 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1158413634 18:57230636-57230658 CCAGCCTGGGTGACAGAGTCAGG + Intergenic
1158476690 18:57786366-57786388 TCAGCCAGGGATTCTCAATCTGG + Intronic
1160232244 18:77057227-77057249 CCAGCCAGGGAGACCGCAGCTGG - Intronic
1160895562 19:1400461-1400483 CCAGCCAGGGAGGCCGAAGACGG + Intronic
1161372097 19:3918441-3918463 ACTTGCAGGGAGACTGAATCGGG + Intronic
1161787328 19:6335252-6335274 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1161934867 19:7365395-7365417 CCAGCCTGGGTGACAGAATGAGG + Intronic
1162041939 19:7976061-7976083 CCAGCCTGGGTGACTGAGTGAGG + Intronic
1163038572 19:14586235-14586257 GCTGCCAGGGAGGCTGAGTCAGG - Intronic
1163039266 19:14590498-14590520 GCTGCCAGGGAGACTGAGTCAGG - Intronic
1163198224 19:15741378-15741400 CCAGGCATGGATACTGTATCTGG - Exonic
1164882372 19:31743813-31743835 CCAGCAAAGGAGACTGAGTGTGG - Intergenic
1165378870 19:35463691-35463713 CCACCCAGGCAGACTGGAACAGG - Intergenic
1165659201 19:37560246-37560268 CCAGCCTGGGTGACAGAATGAGG + Intronic
1165991930 19:39820508-39820530 CCAGCCAGGGTGACAGAGTCAGG + Intergenic
1166033662 19:40151778-40151800 CCATCCAGGCAGCCTGATTCAGG - Intergenic
1166051831 19:40265178-40265200 CCAGCGTGGGAGAAAGAATCTGG + Intronic
1166291709 19:41867773-41867795 CCAGCCTGGGTGACAGAATGAGG + Intronic
1166422851 19:42652226-42652248 GCAGCCACAGAGACTGAAACTGG + Intronic
1166772736 19:45294152-45294174 CCAGCCACCGAGGCTGAGTCAGG - Intronic
1167168738 19:47817176-47817198 ACAGGCAGGGAGACTGAGCCTGG + Intronic
1167225676 19:48237918-48237940 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1167304357 19:48698458-48698480 CCAGCCTGGGCGACAGAGTCAGG - Intronic
1167926661 19:52826674-52826696 CCAGCCTGGGTGACAGAATGAGG + Intronic
1168047465 19:53804426-53804448 CCAGCCTGGGTGACAGAATGAGG - Intronic
1168233565 19:55048030-55048052 CCAGCCAGTGAGTCTCAACCAGG - Intronic
1168403614 19:56099679-56099701 CCAGCCTGGGAGACAGAGTGAGG + Intronic
925633741 2:5922225-5922247 CCAGCAAGGTAGTCTCAATCAGG - Intergenic
925661079 2:6203403-6203425 CCAGCCACGGAGAGAGTATCAGG - Intergenic
925859037 2:8157163-8157185 CCACCCAGAGCCACTGAATCAGG - Intergenic
927549815 2:23988091-23988113 CCAGCCAGGGTGACAGAGTGAGG + Intronic
927901522 2:26822838-26822860 CCAGCCTGGGTGACAGAAGCAGG - Intergenic
928894701 2:36247313-36247335 CCAGTCAGGGACCCTGAAGCTGG + Intergenic
930764622 2:55072257-55072279 CCAGCCTGGGAGACAGAACGAGG - Intronic
931340564 2:61397411-61397433 CCAGCCTGGGAGACAAAATGAGG + Intronic
932744784 2:74324798-74324820 CCAGCCACAGAGACTGGTTCAGG + Intronic
933497111 2:83063420-83063442 CCAGCCAGGAGGACTGAAAATGG - Intergenic
933524973 2:83425464-83425486 CCAGCCTGGGAGACAAAATTAGG + Intergenic
934028381 2:88019174-88019196 CCAGCCAGGGAGCCTCCAGCAGG - Intergenic
934534263 2:95120031-95120053 CCAGCCAGGGCGACAGAAGGGGG + Intronic
934896373 2:98123483-98123505 CGGGCCAGGAAGACTGAAACAGG + Intronic
935161764 2:100535422-100535444 CCAGCCTGGGTGACAGAATAAGG + Intergenic
936005494 2:108883587-108883609 CCAGCCAGTGAGGCTGAAACTGG - Intronic
936067913 2:109345964-109345986 CCAGCCAGGGAATCTTAATTTGG - Intronic
936715649 2:115184065-115184087 CCAGACAGGGAGAGGGAATAGGG + Intronic
937598383 2:123697548-123697570 CCAGGCAGGGAGACTGTTTATGG - Intergenic
938856162 2:135313321-135313343 CCAGCCAGGGTGACAGAGTGAGG + Intronic
939184435 2:138843881-138843903 CCAGCCTGGGTGACTGAGTGAGG - Intergenic
940611096 2:155993082-155993104 CCAGCCTGGAAGACTGAGTGAGG - Intergenic
940953968 2:159708264-159708286 CCAGCCTGGGAGATGGAATGAGG + Intergenic
940984127 2:160036011-160036033 TCAGCAAGGGAGACTGAAAGGGG - Intronic
941068448 2:160929295-160929317 TTATCCAGGGAGACAGAATCAGG - Intergenic
941674854 2:168332950-168332972 CAAGCCACTAAGACTGAATCAGG + Intergenic
942718174 2:178918376-178918398 CCAGCCAGGGTGACAGAGCCAGG + Intronic
944327485 2:198423507-198423529 CCAGCTAGGGAGGCTGAGGCAGG + Intronic
944810542 2:203323407-203323429 CCAGCTAGGGAGGCTGAGGCAGG - Intergenic
945192637 2:207205919-207205941 CCAGCCAGGGAAGCTGACTTAGG - Intergenic
946053352 2:216881605-216881627 GCAGCCTGGGTGACTGATTCTGG + Intergenic
946245019 2:218382532-218382554 CCACCCAGTGAGATTGAGTCTGG - Intronic
946269278 2:218576935-218576957 CCAGCCTGGGAGACAGAGTGAGG + Intronic
946822002 2:223640102-223640124 CAACCCAGGGAGACTGAAGGAGG + Intergenic
948250876 2:236527874-236527896 CCGGGCAGGGACAGTGAATCTGG - Intergenic
948632861 2:239313068-239313090 CCAGCCAGGGAGCTTCACTCAGG + Intronic
948885238 2:240878940-240878962 CCAGCCCGGGAGGCAGAACCAGG + Exonic
1168981134 20:2004691-2004713 CCAGCCAGGCAGTCTGGCTCTGG - Intergenic
1170687279 20:18580751-18580773 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1170977846 20:21183131-21183153 ACAGCCAAAGGGACTGAATCTGG + Intronic
1171905789 20:30899079-30899101 CCAGCCTGGGTTACTTAATCCGG - Intergenic
1172290161 20:33770303-33770325 CCACCCAGGGAGAGGGAAGCAGG - Intronic
1172687576 20:36767870-36767892 CCAGCCTGGGTGACAGAGTCAGG + Intronic
1172721482 20:37002142-37002164 CCAGCTAGGGAGGCTGAGGCAGG - Intronic
1173076528 20:39824611-39824633 CCTGACAGGGAAAATGAATCAGG - Intergenic
1173691149 20:44962091-44962113 CCAGCCTGGGGAAGTGAATCAGG + Intergenic
1174321801 20:49747844-49747866 CCAGCCAGGGAGGAAGACTCAGG - Intergenic
1175351962 20:58329081-58329103 CCAGCCTGGGTGACAGAATGAGG - Intronic
1176003584 20:62846731-62846753 CCAGCCTGGGTGACAGAATGAGG + Intronic
1176042059 20:63071083-63071105 CCAGACAGGGAGGCTGAGTGGGG + Intergenic
1176382531 21:6120466-6120488 CCCTGCAGGGAGAATGAATCAGG - Exonic
1177403138 21:20632399-20632421 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1178002445 21:28177400-28177422 CCAGTCACAGAGTCTGAATCAGG + Intergenic
1178105273 21:29311813-29311835 GCAGGCTGGGAGACAGAATCAGG - Intronic
1178356249 21:31912569-31912591 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1178855089 21:36244136-36244158 CCAGCGTGGGAGACTGAGACAGG - Intronic
1178909975 21:36666580-36666602 CCAGCCTGGGAGACTGGAGATGG - Intergenic
1179472590 21:41621481-41621503 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1179684597 21:43046468-43046490 CCAGCCAGGAACACTGAAAACGG - Intergenic
1179740940 21:43417773-43417795 CCCTGCAGGGAGAATGAATCAGG + Exonic
1179778505 21:43683947-43683969 CCAGCCTGGGTGACAGACTCTGG + Intronic
1180577057 22:16786793-16786815 CCAGACATGAACACTGAATCAGG + Intronic
1180767579 22:18354730-18354752 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1180778727 22:18507658-18507680 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1180811451 22:18764968-18764990 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1180906488 22:19416351-19416373 CCAGCCTGGGCGACAGAATGAGG - Intronic
1181017270 22:20078445-20078467 CCAGCTACGGAGGCTGAAGCTGG - Intergenic
1181197604 22:21199220-21199242 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1181704148 22:24637967-24637989 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1182066524 22:27435248-27435270 ACAGACAGGGAGACTGAGGCCGG + Intergenic
1182164122 22:28155067-28155089 CCAGCCAGGGAGACTGAATCAGG - Intronic
1182424215 22:30263694-30263716 CCAGGCTGGGAGACAGAGTCAGG - Exonic
1182876724 22:33698328-33698350 CCAGCCTGGGTGACTGAGTGAGG - Intronic
1182891504 22:33822666-33822688 CCAGCCTGGGTGACAGAATAAGG + Intronic
1183693798 22:39407511-39407533 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1184061010 22:42081488-42081510 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1184354683 22:43971136-43971158 CCAGCCTGGGTGACAGAATGAGG + Intronic
1203229199 22_KI270731v1_random:95616-95638 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
949218425 3:1600333-1600355 CCTCCAAGGGAGACTGAGTCAGG + Intergenic
949346829 3:3084636-3084658 CCAGCCAGGGAAACTGAGGCTGG - Intronic
950119698 3:10473599-10473621 CCAGCCTGGGTGACAGAATGAGG + Intronic
950437871 3:12991597-12991619 CTGGTCAGGGAGTCTGAATCTGG - Intronic
951420176 3:22474745-22474767 CCAGCCTGGGAGACAGAGTGCGG - Intergenic
951592258 3:24279411-24279433 CCAGCCTGGGCGACAGAATGAGG - Intronic
951733740 3:25839131-25839153 CCAGCTAGGGAGGCTGAGGCAGG - Intergenic
952433312 3:33247292-33247314 CCAGCTAGGGAGGCTGAGGCAGG - Intergenic
953085555 3:39663093-39663115 ACAGGCACTGAGACTGAATCTGG - Intergenic
953236637 3:41112986-41113008 CCTGCCAGGGAGCCTCAGTCAGG + Intergenic
953757483 3:45659547-45659569 CCAGCCTGGGTGACAGAGTCAGG + Intronic
954393411 3:50279375-50279397 CCAGCAGGGGAAACTGAAGCAGG - Intronic
955247766 3:57244183-57244205 CCTGCCTGGGAGACAGAATGAGG - Intronic
955685921 3:61548721-61548743 CCAGCCTGGGCGACAGAATGAGG - Intergenic
957565271 3:81877372-81877394 CCAGCCTGGGAGGCTGAGGCAGG - Intergenic
958876586 3:99624278-99624300 CCAGCCAGGTCCACTGACTCTGG - Intergenic
958901134 3:99887762-99887784 CCAGCCTGGGTGACAGAATGAGG - Intronic
960631907 3:119740964-119740986 CCAGCTTGGGAGACTGAAGCAGG - Intronic
960719645 3:120613150-120613172 CCAGCCCCAGAGAATGAATCGGG + Intergenic
960923544 3:122773665-122773687 CAAGCCTGGGAGACAGAATGAGG - Intronic
961016238 3:123470406-123470428 CCAGCCTGGGTGACAGAGTCAGG - Intergenic
961087525 3:124081725-124081747 CCAGCCTGGGTGACAGAATGAGG + Intronic
961876654 3:130028393-130028415 CCAGCCAGTGAGACAAAAACAGG - Intergenic
962892631 3:139685921-139685943 CCAGCTGGGCAGACTGAATGTGG - Intergenic
964005716 3:151825361-151825383 CCAGCCTGGGTGACAGAATAAGG + Intronic
964109556 3:153074517-153074539 CCAGCCTGGGCGACAGAATGAGG - Intergenic
966103886 3:176311611-176311633 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
966160536 3:176962948-176962970 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
967057096 3:185839022-185839044 CCAGCCTGGGTGACAGACTCTGG + Intergenic
968250712 3:197209884-197209906 CCAACCAGGGAAATTCAATCAGG - Intronic
968404388 4:327328-327350 CCAGCAAGGGGGAATGAATTGGG - Intergenic
968831372 4:2934360-2934382 CCCGCCAGGGAGACCGAGTCCGG - Exonic
968891604 4:3372280-3372302 CCTGCCAGGGAGGCTCAAGCTGG - Intronic
969030798 4:4211651-4211673 CCTGCTAGGGAGACTGAGGCAGG + Intronic
969354495 4:6617468-6617490 TCAGCCAGTGACAGTGAATCTGG + Exonic
970525358 4:16926686-16926708 GCAGCCAGGAAGAGTAAATCGGG + Intergenic
971320014 4:25597994-25598016 CCAGCCTGGGTGACTGAGTGAGG + Intergenic
971425081 4:26508004-26508026 CCAGCCTGGGTGACAGAATGGGG - Intergenic
972491049 4:39587464-39587486 CCAGCCTGGGAGACAGAGTGAGG + Intronic
972535784 4:39998694-39998716 CCAGCCTGGGAGACAGAACGAGG + Intergenic
972548036 4:40100404-40100426 CCAGCCTGGGCGACTGAGTGAGG - Intronic
972617644 4:40715579-40715601 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
972719041 4:41677294-41677316 CCAGCTAGGGAGGCTGAGACAGG + Intronic
973101872 4:46282292-46282314 CTAGCCAGGACGACTGTATCAGG + Intronic
973564527 4:52170843-52170865 GCAGCCAGGAAGATTGAATTGGG - Intergenic
973853367 4:54984939-54984961 CCAGCCTGGGTGACAGAACCAGG - Intergenic
973953353 4:56039305-56039327 CCAGCCAGGGGCACTGAGACAGG + Intergenic
974768556 4:66380844-66380866 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
975564158 4:75736345-75736367 CCAGCCTGGGTGACAGAATGAGG - Intronic
979272844 4:118782756-118782778 CCAGCCAGGGAAGCTCAAACTGG - Intronic
981797329 4:148610761-148610783 CCAGCCTGGGTGACAGAGTCAGG + Intergenic
982314363 4:154016576-154016598 CCAGGTAGGGAGGCTGACTCTGG - Intergenic
982431255 4:155324349-155324371 CAAGCAAGGGAGACTGTATTAGG + Intergenic
982701914 4:158666167-158666189 CCAGCGAGGGAGGCTGAGGCAGG + Intergenic
983250640 4:165342386-165342408 CCAGCCAAGGAGACAGAGTGTGG - Exonic
983479657 4:168257195-168257217 CCAGCTTGGGAGACTGAGGCAGG + Intronic
986545378 5:8891420-8891442 CCATCCAGGAACACTGACTCTGG + Intergenic
986797810 5:11229491-11229513 CCAGCCTGGGTGACAGAAACAGG + Intronic
988630883 5:32930435-32930457 CCAGCCTGGGAGACAGAACAAGG - Intergenic
989270182 5:39523867-39523889 ACAGCGAGGGGGACTGAATGGGG + Intergenic
991403749 5:66281457-66281479 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
991974412 5:72172067-72172089 CCAGCCAGGATGAATAAATCTGG - Intronic
994388530 5:99161998-99162020 CCAGCATGGGAGGCTGAAGCAGG - Intergenic
994993887 5:107034852-107034874 CCACCCAGAGGTACTGAATCAGG + Intergenic
996858056 5:128031882-128031904 CCAGCTAGGGAGGCTGAGGCAGG + Intergenic
997397323 5:133573212-133573234 CCAGCCTGGGAGACAGAGTAAGG + Intronic
997512548 5:134463483-134463505 CGAGCCAGGCAGGCTGACTCTGG - Intergenic
998037137 5:138926754-138926776 CCAGCCAAGGAGACTGAGAAGGG - Intronic
998273356 5:140727616-140727638 CCAGCCTGGGAGACAGAGACAGG - Intergenic
998302357 5:141036163-141036185 CCAGCAAAGGAGACTGAAGGAGG - Intergenic
999145555 5:149390998-149391020 CCAGCCTGGGTGACAGAATCAGG - Intronic
999165502 5:149545916-149545938 CCAGCCTGGGCGACAGAATGAGG - Intronic
999216405 5:149939187-149939209 CTGGCCAGGGACACTGACTCAGG + Intronic
999243127 5:150138884-150138906 CCAGCCAGGGAGACTGGGAGAGG - Intronic
999992318 5:157060925-157060947 CCAGCCTGGGTGACAGAGTCAGG - Intergenic
1001419950 5:171578879-171578901 CCAGCCAGGGTGACTCTATTTGG - Intergenic
1001566110 5:172700539-172700561 CCTGCCACGGAGGCTGAACCTGG - Intergenic
1001839032 5:174857559-174857581 AAACCCAGGGAGACTGAAGCAGG - Intergenic
1002683956 5:180992490-180992512 CCAGTCAGGGAGTCTGCATTTGG + Intronic
1002986357 6:2192786-2192808 CCTCCAAGGGAGACTGAGTCAGG - Intronic
1003211389 6:4070964-4070986 CCAGCCTGGGTGACAGAATGAGG + Intronic
1003333799 6:5151932-5151954 CCAGCCAGGGAGACAAAATGGGG - Intronic
1004354928 6:14922588-14922610 CCTGCCAGGGGGAGTGACTCAGG - Intergenic
1004366536 6:15017895-15017917 CCTGCCAGTGAGTCTGAATCTGG - Intergenic
1004663841 6:17733563-17733585 CCAGCGAGGGAGGCTGAGACAGG - Intergenic
1004808998 6:19238961-19238983 CCAGCCCAGGAGTCTGAATTCGG + Intergenic
1005115263 6:22329179-22329201 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1005563407 6:27064654-27064676 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1006097464 6:31665121-31665143 CCAGCGCGGGAAACTGAACCCGG - Intronic
1006284532 6:33082425-33082447 CCACCCAGGGAATCTGAGTCTGG - Intronic
1006552750 6:34838827-34838849 CCAGCCACTCAGACTGAAGCGGG + Intronic
1006662929 6:35664002-35664024 GGAACCAGGGAGACTGACTCTGG + Intronic
1006800900 6:36759101-36759123 CCAGCTGGGGAGAATGAACCCGG + Intronic
1006804816 6:36781216-36781238 CCAGACAGGGAGAAGGAAGCTGG + Intronic
1006940576 6:37749338-37749360 CTAGCTAGGGAAACTGATTCAGG - Intergenic
1008243378 6:49141370-49141392 CCAGCCTGGGAGACGGAATGAGG - Intergenic
1010215507 6:73397830-73397852 CCAGCCTGGGAGACAGAATGAGG - Intronic
1010540612 6:77088000-77088022 CCAGCCAGGGAAGCTCAAACTGG - Intergenic
1011893811 6:92199606-92199628 CCAGCCTGGAAGACAGAATGAGG - Intergenic
1012898150 6:104975676-104975698 CCAGCCTGGGAGACAGAACAAGG - Intronic
1013462970 6:110393167-110393189 CCACCCAGGGAGCCTGAACTTGG + Exonic
1014153498 6:118085525-118085547 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1017893762 6:158661023-158661045 CCAGCCTGGGTGACAGAATGAGG + Intronic
1018583818 6:165334183-165334205 CCAGCCAAGTATACTGAAGCAGG + Intronic
1018798202 6:167203381-167203403 CCAGACAGGGATAGTGAGTCAGG + Intergenic
1018814510 6:167320795-167320817 CCAGACAGGGATAGTGAGTCAGG - Intergenic
1019219671 6:170463743-170463765 CCAGCCTGGGAGAAGGACTCAGG + Intergenic
1020752221 7:12156305-12156327 CCAGCCTGGGTGACAGAATAAGG + Intergenic
1021815983 7:24448076-24448098 CCAGCCTGGGAGACTAAGTGAGG + Intergenic
1022310319 7:29190962-29190984 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1022944777 7:35271589-35271611 CCAGCCACAGAGACTGAAAAAGG + Intergenic
1023878965 7:44307893-44307915 CCAGCCTGGGTGACAGAATGAGG - Intronic
1024355508 7:48410256-48410278 CCAGGCACGGAGAGTGAAACTGG - Intronic
1024581468 7:50804335-50804357 CCAGCCAGGGAAGGTGCATCAGG + Intergenic
1024732968 7:52273503-52273525 CCAGCCTGGGTGACGGAATGAGG + Intergenic
1025159750 7:56646213-56646235 CCAACCAAGGATACTTAATCTGG + Intergenic
1025746902 7:64250616-64250638 CCAGCCTGGGTGACGGAATGGGG - Intronic
1025755942 7:64340828-64340850 CCAACCAAGGATACTTAATCTGG - Intronic
1027594326 7:80153950-80153972 CCAGCCTGGGTGACAGAATGAGG - Intronic
1028641765 7:93050166-93050188 CCAGCTAGGGAGGCTGAGGCAGG + Intergenic
1029176962 7:98671454-98671476 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1030034135 7:105394170-105394192 CCAGCCTGGGCGACAGAATGAGG - Intronic
1030704918 7:112682552-112682574 CCAGCCTGGGAGACAGAATGAGG - Intergenic
1030934588 7:115569656-115569678 GCAGCCAGGTGGTCTGAATCTGG - Intergenic
1032168487 7:129564542-129564564 CCAGCTAGGGAGGCTGAGGCAGG + Intergenic
1032639546 7:133750608-133750630 CCAGCCTGGGAGACAGAATGAGG - Intronic
1034078232 7:148252761-148252783 GGAGCCAGGGAGCATGAATCAGG - Intronic
1035173111 7:157031518-157031540 CCAGCCTGGGTGACAGAATGAGG - Intergenic
1035208943 7:157313583-157313605 CCAGCCTGGGTGACAGAATCAGG + Intergenic
1035260713 7:157659772-157659794 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1035459722 7:159031367-159031389 CCAGCCAGGGAGGCTGTCTCCGG - Intronic
1036660490 8:10705200-10705222 CCAGCCAGGATGAGTGATTCTGG + Intronic
1037315175 8:17593774-17593796 CCAGCTAGGGAGGCTGAGGCAGG + Intronic
1037875537 8:22545436-22545458 CTAGCCAGCGAGAGTGAATGGGG + Intronic
1038961354 8:32523811-32523833 CCAGCCTGGGAGACAGAGTGAGG + Intronic
1039090535 8:33823875-33823897 CCAGCCTGGGAGACAGAGCCAGG + Intergenic
1039557850 8:38489521-38489543 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1039792167 8:40884723-40884745 CCAGCAATGGGGACTGAAGCAGG - Intronic
1041360804 8:57051943-57051965 ACAGAAAGGAAGACTGAATCAGG + Intergenic
1042133807 8:65615675-65615697 CCAGCCTGGGTGACAGAATGAGG + Intronic
1043397268 8:79851182-79851204 CTACCCAGGGAGGCTGAAGCTGG + Intergenic
1043514077 8:80980016-80980038 CCAGCCTGGGAGACAGAAAGAGG - Intronic
1044447581 8:92296870-92296892 CCAGTGAGGAAGAATGAATCAGG + Intergenic
1044655974 8:94549001-94549023 CCAGCCTGGGAGGCTGAAGTGGG - Intronic
1044837742 8:96312774-96312796 CCAGCCAGGGAAGGTGAAACAGG + Intronic
1045518315 8:102880706-102880728 CAAGCCAGATAGACTGAAGCAGG - Intronic
1045520059 8:102895734-102895756 CCAGCCTGGGTGACAGAATGAGG - Intronic
1045751191 8:105485816-105485838 CCAGACAAGGAGACTGAAAAGGG + Intronic
1048501706 8:134982415-134982437 CTACTCAGGGAGACTGAAGCTGG - Intergenic
1048675478 8:136773809-136773831 CCAGCCAGGTAGACAGTATAGGG + Intergenic
1048754006 8:137714494-137714516 AGAGCTGGGGAGACTGAATCAGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049379798 8:142306301-142306323 CCAGCCCGTGAGAGTGAAGCAGG + Intronic
1049505110 8:142992013-142992035 CCAACCTGGGAGACTGAAGCAGG - Intergenic
1049653471 8:143787589-143787611 GCAAACAGGGAGACTGAATGTGG - Intergenic
1049684565 8:143934167-143934189 ACAGCCAGGGAGACCGGAGCGGG - Intronic
1049817334 8:144612149-144612171 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817342 8:144612197-144612219 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817350 8:144612245-144612267 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817358 8:144612293-144612315 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817366 8:144612341-144612363 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817374 8:144612389-144612411 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817382 8:144612437-144612459 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817390 8:144612485-144612507 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817398 8:144612533-144612555 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817406 8:144612581-144612603 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817414 8:144612629-144612651 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817422 8:144612677-144612699 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1049817430 8:144612725-144612747 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1050317660 9:4419748-4419770 CCAGCCTGGGAGACAGAATGAGG + Intergenic
1050480216 9:6080550-6080572 GCAGCCAGAGGGACGGAATCGGG - Intergenic
1051254836 9:15202680-15202702 CCAGCCTGGGTGACAGAATGAGG + Intronic
1051878756 9:21818355-21818377 CCAGCCTGGGAGACAGAGTGAGG - Intronic
1052263336 9:26543212-26543234 CCTCCCAGGAAGACTGAAACAGG + Intergenic
1052827205 9:33185962-33185984 GCAGCCAGGGAGCATGAACCAGG - Intergenic
1052919577 9:33953649-33953671 CAAGCCACAGAGACTGAAGCAGG + Intronic
1053236850 9:36462919-36462941 CCAGCAGGGGAGACTGAGGCAGG - Intronic
1053648771 9:40141845-40141867 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1053857782 9:42355986-42356008 CCAGCCAGGGAGCCTCCAGCAGG + Intergenic
1054535810 9:66234325-66234347 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1055517111 9:77044356-77044378 CCAGCTAGAGATACTTAATCTGG + Intergenic
1055852092 9:80644251-80644273 GCTGCCTGGGAGGCTGAATCTGG - Intergenic
1056158087 9:83859641-83859663 GCAACCAGGGAGGCTGAAGCAGG - Intronic
1056352464 9:85764416-85764438 GCAACCAGGGAGGCTGAAGCAGG + Intergenic
1056783404 9:89568892-89568914 CAAGCTAGGCAAACTGAATCTGG - Intergenic
1057950156 9:99363471-99363493 CCAGCATGGGAGACTGCACCAGG - Intergenic
1058227892 9:102389145-102389167 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1059122322 9:111652401-111652423 CCAGCTAGGGAGGCTGAGGCAGG + Intronic
1059186712 9:112280167-112280189 CCAGCTAGGGAGGCTGAGGCAGG - Intronic
1059247641 9:112862229-112862251 GCAGCCAGGGTCTCTGAATCAGG - Intronic
1059313754 9:113406687-113406709 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1060357373 9:122922206-122922228 CCAGCCTGGGTGACAGAATGAGG + Intronic
1061151687 9:128832231-128832253 CTATCCAGTGAGACTCAATCGGG + Intergenic
1061188336 9:129068112-129068134 CCAGATGGGGAGACTGAAGCTGG - Intronic
1061252313 9:129433505-129433527 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1061513730 9:131076506-131076528 CCAGCCATGGTGACTGGCTCAGG - Intronic
1061875418 9:133541122-133541144 CCGGCCTGGGATGCTGAATCAGG - Intronic
1062539621 9:137035800-137035822 GCAGCCAGGGACTCTGAACCCGG + Exonic
1203687637 Un_GL000214v1:10214-10236 CCAGCTTGGGAGACTGAGGCAGG + Intergenic
1203648638 Un_KI270751v1:93839-93861 CCAGCTTGGGAGACTGAGGCAGG - Intergenic
1185748439 X:2590658-2590680 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1185785000 X:2883212-2883234 CCAGCCAGGGCGACAGAGTGAGG + Intergenic
1185811652 X:3115826-3115848 CCAGCCTGGGAGACAGAGTGAGG + Intergenic
1186005278 X:5063577-5063599 CCAGCTCGGGAGGCTGAAGCGGG + Intergenic
1186792603 X:13013508-13013530 CAAACCAGGCAGCCTGAATCAGG - Intergenic
1187225873 X:17375229-17375251 CCAGCCAGGGAGAGAGATCCCGG + Intergenic
1187882555 X:23860540-23860562 CCAGCCTGGGAGACCGAGTGAGG - Intronic
1188053223 X:25511928-25511950 CCAGCCAGGGCGACAGAGTGAGG - Intergenic
1188928312 X:36073298-36073320 CCAGCCAAAGAGACTGAACCAGG - Exonic
1189075506 X:37909954-37909976 CCAGCCAGGCATGATGAATCAGG - Intronic
1190129495 X:47734127-47734149 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1193569261 X:83122158-83122180 ACAGCCAGGAAGAAGGAATCTGG - Intergenic
1194216217 X:91133349-91133371 CCAGCCTGGGTGACAGAATGAGG + Intergenic
1194908321 X:99607024-99607046 AAAGCCAGGTAGACTGATTCTGG - Intergenic
1195106263 X:101604380-101604402 CCAGCCTGGGAGACAGAGTGAGG - Intergenic
1196617523 X:117784817-117784839 CCAGCCTGGGTGACAGATTCTGG - Intergenic
1198238770 X:134762790-134762812 CCAGCCTGGGTGACAGAATGAGG + Intronic
1198323248 X:135540784-135540806 CCAGCCTGGGTGACAGAACCAGG - Intronic
1200065440 X:153502316-153502338 CCTCCCAGGGAGAGTGAGTCAGG - Intronic
1200160161 X:154003028-154003050 CCAGCCTGGGTGACAGAATGAGG + Intergenic