ID: 1182167105

View in Genome Browser
Species Human (GRCh38)
Location 22:28186895-28186917
Sequence CTGCTACTTTCTTGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182167105 Original CRISPR CTGCTACTTTCTTGGAAAGA AGG (reversed) Intronic
904159554 1:28512955-28512977 CTGCTAATTTTTTGTAGAGATGG + Intronic
905946122 1:41902564-41902586 CTCCAACTCTCTTGGCAAGAGGG + Intronic
907487136 1:54786069-54786091 CTTCTACTTCCTGGGAAAGCAGG - Exonic
907659326 1:56377601-56377623 CTGCTGGTTTCTTGGCAGGATGG + Intergenic
907947298 1:59147246-59147268 CTGCTACTCTGGGGGAAAGAAGG - Intergenic
908113329 1:60918150-60918172 CTGGAACTTTCTAGGAAAGCAGG + Intronic
908125036 1:61022252-61022274 TTAATACTTTCTAGGAAAGATGG - Intronic
909397747 1:75189223-75189245 CTGCTTCTTTCTTGGGATAAAGG + Intergenic
912389031 1:109288956-109288978 CTACTACTTGCCTGGAGAGAGGG - Intergenic
914954744 1:152151435-152151457 CTGCTAGAATCATGGAAAGAAGG + Intergenic
915560525 1:156684622-156684644 CTCCTTCTTTCTGGGAAAGAAGG + Intergenic
915891325 1:159776752-159776774 CTTGTTCTGTCTTGGAAAGAAGG - Intergenic
917439468 1:175054442-175054464 GTGTTTCTTTCTTGGAGAGAGGG + Intergenic
918788453 1:188795124-188795146 CTTCTATTTGCTTAGAAAGAAGG + Intergenic
920072132 1:203309780-203309802 GAGCTACTTTCCAGGAAAGAGGG - Intergenic
923199021 1:231694049-231694071 CTGCTGCACTCTTGGAAACAGGG - Exonic
923223002 1:231913468-231913490 CTGCTACAATCAGGGAAAGAAGG - Intronic
1063226003 10:4015687-4015709 CTTCTACTTAATTTGAAAGAAGG - Intergenic
1068985012 10:63099440-63099462 CTGTTACTTTCTTTGAGACAGGG - Intergenic
1069608536 10:69756789-69756811 CATCTACTTTCTTTTAAAGATGG + Intergenic
1070051370 10:72893300-72893322 CTGCAACTGTCTTGGTCAGATGG - Intergenic
1070586987 10:77774005-77774027 CTGCTACTAATCTGGAAAGAAGG - Intergenic
1071255429 10:83868008-83868030 CTGCTTCTCTCCTGGGAAGAGGG + Intergenic
1071466963 10:85950132-85950154 CTTTTACTTTCATGGAAATAGGG + Intronic
1071866897 10:89745018-89745040 CAGCTACTTTCTAGGTAAAAGGG + Intronic
1071967996 10:90872269-90872291 CAGCTACTTTCCTGCAATGAGGG + Intronic
1072250043 10:93574473-93574495 CTACTGCTGTCTTGGAATGAGGG + Intronic
1074774744 10:116759157-116759179 CAGAAACTTTCTTGGATAGAAGG - Intergenic
1075610141 10:123847091-123847113 CTACAATTTTATTGGAAAGATGG + Intronic
1077699163 11:4424003-4424025 CTCCTGCTTTCTTGTGAAGAAGG + Intergenic
1077744998 11:4892683-4892705 ATAGTACTTTCTTTGAAAGAAGG - Intronic
1079007038 11:16799043-16799065 CGGCTACTGTCTTGGACAGCAGG - Intronic
1081176438 11:39932920-39932942 TTCCTTATTTCTTGGAAAGAAGG + Intergenic
1084273119 11:68039365-68039387 CTGCTGCTTCCTTGGAGGGAGGG + Intronic
1085721262 11:78914285-78914307 CAGGGAATTTCTTGGAAAGAAGG + Intronic
1089202771 11:116734484-116734506 CTGCTGCTTTCTTGGAAACAGGG - Intergenic
1090262793 11:125333593-125333615 CTGCCACTCACTTGGCAAGACGG - Intronic
1091100445 11:132868096-132868118 CTGCTACTTCTGTGGAAAGCGGG + Intronic
1091354327 11:134924033-134924055 CTGGTACTTCCTTGGTAGGAGGG - Intergenic
1092599015 12:10038555-10038577 CTACTACTTAATTGGAAAAAGGG + Intronic
1094292317 12:28865671-28865693 CTCCTAATTTCCTGGAAACAAGG - Intergenic
1095132574 12:38561407-38561429 CTGCTAGTTTCCTTTAAAGATGG - Intergenic
1096129477 12:49146272-49146294 CTTCTATTTTTTTGGAAACACGG - Intergenic
1096320920 12:50612098-50612120 CTGCTAATTTTTTGTAGAGATGG - Intronic
1096755685 12:53797480-53797502 TTTCTACTTTCTTTCAAAGAGGG + Intergenic
1096777028 12:53970478-53970500 CTGCTACGGTCAAGGAAAGAAGG - Intergenic
1098930244 12:76403986-76404008 CTGCTACTTGGTATGAAAGATGG + Intronic
1099612501 12:84892033-84892055 CTGCGTCTTCATTGGAAAGAAGG + Exonic
1100105684 12:91169224-91169246 CAGCTAATTTTTTGTAAAGATGG - Intronic
1102619661 12:114183860-114183882 CTGCTACTTTAGTGTAATGAAGG + Intergenic
1102882386 12:116495562-116495584 CTACTCCTTTCTTCAAAAGAAGG - Intergenic
1103182212 12:118923260-118923282 CTGCTATTTTCTGGGGAACAAGG + Intergenic
1103529568 12:121591459-121591481 CTGCTAATTTTTTGTAGAGATGG - Intergenic
1103607543 12:122098322-122098344 CTTTTAGGTTCTTGGAAAGATGG + Intronic
1104725922 12:131075695-131075717 CTGCTGCTTCCTGGGAAAGGAGG + Intronic
1106045285 13:26134149-26134171 CTGATACTTTCCTGGCATGAAGG + Intronic
1106070553 13:26407125-26407147 CTGGAACAGTCTTGGAAAGAAGG - Intergenic
1107443645 13:40450390-40450412 ATGCTAATTTCTTGGTGAGATGG + Intergenic
1108025016 13:46168647-46168669 CTCCTAGTTTCTAGGCAAGACGG + Intronic
1109946788 13:69444994-69445016 CAGCTTCTTTCTTGGAGAGTGGG - Intergenic
1110017136 13:70421012-70421034 GTGCAACTTTCTTAGAAAGGAGG - Intergenic
1113287678 13:108870512-108870534 CTGGTATTTTCTTTGCAAGAAGG + Intronic
1114059230 14:19003813-19003835 CAGCTACTTACCTGGAAATAAGG - Intergenic
1114103315 14:19397941-19397963 CAGCTACTTACCTGGAAATAAGG + Intergenic
1116466245 14:45235814-45235836 CTGCTTCTTTCATGGAAATTTGG + Exonic
1116589244 14:46750092-46750114 CTGATACAGTCTTGGAAAGCTGG - Intergenic
1116677288 14:47922041-47922063 ATGCTACATCCCTGGAAAGATGG - Intergenic
1120194323 14:81465966-81465988 CTCCTGCTTTCTTGGGAACAGGG + Intergenic
1120834724 14:89029325-89029347 ATGCTACTTTCTTGCAAGCATGG + Intergenic
1121086735 14:91152218-91152240 CTGTTATTTTTTTGTAAAGATGG - Intronic
1123510953 15:20999413-20999435 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1123568176 15:21573172-21573194 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1123604283 15:22008494-22008516 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1125712241 15:41796329-41796351 CTACCACCTTCTTGGAAAGGAGG + Intronic
1126715820 15:51516302-51516324 CAGCTACTACCTAGGAAAGAAGG - Intronic
1127778426 15:62288874-62288896 ATGCTACTTTGTTGGAAATCCGG - Intergenic
1128154964 15:65386282-65386304 CTGCCAGCATCTTGGAAAGAGGG - Intronic
1202976533 15_KI270727v1_random:300260-300282 CTCTTAGCTTCTTGGAAAGAAGG + Intergenic
1134516307 16:14889899-14889921 CTGCTACTTTACAGGAAATAGGG + Intronic
1134703981 16:16288551-16288573 CTGCTACTTTACAGGAAATAGGG + Intronic
1134963562 16:18423563-18423585 CTGCTACTTTACAGGAAATAGGG - Intronic
1134967857 16:18506162-18506184 CTGCTACTTTACAGGAAATAGGG - Intronic
1136162660 16:28430745-28430767 CTGCTAATTTTTTGTAAAGGTGG + Intergenic
1136200306 16:28684243-28684265 CTGCTAATTTTTTGTAAAGGTGG - Intergenic
1136216654 16:28798436-28798458 CTGCTAATTTTTTGTAAAGGTGG - Intergenic
1137697737 16:50473592-50473614 CTGCTACCTTGTGGGAGAGAAGG - Intergenic
1138380304 16:56596331-56596353 TTTCTAATTTTTTGGAAAGACGG - Intergenic
1141477198 16:84281838-84281860 CAGTTACTTTCCTGGAAAGTTGG + Intergenic
1142067082 16:88068831-88068853 CTCTTCCTTTCTTGGGAAGAAGG + Intronic
1142404711 16:89881613-89881635 CTGCTAATTTTTTGTAGAGATGG + Intronic
1144732578 17:17537178-17537200 CTGCTGCTGCCCTGGAAAGAAGG + Intronic
1146416579 17:32639414-32639436 ATGCTACTTTATTAGACAGAGGG + Intronic
1146449340 17:32960126-32960148 CTCCTTCTTTCTTGGAGACAGGG + Intergenic
1147791887 17:43018883-43018905 CTGCTACTTCATTTGGAAGAAGG - Intronic
1149086217 17:52719397-52719419 CTGCTATTTCAGTGGAAAGAAGG - Intergenic
1151178844 17:72311235-72311257 ATGTGACTTTTTTGGAAAGAGGG + Intergenic
1151236445 17:72723413-72723435 CTACTACTTACTCTGAAAGATGG - Intronic
1156056940 18:33017327-33017349 ATGCTATTTTGTTGGAATGATGG - Intronic
1156470000 18:37371472-37371494 CTGCTACATTCCTGCAGAGAAGG - Intronic
1156503706 18:37575897-37575919 CTGCGACTTCCTAGGAGAGACGG + Intergenic
1156594464 18:38532002-38532024 GTACTACTTTCTTAGGAAGACGG - Intergenic
1157262373 18:46187158-46187180 CTACTACTTTTTTAAAAAGACGG + Intronic
1157428345 18:47602749-47602771 CAGCTCCTGACTTGGAAAGATGG + Intergenic
1158201596 18:54947751-54947773 CTGCTTCTTTCCTGGAAGAAAGG - Intronic
1158445142 18:57513444-57513466 CTTCTTCTTTCTTGAATAGAGGG + Intergenic
1158742842 18:60163898-60163920 TTTCTGCTTTCTTGGCAAGAGGG + Intergenic
1161032517 19:2064756-2064778 CTCCTACTTTGTGGGAAAGAGGG - Intergenic
1161408944 19:4105832-4105854 CTGCTAATTTTTTGTAGAGACGG + Intronic
1162608129 19:11727566-11727588 CTGTAACTTTCTTGGTTAGAAGG - Intronic
1162613560 19:11776412-11776434 CTGTTGCTTTCTTGGTTAGAAGG + Intronic
1164983808 19:32633491-32633513 CCGCTAATTTTTTGTAAAGATGG + Intronic
1165281745 19:34803734-34803756 CTGGTAATTTCTTGGCAAGAAGG - Intergenic
1166112535 19:40631499-40631521 CAGCTACTTTTTTGTAGAGATGG - Intergenic
1167838591 19:52095564-52095586 CTCCTACTTACTTGGGACGAAGG + Intronic
1202635934 1_KI270706v1_random:44404-44426 CAGCTACTTACCTGGAAACAAGG + Intergenic
926287412 2:11500700-11500722 CTGTTACTTACTAGGGAAGATGG + Intergenic
926861423 2:17314026-17314048 CTGCTATTTTCTTAGTAATATGG + Intergenic
926942612 2:18154225-18154247 ATGCTACCTTTTTGGCAAGAGGG + Intronic
927523742 2:23719222-23719244 CTGTTACAGTCTTGGGAAGAAGG - Intergenic
928289849 2:30027555-30027577 CTGATACATTCTTTGAAAGCAGG - Intergenic
929253769 2:39787024-39787046 CCGCTACGGTTTTGGAAAGATGG + Intergenic
929379246 2:41330881-41330903 CCTCTACCTTCTTGGACAGATGG - Intergenic
929689604 2:44063352-44063374 CAGCTACTATCTTGGAAGGGAGG + Intergenic
929785257 2:44985458-44985480 CTGCTAAATTAATGGAAAGATGG - Intergenic
930513994 2:52382215-52382237 CTGATAATATGTTGGAAAGAGGG + Intergenic
934700705 2:96437749-96437771 CTCCTGCTGTCTTGTAAAGAAGG + Intergenic
936807248 2:116350011-116350033 CTGCTACCCTCTTGGACAGCTGG - Intergenic
937247597 2:120503549-120503571 CTGCTAATTTCTGGGAACAATGG - Intergenic
938197938 2:129347766-129347788 CCACCACTTTCTTGGCAAGAAGG + Intergenic
938281953 2:130070428-130070450 CAGCTACTTACCTGGAAATAAGG + Intergenic
938332577 2:130459000-130459022 CAGCTACTTACCTGGAAATAAGG + Intergenic
938357231 2:130661671-130661693 CAGCTACTTACCTGGAAATAAGG - Intergenic
938376796 2:130813196-130813218 CTGCTTATTTCTTGGTAAAAGGG + Intergenic
938433666 2:131268475-131268497 CTGCTACTTACCTGGAAATAAGG - Intronic
938477693 2:131631065-131631087 CAGCTACTTACCTGGAAATAAGG - Intergenic
939394843 2:141615113-141615135 CTGCTACTTTGTGACAAAGATGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941868050 2:170355050-170355072 CTGCTGCTTTTTTGGAGAGATGG - Intronic
944444127 2:199772824-199772846 CTTCTCCTTTCTGAGAAAGATGG + Intronic
944676490 2:202036804-202036826 TGGCTGCTTTGTTGGAAAGAGGG + Exonic
944689414 2:202146330-202146352 CTGCTACTTTTTTATAGAGATGG - Intronic
945357674 2:208858217-208858239 GTGCTGCTCTCGTGGAAAGAAGG - Intergenic
946656107 2:221949658-221949680 CTCATACTTTCTTACAAAGATGG - Intergenic
947176451 2:227372318-227372340 CTTCTACTTTCTTGGTAGAAGGG + Intronic
948524579 2:238563193-238563215 ATTCTACATTTTTGGAAAGAGGG - Intergenic
948743420 2:240065632-240065654 CTGGCATTTTCTTGGTAAGAAGG + Intergenic
1171882088 20:30625460-30625482 CAGCTACTTACCTGGAAATAAGG + Intergenic
1173243163 20:41316220-41316242 CTGTTGCTGCCTTGGAAAGATGG - Intronic
1176962350 21:15173679-15173701 CTTCCACTTTCCTGGAAAGTTGG + Intergenic
1176964123 21:15192945-15192967 CTGCTAGTTTTTTGTAGAGACGG + Intergenic
1177581126 21:23022545-23022567 CTGCTACTTTGTAGGAGAGATGG + Intergenic
1178828903 21:36038680-36038702 TTGCTACTATTTTGGACAGACGG - Intronic
1179942704 21:44650109-44650131 CAGCTACTTTGGTGGGAAGACGG + Intronic
1180148796 21:45937083-45937105 CTGCTACCTTCTTGGAGAAAAGG + Intronic
1180364778 22:11928836-11928858 CAGCTACTTACCTGGAAACAAGG - Intergenic
1180477712 22:15726429-15726451 CAGCTACTTACCTGGAAATAAGG - Intergenic
1182167105 22:28186895-28186917 CTGCTACTTTCTTGGAAAGAAGG - Intronic
1184163802 22:42715549-42715571 CTGCTAATTTTTTGCAAAGAAGG - Intronic
1184710694 22:46247753-46247775 ATGCCACTTTGTTGGAAAGCTGG - Intronic
1185308432 22:50137262-50137284 CTTCTACTTTCTTGAACACATGG - Intronic
949282236 3:2359940-2359962 CTACTACTTCCTTTGAAACAAGG - Intronic
949443986 3:4114064-4114086 CAGCTAATTTCTTGGGTAGAAGG + Intronic
949471508 3:4401489-4401511 CTGCTGCTTGCTTGGAAAGTAGG - Intronic
950032186 3:9860538-9860560 CTGCATCTATCTTGGAAAGGTGG - Intergenic
950416967 3:12874350-12874372 CTGCATCTACCTTGGAAAGATGG - Intergenic
951421785 3:22494941-22494963 CTATTCCTTTCCTGGAAAGATGG + Intergenic
951958592 3:28287440-28287462 CTCCTACTGTTTTGGTAAGAGGG + Intronic
952418305 3:33109165-33109187 CTGCTAATTTTTTGTAGAGATGG + Intergenic
952478561 3:33736228-33736250 CTGCAACCTTCTTTGAAGGATGG + Intergenic
952871496 3:37904895-37904917 TGGCTAGTTACTTGGAAAGATGG - Intronic
953184535 3:40625827-40625849 CTCCTAGTTTCTTGAAAAGTAGG - Intergenic
953514853 3:43579980-43580002 CAGCTAATTTTTTGTAAAGACGG - Intronic
956603429 3:71047813-71047835 CTGCTTTGTTCTTGAAAAGAAGG + Intronic
959065571 3:101653693-101653715 CCTCTACTTTCGTGGAGAGATGG - Intronic
959407013 3:105972446-105972468 CTTCTACTGCCTTGTAAAGAAGG - Intergenic
959681472 3:109101317-109101339 CTGATACTACCTGGGAAAGAAGG + Intronic
960383860 3:116995914-116995936 TTGTTACTTTCTTTGAGAGATGG - Intronic
961645357 3:128389896-128389918 CTGCTACCAACATGGAAAGAAGG - Intronic
964164738 3:153689356-153689378 CTCCTGCTTTCTGGGAAAGCTGG + Intergenic
964641363 3:158913298-158913320 CTGCTAAAAACTTGGAAAGAAGG - Intergenic
964808659 3:160639123-160639145 ATGCTACTATCTTGCAAACAAGG + Intergenic
967409608 3:189154102-189154124 CTGCTTTTTTCTTGGATGGAAGG + Intronic
970333889 4:15011629-15011651 CTCCTATTTTTTTGGGAAGAGGG - Intronic
970378292 4:15480631-15480653 CTGTTCCTCTCTTGGGAAGATGG - Intronic
970587676 4:17530127-17530149 CTGCTCCCTTCTTGGCATGATGG - Intergenic
972244482 4:37230172-37230194 CTGATAGATTGTTGGAAAGAAGG + Intergenic
972798979 4:42452727-42452749 CTGGTACTTTCTTTGTAACATGG + Intronic
973365756 4:49207920-49207942 CAGCTACTTACCTGGAAATAAGG + Intergenic
973394841 4:49584533-49584555 CAGCTACTTACCTGGAAATAAGG - Intergenic
974659588 4:64869655-64869677 CTGTCATTTTCTTGGAAAAAAGG - Intergenic
975980017 4:80146627-80146649 TTGCTACTTTCCTTGACAGAGGG - Intergenic
980079932 4:128333523-128333545 CTGCTAATGACTAGGAAAGAAGG + Intergenic
980385036 4:132078010-132078032 ATACTACATTCTTGGAAAGGTGG + Intergenic
981742275 4:148015252-148015274 GGGGTACTTTGTTGGAAAGAAGG + Intronic
983075752 4:163324300-163324322 GTGTTACTTCCTTTGAAAGATGG + Exonic
983641571 4:169948241-169948263 CTCCTACTTTATGGGGAAGATGG - Intergenic
984260202 4:177435876-177435898 CTCCCACTGGCTTGGAAAGAAGG - Intronic
984449718 4:179883768-179883790 TTGCTCCTTTCTTGGCAAGGAGG - Intergenic
1202763255 4_GL000008v2_random:130267-130289 CAGCTACTTACCTGGAAACAAGG + Intergenic
986104402 5:4645915-4645937 CAGCTAATTTTTTGGAGAGACGG + Intergenic
986406204 5:7427421-7427443 CTGCTGCTGTCTTGTGAAGAAGG - Intronic
986814413 5:11392711-11392733 CTGCCACTTTCCTGCAAATACGG + Intronic
987546631 5:19318859-19318881 CTACTATTTTCTTGGGGAGATGG - Intergenic
987720594 5:21627892-21627914 CTGTTACTCACTTGGAAAGGCGG - Intergenic
987996059 5:25281194-25281216 CTGCTTCTTTCTTCGGAAGGTGG - Intergenic
988225907 5:28411315-28411337 GTCTTACTTTCTTGGAAAGCAGG + Intergenic
988963075 5:36388896-36388918 CTGCTATTTGCTTGGAAGGAGGG + Intergenic
992704711 5:79379613-79379635 TTGCTATTTTCTTGTACAGAAGG + Intronic
994022699 5:95045890-95045912 CTGATATTTTCTTAGAAAGTGGG + Intronic
994334220 5:98545678-98545700 ATGATTCTTTCCTGGAAAGAGGG - Intergenic
994496358 5:100517934-100517956 CTTCTACTTACTGGGGAAGAGGG + Intergenic
996601296 5:125266976-125266998 GAGCTGCTTTCTTGTAAAGAAGG - Intergenic
996621979 5:125516512-125516534 CTGTTACTATCTTGGGAATAAGG + Intergenic
999309344 5:150541770-150541792 TTCCTACTTCCTGGGAAAGAGGG - Intronic
999388197 5:151170638-151170660 CTGCTACTTTCTTACCATGAAGG - Intergenic
1000293793 5:159895427-159895449 CTGCTACCTTCTTAGAAAACAGG + Intergenic
1000604266 5:163311643-163311665 CTGCTACAGTTTTGGAAAGAGGG - Intergenic
1003816946 6:9851796-9851818 CTGCACCTGTCATGGAAAGAGGG - Intronic
1004204629 6:13580829-13580851 CAGCTACTTTTTTGTAGAGATGG + Intronic
1005952781 6:30643691-30643713 CTTCTACTTTCTTAGACAGCAGG + Intronic
1008118787 6:47585902-47585924 CTGCCTCTATCTTGGAAATACGG + Intronic
1008516357 6:52323120-52323142 CTGCTGATTTCTTGGCAGGAAGG + Intergenic
1010089888 6:71968256-71968278 CTCCTACTTTCATGAAAACAGGG - Intronic
1012123246 6:95393222-95393244 ATGGTACTTTCCTGAAAAGAAGG + Intergenic
1012638936 6:101583818-101583840 ATGCTACCATCCTGGAAAGATGG + Intronic
1013591944 6:111626252-111626274 CTGTTACTTCCCTGGAAAAAGGG - Intergenic
1014846261 6:126281229-126281251 CTACTAATTTCTTGAAAACAGGG - Intergenic
1015672127 6:135702585-135702607 GTGCTAGTTTCTTGAATAGATGG - Intergenic
1016256497 6:142111809-142111831 CTGTTTCTTTCTTGGTAAGATGG + Intergenic
1017791884 6:157807097-157807119 CTGCTCCTATCTTTGAAGGATGG - Intronic
1019307541 7:343056-343078 CTGCTTCTTTCTTTTAAAAAGGG - Intergenic
1019747010 7:2706365-2706387 ATGCTACTCTCTGGGCAAGATGG - Intronic
1023904438 7:44512377-44512399 TGGCTACTTTCTTGAAAAGAGGG + Intergenic
1024777817 7:52808288-52808310 CTGCTATTTTCTTCCATAGATGG - Intergenic
1027171595 7:75876842-75876864 CTGCTTCTTTTTTGTAGAGATGG - Intronic
1028328052 7:89550785-89550807 TTGCCACATTCTTAGAAAGAAGG - Intergenic
1029837984 7:103333283-103333305 CTGTTACTTTTTTCAAAAGAGGG - Intronic
1030380734 7:108808587-108808609 CTGCTAGTTCCTTTGAAAAATGG + Intergenic
1031564110 7:123273443-123273465 CTCCTGATTTCTTGGAAGGAAGG - Intergenic
1032438836 7:131925715-131925737 CAGTTGCTTTCTTTGAAAGAAGG - Intergenic
1034278676 7:149836703-149836725 CTCCATTTTTCTTGGAAAGATGG + Intergenic
1036724125 8:11203970-11203992 CTTCTACTTTCTTTGGAAGAAGG + Intergenic
1038842554 8:31198826-31198848 CTGGTACTTTGTTGGATACATGG + Intergenic
1038975270 8:32688352-32688374 CTGCTCCATGCTTTGAAAGATGG - Intronic
1039759817 8:40562456-40562478 CTGCTACTTATTTTAAAAGAGGG + Intronic
1039846626 8:41330198-41330220 GTGCTAGTTGGTTGGAAAGATGG + Intergenic
1040088762 8:43373088-43373110 CAGCTACTTACTTGGAAATATGG - Intergenic
1041058276 8:54010291-54010313 CTGCTATTTTTTTTTAAAGATGG - Intronic
1042724863 8:71862546-71862568 CTGCTCCTCTCATTGAAAGATGG - Intronic
1045262530 8:100589363-100589385 CTGATACCTTCTTGGAAATAGGG - Intronic
1045357613 8:101403557-101403579 CATCTCCTTTCTTGGAAGGAGGG + Intergenic
1046048664 8:108994038-108994060 GTGCTATTTTCTTTGAAAGAAGG - Intergenic
1046764413 8:118054247-118054269 ATCCTACTTACTAGGAAAGATGG - Intronic
1047743748 8:127828113-127828135 GTTCTACTTTGTTGGACAGAAGG + Intergenic
1048737842 8:137521180-137521202 CTGCATCTTTCTTGAAAACAGGG + Intergenic
1051017089 9:12491569-12491591 TTGCTATTTACTTGGAAAGAAGG + Intergenic
1051359474 9:16269229-16269251 CTGCTCCATTCTGGTAAAGAAGG + Intronic
1052161196 9:25262031-25262053 CTGCTACTTCCTTTGAGTGATGG - Intergenic
1052308914 9:27042762-27042784 CTAGGACTTTCTTGGAAACATGG + Intronic
1055954094 9:81757717-81757739 GAGCTGCTTTCTTGGAAGGAAGG + Intergenic
1056265616 9:84893902-84893924 CTGTTTCTATCTTGGAAAGTAGG - Intronic
1057527977 9:95819254-95819276 CTGCTAATTTTTAGTAAAGATGG - Intergenic
1058754431 9:108071279-108071301 CTGGGAATCTCTTGGAAAGATGG - Intergenic
1059218814 9:112592360-112592382 CTGCTTCTTTCTTTGAGACAGGG - Intronic
1060432967 9:123566261-123566283 CTGCTTCTTTCTTGAGAACATGG + Intronic
1060860702 9:126952438-126952460 CTGCTACTTGCCAGGAAAGGAGG + Intronic
1203544019 Un_KI270743v1:115138-115160 CAGCTACTTACCTGGAAACAAGG + Intergenic
1186366590 X:8901219-8901241 TTGCTTCTTTCATGGAAGGATGG - Intergenic
1187003417 X:15205832-15205854 CAGCTACTTTCTTGTTCAGAAGG - Intergenic
1190306985 X:49089622-49089644 CAGCTACTTTTTTGTAGAGATGG - Intronic
1194863118 X:99029192-99029214 CTGCTAATTTTTTGTAGAGATGG + Intergenic
1194935647 X:99944531-99944553 CTTAAATTTTCTTGGAAAGAGGG - Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196580887 X:117377818-117377840 CTTCTAGTTTCTTGAAGAGATGG - Intergenic
1196615632 X:117764045-117764067 CTGCTACTTTCTAGGAAGGTTGG - Intergenic
1197467096 X:126818465-126818487 ATGCCACTTTCTTGTATAGATGG + Intergenic
1199687779 X:150279972-150279994 CTGCTTCTCTCTTAGAATGATGG + Intergenic
1200110130 X:153736745-153736767 CAGCTACTGTCTGGGAAGGAAGG - Intronic