ID: 1182173410

View in Genome Browser
Species Human (GRCh38)
Location 22:28256623-28256645
Sequence CAGGGTAAAAAGAACAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1344
Summary {0: 1, 1: 0, 2: 2, 3: 98, 4: 1243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182173403_1182173410 26 Left 1182173403 22:28256574-28256596 CCTAAAATTTAGATGGAACCAGA 0: 1
1: 13
2: 488
3: 1922
4: 2576
Right 1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG 0: 1
1: 0
2: 2
3: 98
4: 1243
1182173404_1182173410 8 Left 1182173404 22:28256592-28256614 CCAGAAAAGAACCTGAATAGCCA No data
Right 1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG 0: 1
1: 0
2: 2
3: 98
4: 1243
1182173405_1182173410 -3 Left 1182173405 22:28256603-28256625 CCTGAATAGCCAAAGCAATTCAG No data
Right 1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG 0: 1
1: 0
2: 2
3: 98
4: 1243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182173410 Original CRISPR CAGGGTAAAAAGAACAAGGC TGG Intronic
900904329 1:5541522-5541544 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
901294736 1:8152328-8152350 AAGGGAAAAATGAACAAGTCAGG - Intergenic
901649683 1:10736459-10736481 CAGGTTAAAAACAACAAGCCCGG - Intronic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
905053142 1:35070028-35070050 CTGAGCAAAAAGAACAAAGCTGG - Intronic
905331740 1:37207634-37207656 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
905739527 1:40357867-40357889 CTGAGCAAAAAGAACAAAGCTGG - Intronic
905843118 1:41202328-41202350 GAGGGAAAAAAAAAAAAGGCTGG - Intronic
906222721 1:44094784-44094806 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
906393084 1:45436067-45436089 CTGAGCAAAAAGAACAAAGCTGG - Intronic
906817948 1:48898732-48898754 CTGAGCAAAAAGAACAAGGCTGG - Intronic
906874410 1:49521310-49521332 CTAAGTAAAAAGAACAAAGCTGG + Intronic
906901468 1:49841542-49841564 CTAAGAAAAAAGAACAAGGCTGG + Intronic
907148973 1:52264437-52264459 CGTGGTAAAAAGAATATGGCCGG + Intronic
907583865 1:55597292-55597314 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
908030210 1:59991043-59991065 CAGGGGAAAGAGAACAAGATGGG + Intronic
908295272 1:62706825-62706847 CAGGAAAAAAAAAAAAAGGCTGG - Intergenic
908543319 1:65141794-65141816 CAAGGTGAAAAGACCAAGGGTGG + Intergenic
908879883 1:68719316-68719338 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
908893353 1:68870563-68870585 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
908930118 1:69307864-69307886 CTAGGCAAAAAGAACAAAGCAGG - Intergenic
908981210 1:69961531-69961553 CTGGGCAGAAAGAACAAAGCTGG + Intronic
909268524 1:73593282-73593304 CAAGGTCAAAAAAACAAGTCAGG + Intergenic
909812605 1:79949754-79949776 AAGGGAAAAAAGACCAAGTCTGG - Intergenic
910155980 1:84219890-84219912 CAGAGCAAAAAGAGCAATGCTGG - Intronic
910475845 1:87605902-87605924 CTGAGCAAAAAGAACAAAGCAGG - Intergenic
910648094 1:89535087-89535109 AAGGGGAAAAAGAATATGGCTGG + Intronic
910827388 1:91423816-91423838 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
910925399 1:92393030-92393052 CTGGGCAAGAAGAACAAAGCTGG + Exonic
911486260 1:98510087-98510109 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
911495012 1:98620667-98620689 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
911595664 1:99796059-99796081 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
911619093 1:100046527-100046549 CTGAGCAAAAAGAACAAGGCTGG - Intronic
911667732 1:100572997-100573019 CTCAGTAAAAAGAACAAGGCTGG + Intergenic
911690238 1:100824753-100824775 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
911691620 1:100841067-100841089 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
911837681 1:102642165-102642187 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
912150939 1:106857914-106857936 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
912155344 1:106911845-106911867 AAGGGAAAAGAGAAGAAGGCAGG - Intergenic
912235811 1:107849278-107849300 CTAGGCAAAAAGAACAAAGCTGG + Intronic
912594749 1:110863234-110863256 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
912620702 1:111153895-111153917 TAGAGCAAAAAGAACAAAGCTGG - Intronic
913064333 1:115236303-115236325 CAAGGTAAAAAGAATAAAGCAGG + Intergenic
913096280 1:115519143-115519165 CTGGATAAAAAGAACAAAACCGG - Intergenic
913255139 1:116945977-116945999 CAGTGTAAAGAGACCAAGGAAGG + Intronic
913424730 1:118714835-118714857 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914319610 1:146546491-146546513 CAGGGTTCCAAGAACAAGACTGG + Intergenic
914401935 1:147329279-147329301 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
915036398 1:152929513-152929535 CTTGGAAAAAAGAACAAAGCTGG - Intergenic
915059566 1:153169832-153169854 GAGGGTGAGAAGAATAAGGCAGG - Intergenic
915785044 1:158601352-158601374 CAGGGCAAAAAGAACAAAGCTGG + Intergenic
915997968 1:160583821-160583843 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
916228259 1:162512029-162512051 TTGAGAAAAAAGAACAAGGCTGG - Intronic
917042016 1:170815459-170815481 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
917389977 1:174525084-174525106 CTGAGCAAAAAGAACAAAGCTGG - Intronic
917407967 1:174729025-174729047 CAAAGCAAAAAGAACAAAGCTGG + Intronic
917418830 1:174840505-174840527 TAGGGTATAAAGAAGAAAGCGGG + Intronic
917580455 1:176372392-176372414 CTGAGCAAAAAGAACAATGCTGG - Intergenic
917601723 1:176581402-176581424 CCGAGCAAAAAGAACAAAGCTGG - Intronic
917803253 1:178589943-178589965 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
917888909 1:179417654-179417676 CTGTGCAAAAAGAACAAAGCAGG - Intronic
917991439 1:180383720-180383742 CTGAGCAAAAAGAACAAAGCTGG + Intronic
918364513 1:183792988-183793010 CAAAGCAAAAAGAACAAAGCTGG + Intronic
918503446 1:185224428-185224450 CTGAGCAAAAAGAACAAAGCTGG - Intronic
918651591 1:186970848-186970870 CTGAGCAAAAAGAACAAAGCTGG - Intronic
918664624 1:187134876-187134898 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
918853854 1:189725569-189725591 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
918909975 1:190555107-190555129 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
919034410 1:192288032-192288054 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
919220996 1:194628349-194628371 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
919244204 1:194956879-194956901 CTGAATAAAAAGAACAACGCTGG - Intergenic
919274186 1:195391167-195391189 CCGAGCAAAAAGAACAAAGCTGG - Intergenic
919283563 1:195522985-195523007 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
920127575 1:203705717-203705739 CTCTGTAAGAAGAACAAGGCAGG - Intronic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920461831 1:206146407-206146429 CAGGGAAAAGAGAACTAGACAGG - Intergenic
920606082 1:207387774-207387796 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
920717556 1:208354941-208354963 CAAGGGAAAAAGACAAAGGCTGG + Intergenic
920934743 1:210421184-210421206 CTGAGCAAAAAGAACAAAGCTGG + Intronic
921391780 1:214622913-214622935 AGGGGGAAAAAGAAAAAGGCCGG + Intronic
921640417 1:217546310-217546332 CTGAGCAAAAAGAACAAAGCTGG + Intronic
921947832 1:220898906-220898928 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
922226503 1:223650274-223650296 CTGGGCAGAAAGAATAAGGCAGG - Intronic
922378274 1:224992181-224992203 ATGGGCAAAAAGAACAAAGCAGG - Intronic
922388153 1:225109156-225109178 CTGGGCAAAAAGAACAAAGCTGG - Intronic
922549927 1:226487129-226487151 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
922782102 1:228260652-228260674 CAGTGTAATAAAAACAAGCCAGG - Intronic
923228564 1:231962498-231962520 CTGAGCAAAAAGAACAAAGCTGG + Intronic
923284489 1:232479593-232479615 CAGCGTAAAAAGCTCCAGGCTGG + Intronic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924398465 1:243650844-243650866 CTGAGCAAAAAGAACAAAGCTGG - Intronic
924649519 1:245912555-245912577 CCGAGCAAAAAGAACAAAGCTGG + Intronic
924656717 1:245979232-245979254 CAGGGTAAAAACAACTGGGATGG + Intronic
924707930 1:246513313-246513335 GAGAGTAGAAAGAACAAGGTGGG + Intergenic
1063333895 10:5190557-5190579 CAAAGGAAAAAGAACAAAGCAGG + Intergenic
1063946564 10:11181877-11181899 AAAGGAAAGAAGAACAAGGCAGG - Intronic
1064179385 10:13101057-13101079 CTGGGTCAAAAGAGCAAGGTGGG - Intronic
1064322443 10:14318324-14318346 CAAGGTAAAAAAAAAAAGGTGGG - Intronic
1064898249 10:20263057-20263079 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1065405674 10:25360701-25360723 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1065590150 10:27255216-27255238 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1065994693 10:31046852-31046874 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1066033513 10:31454962-31454984 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1066037195 10:31504396-31504418 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1066257217 10:33691758-33691780 TAAGGAAAAAAGAACAAAGCTGG - Intergenic
1066599525 10:37089723-37089745 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1066798612 10:39156374-39156396 CAGGCTAAAAACAAGAAGGAAGG + Intergenic
1066803636 10:39219083-39219105 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1067230721 10:44407148-44407170 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1067336217 10:45366715-45366737 CTGAGCCAAAAGAACAAGGCTGG + Intergenic
1068014896 10:51503709-51503731 CTGGGTAAAAATAAAAAGGTAGG + Intronic
1068442665 10:57078688-57078710 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1068646603 10:59475068-59475090 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1068702586 10:60035691-60035713 AAGGGTAAGAAAAAAAAGGCGGG + Intronic
1068771962 10:60831685-60831707 CAAGGCAAAAAGAACAAAGCTGG + Intergenic
1070226374 10:74511303-74511325 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1070663266 10:78323739-78323761 CCGAGCAAAAAGAACAAAGCTGG - Intergenic
1071002727 10:80848881-80848903 CTGTGTAAAAAGAATAAAGCTGG + Intergenic
1071145442 10:82565010-82565032 CAGGGCAAAAAGAACACTGTTGG + Intronic
1071193147 10:83125945-83125967 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1071723679 10:88173425-88173447 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1071774699 10:88772695-88772717 CTGAGAAAAAAGAACAAAGCTGG - Intronic
1071799748 10:89045457-89045479 CTGAGCAAAAAGAACAAAGCCGG - Intergenic
1072245448 10:93539942-93539964 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1072366383 10:94714619-94714641 CTGAGTCAAAAGAACAAAGCTGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072777481 10:98213520-98213542 CAGGGGAAAAAGAACAAAAGGGG + Intronic
1073886838 10:108049350-108049372 TAGGGTAAAGAGATCAAGGCTGG + Intergenic
1074721568 10:116270399-116270421 CAGGTTAAAGGGAACAAGACAGG + Intronic
1074861346 10:117512542-117512564 CAGAGTAAAGTCAACAAGGCAGG - Intergenic
1075179705 10:120199197-120199219 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1075199650 10:120391966-120391988 CTGGGTTAAAAAAACTAGGCAGG + Intergenic
1075449233 10:122537309-122537331 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1075961998 10:126575630-126575652 CTGGTCAAAAAGAACAAGGCTGG + Intronic
1076448472 10:130536844-130536866 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1076531032 10:131144578-131144600 CAGGTTAAAAAAAAAAAGACTGG + Intronic
1076703326 10:132285486-132285508 CAGGTTAAAAAGGAAAAGGGTGG + Intronic
1077427837 11:2493789-2493811 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1078690417 11:13574459-13574481 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1079097069 11:17517858-17517880 AAGGGTGATAAGCACAAGGCTGG - Intronic
1079210917 11:18460132-18460154 TAGAGTAAAAAGATCCAGGCTGG + Intronic
1079253678 11:18808003-18808025 TTGAGCAAAAAGAACAAGGCTGG - Intergenic
1079578235 11:22029637-22029659 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
1079586587 11:22132724-22132746 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1079861383 11:25676480-25676502 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1079902952 11:26210425-26210447 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1080489051 11:32743097-32743119 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1080513262 11:32996458-32996480 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1080515566 11:33016258-33016280 CTGGGTAGAAAGAAAAAAGCTGG - Intronic
1080737111 11:35027053-35027075 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1080889109 11:36393619-36393641 CAGAGCAAAAAGAACAAAACTGG - Intronic
1080904295 11:36525037-36525059 AAGGGAAAAAAGAACAAGGAAGG - Intronic
1081079796 11:38727561-38727583 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1081082634 11:38762112-38762134 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1081467849 11:43340482-43340504 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1081920823 11:46774538-46774560 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082728817 11:56770101-56770123 CAGGGGCCAAAGAACAAGGAAGG + Intergenic
1082732094 11:56811486-56811508 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1082856181 11:57809231-57809253 CAGGGAGAAAAGATCAAGTCAGG - Intronic
1082938911 11:58683264-58683286 CTAAGCAAAAAGAACAAGGCTGG + Intronic
1083230148 11:61312154-61312176 CAGAGGAAGAAAAACAAGGCAGG + Intronic
1083732330 11:64659365-64659387 CAGGGCAAAAAGAAAACAGCAGG - Intronic
1085003826 11:73066054-73066076 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1085210978 11:74778033-74778055 CAGGAGAAAGAGAACAGGGCTGG - Intronic
1085442897 11:76579473-76579495 AAGGGGAACAAGAACATGGCTGG + Intergenic
1085443153 11:76581111-76581133 CAGGGTATAAAGAAAAACGGTGG - Intergenic
1085538218 11:77240189-77240211 TTGTGCAAAAAGAACAAGGCTGG + Intronic
1085594556 11:77797210-77797232 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1085965947 11:81526560-81526582 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1086277575 11:85149190-85149212 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1086767303 11:90713097-90713119 CTGAGCAAAAAGAACAAGGCTGG - Intergenic
1086771373 11:90771647-90771669 CTGGACAAAAAGAACAAAGCTGG + Intergenic
1086874621 11:92080444-92080466 CTGAGCAAAAAGAACAAGACTGG + Intergenic
1087063481 11:94005888-94005910 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1087084940 11:94207959-94207981 CAAGGTAAAAAGAACAAAGCTGG + Intergenic
1087166387 11:95008250-95008272 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1087253209 11:95926795-95926817 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1087294038 11:96348891-96348913 CTGAGCAAAAAGAAAAAGGCTGG - Intergenic
1087304912 11:96477741-96477763 TTGAGGAAAAAGAACAAGGCTGG + Intronic
1087445522 11:98246753-98246775 CTGATTAAAAAGAACAAAGCTGG - Intergenic
1087471765 11:98584522-98584544 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1087753706 11:102032862-102032884 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1087998696 11:104847009-104847031 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1088066880 11:105730577-105730599 CAAAGCAAAAAGAACAAAGCTGG + Intronic
1088181230 11:107114441-107114463 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1088364475 11:109024984-109025006 CTGAGTAAAAAGAACAAAACAGG - Intergenic
1088563913 11:111147215-111147237 AAGAGTAAAGAGATCAAGGCTGG + Intergenic
1088958052 11:114630222-114630244 CTGAGTCAAAAGAACAAAGCTGG + Intergenic
1089773513 11:120819956-120819978 CAGGGCAAAATCAACAAGACTGG - Intronic
1090211788 11:124925902-124925924 AAGGATAATAATAACAAGGCTGG + Intronic
1090567517 11:128011164-128011186 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1090597710 11:128336797-128336819 CAGGGTAAAAAGAGCAGGTTGGG + Intergenic
1090853509 11:130591637-130591659 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1091352992 11:134912671-134912693 CAGGGTAAAAAGATGCTGGCTGG - Intergenic
1091861761 12:3791761-3791783 AAGGGAAAAATGAACAAGGAAGG - Intronic
1092393789 12:8106329-8106351 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1092749797 12:11708156-11708178 TAGGTTAAAGAGATCAAGGCTGG - Intronic
1092803475 12:12196131-12196153 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1092941667 12:13414667-13414689 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1093309034 12:17555744-17555766 ATGGGTAATAAGAAAAAGGCAGG - Intergenic
1093390232 12:18609923-18609945 AAGGGTAAAAGAAAAAAGGCTGG + Intronic
1093606980 12:21103988-21104010 CAGGGAAAAAAGAAAACTGCTGG - Intronic
1093635642 12:21464053-21464075 CAGGTTAGAAACAAAAAGGCTGG - Intronic
1093695193 12:22151255-22151277 CTAAGTAAAAAGAACAAAGCAGG + Intronic
1093991982 12:25599997-25600019 CAAAGTAAAAAGAACAAAACTGG + Intronic
1094060647 12:26311803-26311825 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1094081963 12:26546600-26546622 CTGAGTGAAAAGAACAAAGCTGG + Intronic
1094727383 12:33133999-33134021 AAGGGTAAGAAGAAGAGGGCAGG + Intergenic
1094863129 12:34493860-34493882 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1095097113 12:38154757-38154779 CAGGGAAAAAAGCGGAAGGCCGG + Intergenic
1095281681 12:40358662-40358684 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1095315254 12:40753083-40753105 CAAGGTAAAATTAACATGGCAGG - Intronic
1095994798 12:48072015-48072037 CAGGAGAACAAGAACATGGCAGG + Intronic
1096110133 12:49023776-49023798 CAGGGCATCAAGGACAAGGCTGG + Intronic
1096130581 12:49155829-49155851 CAGAATGAAAAGAACAAGCCAGG + Intergenic
1096295987 12:50384495-50384517 TTGAGTAAAAAGAACAAAGCAGG + Intronic
1096760010 12:53833570-53833592 CAAGGAAAAGAGAACAAGGTTGG + Intergenic
1096920429 12:55079569-55079591 CTGAATAAAAAGAACAAAGCTGG + Intergenic
1096988812 12:55781565-55781587 CAGACAAAAAATAACAAGGCAGG + Intronic
1097149438 12:56965635-56965657 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
1097287205 12:57887520-57887542 CAGGGTCAACAGGACAAGCCAGG + Intergenic
1097303949 12:58048305-58048327 CTGAGCAAAAATAACAAGGCTGG + Intergenic
1097498065 12:60367880-60367902 CTGAGTAAAAAGACCAAAGCTGG + Intergenic
1097514424 12:60586749-60586771 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1098203539 12:68082636-68082658 CAGAGTAAAAAAAACAAAGCAGG + Intergenic
1098215493 12:68212323-68212345 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1098360773 12:69652333-69652355 CAGGGAAAAAGGAGCTAGGCAGG + Intronic
1098399581 12:70059615-70059637 CAATGTAAAAAGAACACGTCAGG + Intergenic
1098458913 12:70710101-70710123 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1099192860 12:79578421-79578443 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1099217061 12:79866018-79866040 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1099232236 12:80040172-80040194 GAGTGTATAAAGAACAAGTCAGG - Intergenic
1099583096 12:84478453-84478475 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1099626355 12:85079760-85079782 AAGGGCAAAAAGAAAAAAGCAGG - Intronic
1100024998 12:90117283-90117305 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100040150 12:90306803-90306825 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100193334 12:92216663-92216685 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100374721 12:94003752-94003774 CTGGGTAAGAAGAACAAAGCTGG - Intergenic
1100414803 12:94360800-94360822 CTGTGTAAAAAGAACAAAGTTGG + Intronic
1100694208 12:97073766-97073788 CAAAGGAAAAAGAATAAGGCAGG - Intergenic
1100804811 12:98271710-98271732 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1101299584 12:103465007-103465029 AAAAGTAAAAAGAACAAAGCTGG - Intronic
1101536351 12:105620769-105620791 CTGAGTAAAGAGAACAAAGCTGG - Intergenic
1101628191 12:106466893-106466915 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1101648275 12:106651696-106651718 CAGGGTACAAAGAAATAGGGAGG + Intronic
1101790521 12:107922626-107922648 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1101901461 12:108794079-108794101 CAGGGTCCAGAGAACAGGGCCGG - Intronic
1102262992 12:111456386-111456408 CAGGGTGGTAAGAGCAAGGCTGG + Intronic
1102513997 12:113434514-113434536 GAGGGTAAATAGAACAGTGCAGG - Intronic
1102704339 12:114868206-114868228 CAGGTGACAAAGAACAATGCGGG - Intergenic
1102787137 12:115614202-115614224 CAGGGAAAAAAGAACTTGTCTGG - Intergenic
1102921607 12:116795781-116795803 CAGAGTAGAAAGAACACAGCTGG + Intronic
1102939959 12:116931323-116931345 CTGAGCAAAAAGAACAATGCTGG - Intronic
1103000093 12:117378933-117378955 CAGTGTAAAAAAGGCAAGGCTGG + Intronic
1103055080 12:117812865-117812887 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1103126421 12:118426663-118426685 TAGAGTAAAAAGACCAAGGATGG - Intergenic
1103180201 12:118904404-118904426 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1103460523 12:121101059-121101081 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1103965570 12:124637434-124637456 CAGGTGAATAAGAACAAGACTGG - Intergenic
1104440987 12:128792793-128792815 CAGGTTAAAAAAAACGGGGCAGG - Intergenic
1105275282 13:18917552-18917574 TAAGATAAAAAGAACTAGGCCGG + Intergenic
1105318102 13:19287486-19287508 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1105938577 13:25126307-25126329 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1105981606 13:25521913-25521935 CAGAGCAAAAAGAACAAAGCTGG - Intronic
1106073632 13:26438214-26438236 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1106611881 13:31291284-31291306 CAAAGCAAAAAGAACAAAGCTGG - Intronic
1106860341 13:33900228-33900250 CCGAGAAAAAAGAACAAAGCGGG + Intronic
1107093249 13:36507284-36507306 CAAGGTAAAATGAACAATTCTGG - Intergenic
1107243734 13:38267572-38267594 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1107287940 13:38817260-38817282 CTGTGCAAAAAGAACAAAGCTGG + Intronic
1107570573 13:41653610-41653632 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1108261663 13:48663282-48663304 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1108307111 13:49148645-49148667 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1108657522 13:52549835-52549857 CATGGAAAACAAAACAAGGCAGG - Intergenic
1108840041 13:54602014-54602036 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1108976813 13:56454861-56454883 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1109086863 13:57985232-57985254 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1109290038 13:60462817-60462839 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1109528046 13:63602210-63602232 CTGAGTGAAAAGAACAAAGCTGG - Intergenic
1109761687 13:66838070-66838092 CATGGTAAAAAGTACAAAACTGG - Intronic
1110128947 13:71982404-71982426 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1110207767 13:72937080-72937102 ACGGGTTAAAAGAAGAAGGCTGG - Intronic
1110215018 13:73015354-73015376 CAGAATAGAAAGAAAAAGGCAGG - Intronic
1110491623 13:76116703-76116725 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110629239 13:77687498-77687520 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1110747799 13:79076364-79076386 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110878335 13:80538745-80538767 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1111083658 13:83344222-83344244 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1111137073 13:84061577-84061599 CTGAGCAAAAAGCACAAGGCTGG - Intergenic
1111426660 13:88093732-88093754 CAGACCAAAAAGAACAAAGCTGG - Intergenic
1111525230 13:89459729-89459751 CCAAGTAAAAAGAACAAAGCTGG - Intergenic
1111583198 13:90251297-90251319 CTGAGCAAAAAGAACAAGACTGG - Intergenic
1111671409 13:91334814-91334836 CAGAGCAAAAAGAACAAAGCTGG - Intergenic
1111791141 13:92857025-92857047 CTAGGCAAAAAGAACAAAGCTGG + Intronic
1112182631 13:97099527-97099549 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1112743296 13:102498742-102498764 CTGAGCAAAAAGAACAAGACTGG + Intergenic
1112845984 13:103644500-103644522 CTGAGCAAAAAGAACAAGACTGG - Intergenic
1113296449 13:108964189-108964211 CAAGGAAAAAAGAGCAAGGGTGG - Intronic
1113546955 13:111160292-111160314 TTGAGTAAAAAGAACAAAGCTGG - Intronic
1114157818 14:20126681-20126703 TTAGGTAAAAAGAACAAAGCTGG + Intergenic
1114691650 14:24587844-24587866 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1114707221 14:24739272-24739294 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1114937754 14:27565031-27565053 CTGAGAAAAAAGAACAAAGCTGG + Intergenic
1115108005 14:29784333-29784355 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1115538494 14:34396201-34396223 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1116354465 14:43910922-43910944 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1116417634 14:44697933-44697955 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1116551626 14:46247181-46247203 CAGGGAAGAATAAACAAGGCTGG + Intergenic
1116552960 14:46265946-46265968 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1116554362 14:46284614-46284636 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1116569571 14:46498430-46498452 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1116579366 14:46619399-46619421 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1116717529 14:48446745-48446767 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1116766344 14:49075186-49075208 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1116880081 14:50158728-50158750 CAAAGTAAAAAGAAAAAGGGAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117079271 14:52134685-52134707 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
1117298755 14:54402991-54403013 CTAAGTAAAAAGAACAACGCTGG - Intronic
1117374401 14:55107745-55107767 CAGGCTAACAAGGACAAGGAAGG - Intergenic
1117620906 14:57586027-57586049 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1117624889 14:57625501-57625523 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1117822338 14:59662966-59662988 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1117856102 14:60035782-60035804 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1117883766 14:60337787-60337809 CTGGGCAAGAAGAACAAAGCCGG - Intergenic
1117917690 14:60694990-60695012 CTGTGTAAAAAGAACAAAGCTGG - Intergenic
1118043733 14:61944433-61944455 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1118088448 14:62445511-62445533 CAGAGTAATAAGAAAAAGGAGGG - Intergenic
1118114970 14:62765072-62765094 CTAAGCAAAAAGAACAAGGCTGG + Intronic
1118479405 14:66148814-66148836 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1118523584 14:66616146-66616168 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1118529522 14:66687289-66687311 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1118557565 14:67042670-67042692 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1118649268 14:67872638-67872660 CTGAGCCAAAAGAACAAGGCTGG + Intronic
1118931190 14:70242568-70242590 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1119246145 14:73110179-73110201 CAGGGAAAAAAAAAAAAGGCCGG - Intronic
1119535761 14:75401359-75401381 CGAGATAAAAAGAACAAGGAAGG - Intergenic
1120587925 14:86338488-86338510 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1120639535 14:86993731-86993753 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
1120730906 14:88000292-88000314 TTGGGCAAAAAGAACAAAGCTGG - Intergenic
1120797864 14:88655177-88655199 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1120803640 14:88721316-88721338 CTAAGCAAAAAGAACAAGGCAGG + Intronic
1122110740 14:99499332-99499354 CAGTGTAAAAAAAACTGGGCTGG - Intronic
1122148868 14:99712845-99712867 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1122646208 14:103196113-103196135 AAAGGAAAAAGGAACAAGGCAGG + Intergenic
1123163700 14:106305243-106305265 CAGGTTTTAAAGAACAAGGATGG - Intergenic
1123798692 15:23799039-23799061 TTGAGCAAAAAGAACAAGGCTGG + Intergenic
1123960937 15:25399469-25399491 CAGGGTGCAAAGAACACAGCGGG - Intronic
1124338189 15:28872939-28872961 CAGGGTCTAAGGAATAAGGCTGG - Intergenic
1124419638 15:29509452-29509474 CCAGGCAAAAAGAACAAAGCTGG + Intronic
1124682821 15:31750556-31750578 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1124717598 15:32079848-32079870 CAAGCAAAAAAGAACAAAGCTGG + Intronic
1124908248 15:33892661-33892683 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1125084680 15:35716102-35716124 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1125207717 15:37173677-37173699 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1125276564 15:37998639-37998661 CTGGGCAAAAAGAACAAAACTGG - Intergenic
1125288937 15:38124414-38124436 CCAGGCAAAAAGAACAAAGCTGG + Intergenic
1125393187 15:39217861-39217883 GAGGGAAAAAAGAACAAAACTGG + Intergenic
1125464247 15:39934643-39934665 GAGGGGAAAAAGGACAAGGTTGG - Intronic
1126367599 15:47912020-47912042 CAGAGTAAATAGAATAAAGCAGG - Intergenic
1126476746 15:49073245-49073267 CTGGGCAAGAAGAACAAGGCTGG + Intergenic
1126742485 15:51791555-51791577 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1127038670 15:54948758-54948780 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1127058417 15:55156232-55156254 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1127168875 15:56277610-56277632 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1127189885 15:56518353-56518375 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
1127720343 15:61692985-61693007 GAGGCTAAAATGAACAAGGCAGG + Intergenic
1127730195 15:61793730-61793752 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1127814338 15:62594032-62594054 TAGAGCAAAAAGAACAAAGCTGG + Intronic
1128056029 15:64700756-64700778 TAGGGTAAAGAGAACATGGGAGG + Intronic
1128128274 15:65208885-65208907 CAGGGTGGAAAGAGCAAGGCAGG + Intronic
1128926995 15:71665944-71665966 CTAAGCAAAAAGAACAAGGCTGG - Intronic
1129507515 15:76094557-76094579 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1129548862 15:76426768-76426790 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1129586199 15:76868834-76868856 CTGGGCAAAAAGAATAAAGCTGG + Intronic
1129965323 15:79729817-79729839 CAGGTTAAGAAGAAAAAGTCAGG + Intergenic
1130166245 15:81461939-81461961 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1130225381 15:82054058-82054080 CAAGGTCACAAAAACAAGGCAGG - Intergenic
1130364120 15:83218220-83218242 CTAAGAAAAAAGAACAAGGCCGG + Intergenic
1130617042 15:85420235-85420257 CAGATTAAAAAAAAAAAGGCCGG - Intronic
1131030957 15:89185606-89185628 CAGGGGAAAAAAAAAAATGCAGG + Intronic
1131415851 15:92257030-92257052 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
1131444209 15:92482789-92482811 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1131942164 15:97578917-97578939 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1132037319 15:98495986-98496008 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1132334258 15:101034695-101034717 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1133217875 16:4304390-4304412 CAGGGAAAGGAAAACAAGGCAGG + Intergenic
1134316627 16:13124667-13124689 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1134781314 16:16898602-16898624 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1137385368 16:48037094-48037116 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1137459221 16:48643897-48643919 CTGAACAAAAAGAACAAGGCTGG - Intergenic
1138146764 16:54619625-54619647 GATGGTTAAAAGAAAAAGGCAGG - Intergenic
1138300536 16:55924620-55924642 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1138478832 16:57288213-57288235 CAGGGTTGGAAGAACAAGGATGG - Intergenic
1138610193 16:58117273-58117295 CACAATAAAAACAACAAGGCAGG + Intronic
1138637671 16:58354753-58354775 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1139046895 16:63072010-63072032 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1139290162 16:65850672-65850694 GAGGGGAAAAAGGTCAAGGCAGG + Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1139556920 16:67718406-67718428 CACGATCTAAAGAACAAGGCAGG - Intronic
1140013914 16:71163590-71163612 CAGGGTTCCAAGAACAAGACTGG - Intronic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1143328008 17:6112996-6113018 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1144642923 17:16948573-16948595 CAGGATAAAAAAAACAATGTAGG - Intronic
1144812646 17:18010517-18010539 CTGAGCAAAAAGAACAACGCTGG + Intronic
1145738099 17:27247659-27247681 CATGGAAACAAGAAGAAGGCTGG + Intergenic
1146020445 17:29273466-29273488 CAGTGTTAAAAGATCAAGGCTGG - Intronic
1146363068 17:32195119-32195141 TAGGGAAAAAAAAAAAAGGCCGG - Intronic
1147733076 17:42616048-42616070 CAGGATAAAAAGGGCAAAGCAGG + Intergenic
1147900386 17:43779549-43779571 CAGGGAAAAAAAAAAAAAGCGGG + Intergenic
1148352994 17:46954477-46954499 CAAGGCCAAAAGAACAAAGCTGG - Intronic
1148861568 17:50607050-50607072 CAGGACAGAAAGAGCAAGGCAGG + Intronic
1149253654 17:54799733-54799755 CTGGGCAACAAGAACAAAGCTGG + Intergenic
1149456045 17:56789446-56789468 CAGGGTACATGGAACAAGGGTGG - Intergenic
1149934224 17:60787873-60787895 CATGGTAAGAAGAGCAAGACAGG + Intronic
1150151649 17:62814232-62814254 CTGTGCAAAAAGAACAAAGCTGG - Intergenic
1150517918 17:65833900-65833922 CAAAGTAAAGAGAACAAAGCTGG + Intronic
1150539276 17:66079708-66079730 CTAAGCAAAAAGAACAAGGCTGG + Intronic
1150755587 17:67909274-67909296 CAGGATAAAAAAAAAAAGGGGGG - Intronic
1150881906 17:69039263-69039285 CTAGGCAAAAAGAACAAAGCTGG + Intronic
1150934618 17:69622217-69622239 CTGCATAAAAAGAACAAAGCTGG - Intergenic
1150993220 17:70285149-70285171 TTGGGCAAAAAGAACAAAGCTGG + Intergenic
1151503370 17:74507457-74507479 CAGAGCAAAAAGAACAAAACTGG - Intergenic
1151735946 17:75940550-75940572 CAGAGAAAAAGAAACAAGGCCGG - Intronic
1151870315 17:76832343-76832365 CACGGGAGAAAGAAGAAGGCCGG + Intergenic
1151924869 17:77187672-77187694 TAGGGTAATAAGAATAAGGCCGG - Intronic
1152715096 17:81895671-81895693 CAGGGTCAAGAGATCAAGGCAGG + Intronic
1152902845 17:82954681-82954703 CTAGGCAAAAAGAACAAAGCTGG + Intronic
1153112430 18:1608201-1608223 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1153129252 18:1835518-1835540 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153133046 18:1879661-1879683 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1153274634 18:3355898-3355920 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153341235 18:3977366-3977388 CAGTTTAAAAATAATAAGGCCGG - Intronic
1153474651 18:5486040-5486062 CTGACTAAAAAGAACAAAGCTGG + Intronic
1153644473 18:7182719-7182741 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153701938 18:7703119-7703141 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1153718181 18:7872461-7872483 CCGGGTAAAAAAAACAAACCAGG - Intronic
1154044609 18:10893041-10893063 CAGGATAAAATTAACAATGCTGG + Intronic
1154337498 18:13477290-13477312 CATGGTCAGAAGAACAAGGAAGG + Intronic
1154381822 18:13858731-13858753 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1155486557 18:26349754-26349776 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1155600299 18:27538318-27538340 AGGGGTAAAAACAACAAGGGTGG + Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1156060509 18:33069229-33069251 CTGAGTGAAAAGAACAAAGCTGG + Intronic
1156135924 18:34037463-34037485 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1156191353 18:34724783-34724805 CTAGGCAAAAAGAACAAAGCTGG + Intronic
1156226065 18:35109398-35109420 CTAGGCAAAAAGAACAATGCTGG - Intronic
1156931717 18:42652781-42652803 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
1157180806 18:45496444-45496466 CAGGGTAGCTAGAACAAAGCAGG + Intronic
1157647777 18:49294257-49294279 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1158101685 18:53836343-53836365 CCAGGTAAAAAGAACAAACCTGG + Intergenic
1158747852 18:60222158-60222180 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1158971951 18:62676415-62676437 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1159141858 18:64406304-64406326 CAGGGTAGAAAGCAAAATGCTGG - Intergenic
1159376125 18:67595904-67595926 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1159416615 18:68157680-68157702 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1159438287 18:68446065-68446087 CAGGGGAGAAAGATGAAGGCTGG - Intergenic
1159545272 18:69833113-69833135 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1160092778 18:75842606-75842628 CACGGGAGAAAGAAGAAGGCCGG - Intergenic
1160184517 18:76664828-76664850 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1160251988 18:77210692-77210714 CAGGGTGTGAAGAAGAAGGCAGG - Intergenic
1160746658 19:714652-714674 CAGTCTAAAAAAAAGAAGGCTGG - Intronic
1161819903 19:6523664-6523686 CAAGAAAAAAAAAACAAGGCCGG - Intergenic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1164035174 19:21447710-21447732 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1165250473 19:34529263-34529285 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1165566878 19:36737527-36737549 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1166630773 19:44405416-44405438 CTAAGTAAAAAGAACAAGTCTGG + Intergenic
1166900116 19:46054546-46054568 TTGAGTAAAAAGAACAAAGCTGG - Intronic
1166963060 19:46511207-46511229 GAGAGTCAAAAGAACAATGCAGG + Intronic
1167519267 19:49943247-49943269 CTGGGCAAAAAGAACAAAGCTGG + Intronic
1167727695 19:51228202-51228224 CAAGCAAAAAAGAACAAAGCTGG - Intronic
1167763888 19:51467431-51467453 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1167773111 19:51534284-51534306 CGGAGAAAAAAGAACAAAGCTGG - Intergenic
1167860498 19:52279315-52279337 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1167890309 19:52535033-52535055 CGGGTTAAAAAAAAAAAGGCTGG + Intronic
1168010306 19:53525206-53525228 CTAGGCAAAAAGAACAAAGCTGG - Intronic
925074358 2:1001814-1001836 CTAAGTAAAAAGAACAAAGCTGG + Intronic
925257348 2:2501425-2501447 CAGGGAAAAAAGAACATTGCTGG - Intergenic
925271395 2:2611449-2611471 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
925432837 2:3811021-3811043 CTAGGCAAAAAGAACAAAGCTGG - Intronic
925684505 2:6457872-6457894 GACTGTAACAAGAACAAGGCGGG + Intergenic
926348417 2:11971093-11971115 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
926576023 2:14582801-14582823 TAGAGCAAAAAGAACAAAGCTGG + Intergenic
926708291 2:15853184-15853206 CCGAGTAAAAAGAACAAAGTTGG - Intergenic
926848387 2:17167495-17167517 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
926935388 2:18082618-18082640 CAGGGAACAAGGAACAAGGAAGG - Intronic
926968209 2:18439279-18439301 CAAGGAAAAAAGAGAAAGGCAGG - Intergenic
926995828 2:18734862-18734884 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
927154341 2:20213011-20213033 CAGGGCAAAAAGCCCAGGGCTGG - Intronic
927330575 2:21858416-21858438 TTGGGCAAAAAGAACAAAGCTGG - Intergenic
927785855 2:25974362-25974384 TAGGAAAAAAAGAAAAAGGCCGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928501315 2:31899234-31899256 CTAAGTAAAAAGAACAAAGCTGG + Intronic
928679398 2:33684159-33684181 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
929241170 2:39655149-39655171 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
929265707 2:39916787-39916809 CTGAGTAGAAAGAACAAAGCTGG - Intergenic
929385127 2:41397367-41397389 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929734834 2:44536713-44536735 CTGAGCAAAAAGAACAAAGCTGG + Intronic
930292997 2:49519153-49519175 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
930323748 2:49886879-49886901 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
930328170 2:49946763-49946785 CTAAGCAAAAAGAACAAGGCTGG + Intronic
930480854 2:51946678-51946700 CATGGGAAAAAGATGAAGGCTGG + Intergenic
930803474 2:55466845-55466867 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
930859782 2:56059353-56059375 TTGGGCAAAAAGAACAAAGCTGG - Intergenic
930921459 2:56760083-56760105 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
930935800 2:56949916-56949938 CTAAGTAAAAAGAACAAAGCAGG - Intergenic
931217043 2:60255480-60255502 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
931258127 2:60592483-60592505 CTGAATAAAAAGAACAAAGCTGG + Intergenic
931415825 2:62079305-62079327 CAGGATAAAAAGATCATGGGGGG + Intronic
931594934 2:63931204-63931226 CTGGGCAAGAAGAACAAAGCTGG + Intronic
931873515 2:66486539-66486561 CTAGGCAAAAAGAACAAAGCTGG - Intronic
932006777 2:67935232-67935254 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
932089586 2:68793716-68793738 CTAAGCAAAAAGAACAAGGCTGG - Intronic
932138906 2:69257648-69257670 CAGAGCAAAAAGAACAAACCTGG + Intergenic
932172595 2:69571017-69571039 CAGGGTAAAAAAATCAAGGTGGG - Intronic
932377149 2:71246875-71246897 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
933166231 2:79079181-79079203 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
933323546 2:80807566-80807588 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
933324639 2:80819830-80819852 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
933358855 2:81251463-81251485 CTGAGTAGAAAGAACAAAGCTGG - Intergenic
933642108 2:84774504-84774526 CCGTGTAAAAAGAACAAAGCTGG - Intronic
933819427 2:86096477-86096499 TTGAGTAAAAAGAACAAAGCTGG + Intronic
935021244 2:99234520-99234542 CTGGGCAAGAAGAACAAAGCTGG + Intronic
935113054 2:100109347-100109369 CATTTTAAAAAGAAAAAGGCAGG + Intronic
935288226 2:101585218-101585240 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
935449698 2:103194963-103194985 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
935567533 2:104625174-104625196 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
936122579 2:109759766-109759788 CATTTTAAAAAGAAAAAGGCAGG - Intergenic
936222114 2:110611706-110611728 CATTTTAAAAAGAAAAAGGCAGG + Intergenic
936612435 2:114014417-114014439 CTGGGCCAAAAGAACAAAGCTGG - Intergenic
936701438 2:115016049-115016071 CTAAGCAAAAAGAACAAGGCTGG + Intronic
936892219 2:117384958-117384980 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
937630882 2:124099774-124099796 CAGGACCAAGAGAACAAGGCGGG + Intronic
937765946 2:125660683-125660705 CATGGGAAAAAGATGAAGGCTGG - Intergenic
938254317 2:129843147-129843169 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
938588967 2:132719157-132719179 CAAGGTATAAAGTACAAGCCAGG + Intronic
938866561 2:135427750-135427772 CAAAGTAAAAAGAACAAAGCTGG + Intronic
938874022 2:135514082-135514104 CTAGGCAAAAAGAACAAAGCTGG - Intronic
939058330 2:137389990-137390012 CTGAGCAAAAAGAACAAAGCTGG - Intronic
939244143 2:139601042-139601064 CAGGGGACAAAAAAAAAGGCAGG - Intergenic
939695072 2:145313386-145313408 CACTGTCACAAGAACAAGGCAGG + Intergenic
940395369 2:153183912-153183934 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
940535168 2:154931916-154931938 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
940716302 2:157228647-157228669 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
940923949 2:159342965-159342987 CTGAGTAACAAGAACAAAGCTGG + Intronic
941041037 2:160624034-160624056 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
941050498 2:160727505-160727527 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
941192989 2:162410129-162410151 CGAGGCAAAAAGAACAAAGCTGG + Intronic
941228444 2:162878619-162878641 CCGGGCAAGAAGAACAAAGCTGG + Intergenic
941238896 2:163012553-163012575 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
941566146 2:167110614-167110636 CAAAGCAAAAAGAACAAAGCTGG - Intronic
941625601 2:167827262-167827284 TGGGGTACAAAGAACAAGACAGG + Intergenic
942327925 2:174791257-174791279 CAGAGTAATAAGAGCAAGGAAGG + Intergenic
942428953 2:175889169-175889191 TAGAAGAAAAAGAACAAGGCAGG + Intergenic
942652694 2:178185006-178185028 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
942722664 2:178970320-178970342 CTGGGCAAGAAGAACAAAGCTGG + Intronic
942766602 2:179464789-179464811 CTGGGCAAGAAGAACAAAGCTGG - Intronic
942816724 2:180060970-180060992 AAGGGTTAAAAGAAAAAAGCTGG + Intergenic
942895949 2:181054677-181054699 CAATGTCAAGAGAACAAGGCAGG - Intronic
942927671 2:181453544-181453566 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
943186506 2:184613984-184614006 CTAAGTAAAAAGAACAAAGCTGG + Intronic
943583996 2:189716639-189716661 CTAGGCAAAAAGAACAAAGCTGG + Intronic
943659182 2:190539390-190539412 CTGGGCGAAAAGAACAAAGCTGG - Intergenic
943667333 2:190623367-190623389 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
943714689 2:191137567-191137589 CTGAGCAAAAAGAACAAAGCTGG + Intronic
943950310 2:194126054-194126076 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
943954645 2:194173437-194173459 CAGGGTAAATAGAGTAAGGTAGG - Intergenic
944178482 2:196860887-196860909 CTGAGCAAAAAGAACAAAGCTGG + Intronic
944259638 2:197662544-197662566 TAGGAAAAAAAGAACAAAGCTGG - Intronic
944768091 2:202885118-202885140 CAGGGTACAAAAACCAGGGCAGG + Intronic
945059481 2:205896291-205896313 CAGGGCAAGAAGAAAAAGCCCGG - Intergenic
945110990 2:206359481-206359503 CTGAGTAAAAAGAACAAAGATGG + Intergenic
945145241 2:206731480-206731502 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
945161439 2:206895656-206895678 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
945211145 2:207383604-207383626 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
945308145 2:208279905-208279927 CTAAGCAAAAAGAACAAGGCAGG + Intronic
945578044 2:211556810-211556832 CTAAGCAAAAAGAACAAGGCTGG + Intronic
945734063 2:213576364-213576386 CAAAGCAAAAAGAACAAAGCTGG - Intronic
945791034 2:214305813-214305835 CAAAGCAAAAAGAACAAAGCTGG - Intronic
945845499 2:214939404-214939426 CTGAGCAAAAAGAACAAAGCTGG - Intronic
945847578 2:214964926-214964948 CTAAGTAAAAAGAACAAAGCTGG + Intronic
945945655 2:215993114-215993136 CTAGGCAAAAAGAACAAAGCTGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946444237 2:219724502-219724524 CAGGGTAAGAATAAAAAGGCTGG + Intergenic
947040629 2:225915206-225915228 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
947132162 2:226939816-226939838 CTAAGCAAAAAGAACAAGGCTGG + Intronic
948245134 2:236476016-236476038 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1169595291 20:7191637-7191659 CAGGTAAACCAGAACAAGGCAGG + Intergenic
1169695256 20:8380388-8380410 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1169737291 20:8850663-8850685 AAGGGCAAAAAGAGCAAAGCAGG - Intronic
1169987770 20:11464986-11465008 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1170128238 20:12989300-12989322 CAAGTTAAAAACAAAAAGGCCGG + Intergenic
1170143195 20:13145689-13145711 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1170306098 20:14939531-14939553 CTGAGCAAAAAGAACAATGCTGG - Intronic
1170384568 20:15801642-15801664 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1170413750 20:16118343-16118365 CAAGGCAGAAAGAACAAAGCTGG + Intergenic
1170483219 20:16789272-16789294 CTGAGCCAAAAGAACAAGGCTGG - Intergenic
1170996891 20:21370296-21370318 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1172203375 20:33143243-33143265 CAGAGTAAAAGGAACAAAACTGG - Intergenic
1173235507 20:41241687-41241709 CAGAGCAAAAAGAACAAAACTGG - Intronic
1173738618 20:45379914-45379936 CAGGGTAAAGGGAACAGGGAGGG + Intronic
1173780812 20:45755731-45755753 CTGGGCAAAAACAACAAAGCTGG + Intronic
1174199266 20:48795600-48795622 CAGAAGAAAAAGAAAAAGGCAGG + Intronic
1174695793 20:52556375-52556397 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1174741266 20:53016341-53016363 CAGTTTCAAAAGAACAAGGTAGG + Intronic
1175613159 20:60368985-60369007 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1176778713 21:13166755-13166777 CAGGCTAAGAAGAACAAAGAAGG + Intergenic
1177183745 21:17771197-17771219 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1177663131 21:24113975-24113997 CGGAGCAAAAAGAACAAAGCTGG + Intergenic
1177691656 21:24517923-24517945 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
1177766382 21:25462077-25462099 CAGTGTAAAAAGGAAAAGGTGGG + Intergenic
1177768323 21:25485031-25485053 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1177857623 21:26417447-26417469 CAGGTTAAGAACAACAAGACAGG - Intergenic
1177956165 21:27601864-27601886 CAAGACAAAAAGAACAAAGCTGG - Intergenic
1177990779 21:28033607-28033629 CGGTGTACAAAGAACAAGACGGG + Intergenic
1178160132 21:29902831-29902853 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1178197341 21:30362120-30362142 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1178236585 21:30849924-30849946 CAGAACAAAAAGAACAAAGCTGG - Intergenic
1178956249 21:37024723-37024745 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1179196375 21:39167043-39167065 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1179473668 21:41629541-41629563 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1180123874 21:45773679-45773701 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1181309816 22:21938519-21938541 CCGGGGAAAAGGAACAAGGTGGG - Intronic
1181677717 22:24467705-24467727 CAGGGTAAGAAAAACAGGGAAGG + Intergenic
1181912475 22:26250603-26250625 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1182178101 22:28314413-28314435 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1182960142 22:34464295-34464317 CAAAGAAAGAAGAACAAGGCAGG - Intergenic
1183761897 22:39828244-39828266 CAGGGTAAAGAGTACAGAGCAGG - Intronic
1184651496 22:45921299-45921321 CAGGGTAAAAGGACCAGGACAGG + Exonic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1184770291 22:46593259-46593281 CCGGGGAAAAGGAACCAGGCAGG - Intronic
949104927 3:192578-192600 AAGGAGAAAAAGAACTAGGCCGG + Intergenic
949308283 3:2668033-2668055 CTGAGTCAAAAGAACAAAGCTGG - Intronic
949899119 3:8795190-8795212 GATGGTAAAAAGGGCAAGGCTGG + Intronic
949952944 3:9244064-9244086 CAGGATAAAATGAAGAAAGCAGG - Intronic
950348991 3:12328438-12328460 CAGGGTAAAAACTCCAGGGCTGG - Intronic
950561552 3:13731836-13731858 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
950885394 3:16358048-16358070 CTGTGGAAAAAGAAAAAGGCGGG + Intronic
950914135 3:16626550-16626572 CAGAATAAAAAAAACAAGGGTGG + Intronic
950951230 3:17001797-17001819 CTGAGTAAAAAGAACAAAGCTGG - Intronic
951008506 3:17648033-17648055 CTAGGCAAAAAGAACAATGCTGG + Intronic
951124885 3:18971732-18971754 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
951282362 3:20767774-20767796 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
951348733 3:21578774-21578796 CAGAACAAAAAGAACAAAGCTGG - Intronic
951599968 3:24362876-24362898 AAGTGTTAAAATAACAAGGCAGG - Intronic
951789879 3:26468726-26468748 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
951977656 3:28530897-28530919 CTGAGTAAAAAGAACAAAGCTGG + Intronic
952023647 3:29053050-29053072 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
952151965 3:30603308-30603330 CAGGGTTTAAAAAACAAGGAAGG - Intergenic
952470493 3:33645245-33645267 CTGGGTATAAGGAATAAGGCAGG - Intronic
952514114 3:34086779-34086801 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
952574285 3:34755919-34755941 AAGGGCAAAAAGAACCAGGAAGG - Intergenic
952813577 3:37426795-37426817 CTAGGCAAAAAGAACAAAGCTGG - Intronic
952941320 3:38446468-38446490 CTGAGTGAAAAGAACAAAGCTGG + Intergenic
953100760 3:39824293-39824315 CAGAGCAAAGAGAACAATGCTGG - Intronic
953523307 3:43664080-43664102 CTGGGCAAGAAGAACAACGCTGG + Intronic
953779675 3:45856099-45856121 CTAGGCAAAAAGAACAAAGCTGG + Intronic
954074064 3:48163943-48163965 CAGGGTGAAAAGAAAAAAGGGGG - Intronic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
954491554 3:50911596-50911618 CTAAGTAAAAAGAACAAAGCTGG - Intronic
954552775 3:51495993-51496015 CAAGGAAAAAAAAAAAAGGCCGG + Intronic
954949334 3:54455991-54456013 CTGAGCAAAAAGAACAAAGCTGG - Intronic
954979015 3:54726461-54726483 CTGGGCAAGAAGAGCAAGGCTGG + Intronic
955370154 3:58344411-58344433 CAGGGTAAAAAGGAAAAAACAGG - Intronic
955742726 3:62109486-62109508 CTGGGCAAGAAGAACAAAGCTGG - Intronic
955914911 3:63897655-63897677 CAAGGTATAAAGCACAAGACAGG - Intronic
956266114 3:67397719-67397741 CTAAGTAAAAAGAACAAAGCTGG + Intronic
956400147 3:68870402-68870424 CTGGACAAAAAGAACAAAGCTGG + Intronic
956857116 3:73286304-73286326 CAGGCAATAAAGAACAAGTCAGG - Intergenic
957438181 3:80207078-80207100 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
957561501 3:81827735-81827757 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
957686234 3:83506018-83506040 CTGGGGAAAAAGAACAAAACTGG + Intergenic
957767636 3:84647089-84647111 CAGTGTAAAAACAAGAAAGCTGG - Intergenic
958029861 3:88095730-88095752 GAGGGTTAAAATAACAAGCCTGG - Intronic
958490233 3:94763334-94763356 CAAAGTAAAAAGAACAAATCTGG - Intergenic
958589005 3:96129634-96129656 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
958621675 3:96570733-96570755 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
959038456 3:101392738-101392760 CTGAGCAAAAAGAACAATGCTGG + Intronic
959453127 3:106527449-106527471 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
959494790 3:107037654-107037676 CTATGCAAAAAGAACAAGGCTGG + Intergenic
959535031 3:107475064-107475086 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
959601741 3:108194539-108194561 CTGAGCAAAAAGAACAAAGCTGG + Intronic
959898406 3:111631677-111631699 CAAAGCAAAAAGAACAAAGCTGG + Intronic
960032424 3:113068086-113068108 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
960278608 3:115755580-115755602 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
960566222 3:119134757-119134779 CAAAGCAAAAAGAACAAAGCTGG + Intronic
960656333 3:120008408-120008430 CTGGGCAAGAAGAACAAAGCTGG + Intronic
960810982 3:121627358-121627380 CAGGGTGAAGGGAACAAAGCTGG + Exonic
961953595 3:130776022-130776044 CTGAGTGAAAAGAACAAAGCTGG + Intergenic
962038308 3:131677873-131677895 CAAAGCAAAAAGAACAAAGCTGG - Intronic
962064793 3:131967907-131967929 CAAAGCAAAAAGAACAAAGCTGG + Intronic
962496066 3:135940051-135940073 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
962624865 3:137215716-137215738 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
962651428 3:137497586-137497608 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
962910448 3:139844115-139844137 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
963014920 3:140813882-140813904 TAAGATAAAAAAAACAAGGCAGG + Intergenic
963033816 3:141006797-141006819 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
963154895 3:142086037-142086059 CAGGTGAAAAAGAACAAGGGCGG - Intronic
963403549 3:144834254-144834276 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
963493434 3:146030046-146030068 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
963498095 3:146094770-146094792 CTAAGTAAAAAGAACAAAGCTGG + Intronic
963551051 3:146723331-146723353 TTGAGTAAAAAGAACAAAGCTGG + Intergenic
963573097 3:147022473-147022495 CTGAGTGAAAAGAACAAAGCTGG + Intergenic
964114808 3:153124693-153124715 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
964148174 3:153491542-153491564 CTGAGCAAAAAGAACAAAGCTGG + Intronic
964264574 3:154879677-154879699 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
964265948 3:154895630-154895652 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
964456249 3:156870146-156870168 CTGAGCAAAAAGAACAAAGCTGG - Intronic
964501211 3:157350069-157350091 CTGGGCAAAAAGAACAAAGCTGG + Intronic
964715675 3:159718932-159718954 CTAAGCAAAAAGAACAAGGCTGG + Intronic
964804459 3:160592647-160592669 CTGAGTAAAAAGAACAAAACTGG + Intergenic
965207339 3:165738746-165738768 CGGAGCAAAAAGAACAAAGCTGG + Intergenic
965274225 3:166660050-166660072 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
965292771 3:166905327-166905349 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
965501652 3:169463488-169463510 AAGGATAAAATGAACAAGGGAGG + Intronic
965654637 3:170970897-170970919 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
965820075 3:172676344-172676366 CATGGTGACAAGAAGAAGGCAGG - Intronic
966040813 3:175485621-175485643 CAGGGGAGAAAGATGAAGGCTGG + Intronic
966133307 3:176669105-176669127 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
966138189 3:176725041-176725063 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
966148638 3:176841371-176841393 CAGGGGAGAAAGATGAAGGCTGG - Intergenic
966637496 3:182152139-182152161 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
966664593 3:182457056-182457078 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
967500891 3:190195765-190195787 CTTGGTAAAAAGAACAACGTGGG - Intergenic
967524757 3:190478324-190478346 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
967906981 3:194509580-194509602 CAAGGCAAAAAAAAAAAGGCCGG - Intergenic
967944328 3:194790958-194790980 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
969165702 4:5309436-5309458 CTGAGCAAAAAGAACAAGGTTGG + Intronic
969921981 4:10548946-10548968 TTGAGTAAAAGGAACAAGGCTGG - Intronic
970014064 4:11493018-11493040 CATGTAAAAATGAACAAGGCGGG + Intergenic
970017189 4:11525314-11525336 CAGGGCAAAGAGGACAAGGCTGG - Intergenic
970082959 4:12309506-12309528 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
970173909 4:13317816-13317838 CTGAGCAAAAAGAACAAGGCTGG - Intergenic
970353682 4:15231644-15231666 TAGGGTAAAATGAATTAGGCTGG - Intergenic
970416115 4:15858624-15858646 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
970693651 4:18648671-18648693 CTGAGGAAAAAGAACAAAGCTGG + Intergenic
970995367 4:22261383-22261405 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
971005579 4:22370619-22370641 CTGAGTAAACAGAACAAAGCTGG + Intronic
971543693 4:27856777-27856799 CTGGGCATAAAGAACAAAGCTGG - Intergenic
971551234 4:27958766-27958788 CAGGGTAATCAGAGCAATGCTGG - Intergenic
971867002 4:32185313-32185335 CAGGGCAAACAGAACTATGCAGG - Intergenic
971978166 4:33718084-33718106 TTGAGCAAAAAGAACAAGGCTGG - Intergenic
972007972 4:34135557-34135579 CTAGGCAAAAAGAACAAGGCTGG - Intergenic
972169171 4:36324030-36324052 GAGGGGAAAATGAACAAAGCTGG + Intronic
972177958 4:36430648-36430670 CTGAGAAAAAAGAACAAAGCTGG + Intergenic
972255444 4:37350127-37350149 CTAAGTAAAAAGAACAAAGCCGG - Intronic
972680387 4:41300741-41300763 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
972837031 4:42883920-42883942 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
973313205 4:48731483-48731505 CTGGGCAAGAAGAACAAAGCTGG + Intronic
973341421 4:49008916-49008938 CTAGGCAAAAAGAACAAAGCTGG - Intronic
973808783 4:54550349-54550371 GAGGAGAAAAAGAAAAAGGCAGG - Intergenic
973984826 4:56340237-56340259 TTGGGTAAAAAGAACAAAGCTGG + Intronic
974248411 4:59353448-59353470 CTGTGTAAGAAGAACAAAGCTGG - Intergenic
974641138 4:64632274-64632296 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
974720293 4:65729291-65729313 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
974876226 4:67706428-67706450 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
974918500 4:68206871-68206893 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
975093714 4:70433171-70433193 CTAAGTAAAAAGAACAAAGCTGG - Intronic
975202082 4:71602977-71602999 CACGGGAAAAAGATGAAGGCTGG + Intergenic
975247234 4:72133449-72133471 CTAAGTAAAAAGAACAAAGCTGG - Intronic
975364532 4:73513574-73513596 CTGGCCAAAAAGAACAAAGCTGG - Intergenic
975501956 4:75096445-75096467 CTGGGAAAGAAGAACAAAGCTGG - Intergenic
975569937 4:75805358-75805380 CAAGGAAAAAAAAAAAAGGCAGG - Intronic
975807035 4:78123418-78123440 CTGGGCAAGAAGAACAAAGCTGG - Intronic
975811407 4:78173847-78173869 ATGGGTAAAAATGACAAGGCTGG + Intronic
975977905 4:80120265-80120287 CTAAGTAAAAAGAACAAAGCTGG + Intronic
976024293 4:80668743-80668765 CTGAGCAAAAAGAACAAAGCTGG - Intronic
976024536 4:80671435-80671457 CAAAGCAAAAAGAACAAAGCTGG - Intronic
976093213 4:81478644-81478666 CTGGGCAAGAAGAACAAAGCTGG + Intronic
976159982 4:82188819-82188841 TTGGGTAAGAAGAACAAAGCTGG + Intergenic
976229937 4:82832107-82832129 CTGGGCAAGAAGAACAAAGCTGG + Intronic
976537761 4:86238287-86238309 CTAAGCAAAAAGAACAAGGCTGG - Intronic
976669942 4:87640944-87640966 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
976833488 4:89342749-89342771 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
976862003 4:89676640-89676662 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
977109104 4:92928265-92928287 CAGAGTAAAAAGTAGAGGGCTGG + Intronic
977218407 4:94310576-94310598 CTAAGCAAAAAGAACAAGGCTGG - Intronic
977385924 4:96339077-96339099 CTGTGCAAAAAGAACAAAGCTGG + Intergenic
977520069 4:98071116-98071138 CTAAGTAAAAAGAACAAAGCTGG + Intronic
977605020 4:98975532-98975554 ATGAGTAAAAAGAACAAAGCTGG - Intergenic
977713597 4:100155523-100155545 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
977829619 4:101575445-101575467 CTGGATAAAAAGAACAAAGCTGG - Intronic
977906382 4:102482586-102482608 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
978020162 4:103799016-103799038 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978137836 4:105284209-105284231 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978140784 4:105315450-105315472 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
978252163 4:106644514-106644536 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978391607 4:108232390-108232412 CTAGGTAAAAAGAACAAAGCTGG - Intergenic
978462840 4:108976611-108976633 CTGAGGAAAAAGGACAAGGCTGG + Intronic
978549207 4:109906695-109906717 CTGGGCAAAAAGAACAAATCAGG + Intergenic
978699354 4:111624181-111624203 CAGAGCAAAAAGAACAAAGCTGG - Intergenic
978721555 4:111916158-111916180 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
978905284 4:113998017-113998039 AGGGGCAAAAAGAAAAAGGCAGG - Intergenic
978926865 4:114256805-114256827 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
978974225 4:114849042-114849064 CAAGGTTGAAAGAAGAAGGCAGG + Intronic
979539657 4:121866871-121866893 CTGAGTAAAAGGAACAAAGCTGG - Intronic
979898103 4:126186487-126186509 CATGGGAAAAAGATGAAGGCTGG + Intergenic
980276278 4:130655079-130655101 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
980297246 4:130937405-130937427 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
980432573 4:132723258-132723280 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
980803962 4:137788343-137788365 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
980882766 4:138729935-138729957 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
980954403 4:139413876-139413898 CTGAGCAAAAAGAACAAGGCTGG - Intronic
981257246 4:142676540-142676562 CTAAGTAAAAAGAACAAAGCTGG + Intronic
981880844 4:149610424-149610446 CTGAGTAAAAAGTACAAAGCTGG + Intergenic
982190111 4:152844914-152844936 CTAAGCAAAAAGAACAAGGCTGG + Intronic
982323081 4:154100623-154100645 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
982580747 4:157176334-157176356 CTGAGCCAAAAGAACAAGGCTGG - Intergenic
982670021 4:158309382-158309404 CCAGGCAAAAAGAACAAAGCTGG - Intergenic
982674272 4:158357926-158357948 CTGAGCAAAAAGAACAAAGCTGG + Intronic
982702588 4:158672528-158672550 TAGGGCAAAAGGGACAAGGCCGG + Intronic
983047058 4:163000155-163000177 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
983103606 4:163657610-163657632 CTAGGCAAAAAGAACAAAGCTGG + Intronic
983169233 4:164517037-164517059 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
983413434 4:167425510-167425532 CAGGGTTCAAAGAACAAAGCTGG + Intergenic
983487154 4:168345546-168345568 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
983727175 4:170942789-170942811 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
983879482 4:172916947-172916969 CTGAGCAAAAAGAACAAAGCTGG + Intronic
983895790 4:173080251-173080273 TAAGGCAAAAAGAACAAAGCTGG - Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984732826 4:183084328-183084350 CATGGGAAAAAGATGAAGGCTGG - Intergenic
984877754 4:184384757-184384779 CGGTGTCAAAAGAACAGGGCTGG - Intergenic
984967683 4:185154787-185154809 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
985151503 4:186951862-186951884 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
985375387 4:189332034-189332056 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
986113391 5:4743717-4743739 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
986628441 5:9745467-9745489 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
986691773 5:10319228-10319250 CAGGGGCAGAAGAACAAGACAGG + Intergenic
986862002 5:11937236-11937258 CAGGGTAGAAAGAATAAGACAGG - Intergenic
987517144 5:18925302-18925324 CTAGGTAAAAATAACAAGGCTGG - Intergenic
987537992 5:19213180-19213202 CAGAGCAAAAAGAACAAAACTGG + Intergenic
987615390 5:20267374-20267396 CTGAGGAAAAAGAACAAAGCTGG - Intronic
988172680 5:27680084-27680106 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
988195697 5:28002701-28002723 CTGCGCAAAAAGAACAAAGCTGG - Intergenic
988214072 5:28248570-28248592 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
988317321 5:29647070-29647092 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
988630036 5:32919224-32919246 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
988903617 5:35761437-35761459 GAGGGTAAAAGAAACAAAGCAGG - Intronic
989008401 5:36841324-36841346 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
989222918 5:38989062-38989084 CTAAGTAAAAAGAACAAAGCTGG + Intronic
989364349 5:40638962-40638984 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
989393477 5:40926947-40926969 ATGGGCAAAAAGAACAAAGCTGG + Intronic
989479111 5:41908175-41908197 CAGGGGAAAAAAAAAAAGTCAGG - Intronic
989498430 5:42137177-42137199 CAGAGCAAAAAGAACAAAACTGG + Intergenic
989549628 5:42719014-42719036 CCGGGCCAAAAGAATAAGGCAGG + Exonic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
989991566 5:50773598-50773620 CTGAGCAAAAAGAACAAAGCTGG - Intronic
990244066 5:53845469-53845491 AAAGGAAAAAAGAACAAGGGTGG + Intergenic
990289811 5:54338321-54338343 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
990351606 5:54922654-54922676 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
990525904 5:56627624-56627646 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
990533615 5:56698405-56698427 CAGAGTACAGAGAACAATGCTGG - Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
990975212 5:61554558-61554580 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
991037455 5:62142272-62142294 CAGAGAAAAGAAAACAAGGCAGG + Intergenic
991159476 5:63480488-63480510 CATGGAAAAAAAAACAATGCTGG + Intergenic
991177030 5:63701017-63701039 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
991394811 5:66193098-66193120 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
991961933 5:72053641-72053663 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
992021291 5:72626865-72626887 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
992026803 5:72678090-72678112 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
992054816 5:72978050-72978072 CTAGGCAAAAAGAACAAAGCTGG - Intronic
992081279 5:73235577-73235599 CAAGGTAAAAAGAACAGGATAGG - Intergenic
992121095 5:73593344-73593366 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
992257830 5:74939293-74939315 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
992358698 5:76013046-76013068 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
992681595 5:79158937-79158959 CTAAGTAAAAAGAACAAAGCTGG + Intronic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
992756895 5:79915646-79915668 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
992819739 5:80484437-80484459 CAGGTTAAAAAGTAAAAGGATGG + Intergenic
993255334 5:85583679-85583701 CAGAGCAAAAAGAACAAAGCTGG - Intergenic
993420287 5:87693139-87693161 CCAAGCAAAAAGAACAAGGCTGG - Intergenic
993494617 5:88593798-88593820 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
994053261 5:95386483-95386505 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
994113864 5:96039814-96039836 CTGGGCAAGAAGAACAATGCTGG - Intergenic
994172056 5:96668805-96668827 CAGGTAAAAAAAAAAAAGGCTGG + Intronic
994255544 5:97590053-97590075 TTGACTAAAAAGAACAAGGCTGG - Intergenic
995008074 5:107225730-107225752 CAAGGCAAAAAGAACAAAGCTGG - Intergenic
995535727 5:113134511-113134533 CTGAGCAAAAAGAACAAAGCTGG - Intronic
995547468 5:113247410-113247432 AAGAGTAAAGAGAACAAAGCAGG + Intronic
995621031 5:114025930-114025952 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
995642555 5:114274278-114274300 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
995780397 5:115769341-115769363 TAAGATCAAAAGAACAAGGCTGG + Intergenic
995812408 5:116122423-116122445 CTGAGCAAAAAGAACAAAGCTGG - Intronic
996468377 5:123830253-123830275 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
996521535 5:124432264-124432286 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
996524073 5:124459229-124459251 CAGCATAAAAAGAAGAATGCCGG - Intergenic
996742419 5:126813056-126813078 AATGGTAAAAAGAAAAAGGAAGG - Intronic
996824612 5:127667772-127667794 GAGGGTAGAAAGAAAAAGTCAGG - Intergenic
996879746 5:128282733-128282755 AAGGGTAGAAAGTACAATGCTGG - Intronic
997105314 5:131012103-131012125 CTGAGTAAAAAGAACAAAACTGG + Intergenic
997854382 5:137360220-137360242 CAAGGCAAAAGGAAGAAGGCAGG + Intronic
998175311 5:139898239-139898261 CAGGTTCACAGGAACAAGGCCGG + Intronic
998676224 5:144411234-144411256 CTGAGTAAAAAGAACAAAGCTGG + Intronic
998723974 5:144987832-144987854 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
998770460 5:145538287-145538309 CTGGGCAAAAAGAACAAATCTGG - Intronic
998954180 5:147421559-147421581 CTAAGTAAAAAGAACAAAGCTGG + Intronic
999272468 5:150304609-150304631 CAGGGCAAAAGGAACTGGGCAGG + Intronic
999410098 5:151343050-151343072 CAGGAGACACAGAACAAGGCAGG + Intronic
1000032426 5:157415171-157415193 CTGAATAAAAAGAACAAAGCTGG + Intronic
1000498336 5:162014623-162014645 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1000543538 5:162570331-162570353 CAGGATAAAAGGAAGAAGCCAGG + Intergenic
1001090024 5:168732520-168732542 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1001965910 5:175909751-175909773 CAGGAAAAAAAAAACAAGGTGGG + Intergenic
1002335395 5:178474272-178474294 CAAGGAAAGAAGAACTAGGCGGG - Intronic
1002686279 5:181013195-181013217 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1003156301 6:3598490-3598512 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1004586614 6:17008144-17008166 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1004630410 6:17415721-17415743 CAGGAAAGAAAGCACAAGGCAGG + Intronic
1004795403 6:19077788-19077810 CTGAGCAAAAAGAACAAAGCAGG + Intergenic
1004844105 6:19619957-19619979 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
1004873299 6:19929669-19929691 CAGGTTAAAAAAAGCAAGGTTGG - Intergenic
1006110061 6:31739009-31739031 CAGGGTACTAGGAACAAAGCTGG + Intronic
1006245019 6:32725631-32725653 AGGTGGAAAAAGAACAAGGCTGG - Intergenic
1006280368 6:33047772-33047794 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1006548247 6:34797565-34797587 TAGTGTAAAAAGAACATGACTGG - Intronic
1006614320 6:35315391-35315413 CTGAGTAAAAAGAACGAAGCTGG - Intronic
1006916363 6:37596528-37596550 CAGGTTTAAAAGAAGAAGGTGGG + Intergenic
1008069874 6:47088553-47088575 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1008167449 6:48156054-48156076 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
1008192734 6:48480312-48480334 CTGAGCAAAAAGAACAAGACTGG + Intergenic
1008264295 6:49405131-49405153 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1008315797 6:50038545-50038567 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1008352093 6:50504096-50504118 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1008473116 6:51906715-51906737 CAGGTTTCAAAGATCAAGGCTGG - Intronic
1008527583 6:52421293-52421315 TAGAATAAAAAGAACAGGGCCGG - Intronic
1008548935 6:52608982-52609004 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1008865854 6:56208724-56208746 CTAGGTAAAAAGAACAAAGCTGG + Intronic
1008937395 6:57006789-57006811 CTGAGCAAAAAGAACAATGCTGG + Intronic
1009030581 6:58052911-58052933 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009262695 6:61514782-61514804 CAGGATAAAAAGTACAAGGAAGG + Intergenic
1009283028 6:61775841-61775863 CTGAGTCAAAAGAACAAAGCTGG + Intronic
1009448126 6:63767774-63767796 CTAAGCAAAAAGAACAAGGCCGG + Intronic
1009514416 6:64596413-64596435 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1009577734 6:65488676-65488698 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1009764732 6:68057445-68057467 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1009945710 6:70340057-70340079 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1009997755 6:70915844-70915866 CTGGGCAAAAAGAACAAAGCTGG - Intronic
1010008217 6:71019745-71019767 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010019964 6:71147988-71148010 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010102009 6:72121094-72121116 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1010156934 6:72805610-72805632 CTGGGCAAAAAGAACAAAACTGG - Intronic
1010346843 6:74820917-74820939 CTGAGTGAAAAGAACAAAGCTGG + Intergenic
1010466277 6:76170331-76170353 CGGAGCAAAAAGAACAAAGCTGG + Intergenic
1010467023 6:76179909-76179931 AAGCATAAAAAGAACAAAGCTGG + Intergenic
1010484675 6:76395593-76395615 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1010539918 6:77080327-77080349 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010681370 6:78803034-78803056 CTATGTAAAAAGAACAAAGCTGG - Intergenic
1010838314 6:80616752-80616774 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1010857947 6:80866558-80866580 TTGAGTAAAAAGAACAAAGCTGG + Intergenic
1010888412 6:81272678-81272700 CAGCGTAGCAAGAACAATGCAGG - Intergenic
1011027810 6:82888143-82888165 CAGCCTAAAAAGGACATGGCAGG - Intergenic
1011033598 6:82949563-82949585 CTGAGTAAAAAGAACAAAACTGG + Intronic
1011062593 6:83288596-83288618 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1011103611 6:83753341-83753363 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1011199441 6:84819012-84819034 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1011303801 6:85904467-85904489 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1011324283 6:86131953-86131975 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1011392722 6:86872179-86872201 CCAGGCAAAAAGAACAAAGCTGG + Intergenic
1011539093 6:88411065-88411087 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1011922727 6:92601240-92601262 CAGAGCAAAAAGAACAACGCAGG + Intergenic
1011969650 6:93207212-93207234 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1011985243 6:93435604-93435626 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1012571795 6:100738657-100738679 CAAAGCAAAAAGAACAAAGCTGG - Intronic
1012587482 6:100941630-100941652 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1012596705 6:101049608-101049630 CAACGAAAAAAGAACAAAGCTGG - Intergenic
1012725437 6:102804849-102804871 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1012766386 6:103371585-103371607 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1012778648 6:103528735-103528757 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
1012798895 6:103800358-103800380 CAGAGTAAAAACAAAAAGGGAGG + Intergenic
1012826189 6:104150352-104150374 CTGGGCAAAAAGAACAAATCTGG - Intergenic
1012878841 6:104761248-104761270 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1012893032 6:104918727-104918749 AAGGTTAAAAAGAACAAAGCTGG - Intergenic
1012922023 6:105229987-105230009 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1012955140 6:105561913-105561935 CAGGGAGAAAAAAAAAAGGCAGG + Intergenic
1013495959 6:110697714-110697736 CTAGGCAAAAAGAACAAAGCTGG + Intronic
1013518234 6:110908979-110909001 CTGAGTCAAAAGAACAAAGCTGG + Intergenic
1013741742 6:113295505-113295527 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1013815018 6:114087272-114087294 CAGGGAAGGAAGAACAATGCTGG - Intronic
1014113790 6:117650230-117650252 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1014176564 6:118337687-118337709 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1014560218 6:122880744-122880766 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1014643861 6:123949243-123949265 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1014833935 6:126136683-126136705 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1014838764 6:126191885-126191907 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
1014902699 6:126987168-126987190 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
1015247963 6:131096264-131096286 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015658134 6:135543034-135543056 CTAGGCAAAAAGAACAATGCAGG + Intergenic
1015735561 6:136396006-136396028 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016155161 6:140797045-140797067 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1016444996 6:144122367-144122389 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
1016650849 6:146457926-146457948 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1016655205 6:146510911-146510933 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1016660716 6:146575902-146575924 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1017143262 6:151211180-151211202 CTGAGAAAAAAGAACAAAGCTGG + Intergenic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017411931 6:154176839-154176861 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1017439280 6:154448151-154448173 TAGGCTAAAATGAACAAAGCTGG - Intronic
1017763124 6:157586231-157586253 CTGGATAAATAAAACAAGGCAGG + Intronic
1017998043 6:159550900-159550922 CTGGGCAAAAAGAACAAAACTGG - Intergenic
1018144240 6:160868076-160868098 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1018448613 6:163883212-163883234 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1018895011 6:168008516-168008538 CTGAGAAAAAAGAACAAAGCTGG - Intronic
1020389234 7:7640879-7640901 CAGAGTCAAAAGAGCTAGGCGGG + Exonic
1020420559 7:7999606-7999628 GTGTCTAAAAAGAACAAGGCTGG + Intronic
1020429053 7:8100826-8100848 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1020490299 7:8774346-8774368 CTGAGCAAAAAGAACAAGGCTGG - Intergenic
1020512499 7:9075427-9075449 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1020574004 7:9902545-9902567 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1020636387 7:10700564-10700586 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
1020810394 7:12844228-12844250 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1020890945 7:13877090-13877112 CATGGGAAAAAGATGAAGGCCGG - Intergenic
1020970332 7:14930164-14930186 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1021004775 7:15380731-15380753 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1021224140 7:18008377-18008399 CTGGGAAAGAAGAACAAAGCTGG - Intergenic
1021501878 7:21340790-21340812 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1021594057 7:22296002-22296024 CAGGGTAAGGAGAACAAAGGAGG + Intronic
1021605824 7:22408505-22408527 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1021984209 7:26083488-26083510 AAGGGTAAAAAGAGAAAGGGAGG + Intergenic
1022293577 7:29027994-29028016 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1022346638 7:29522140-29522162 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
1022365794 7:29714806-29714828 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1022549302 7:31222695-31222717 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1023419961 7:39968743-39968765 CTGAGCAAAAAGAACAAGGCTGG - Intronic
1023435954 7:40140792-40140814 CCAAGTAAAAAGAACAAAGCTGG - Intronic
1023666940 7:42533174-42533196 CTAGGCAAAAAGAACAATGCCGG + Intergenic
1024145024 7:46505775-46505797 CTAAGTAAAAAGGACAAGGCTGG + Intergenic
1024405967 7:48980543-48980565 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1024412180 7:49057114-49057136 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1025599644 7:62979633-62979655 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1025700358 7:63814001-63814023 CATGGTAAAAAGTTGAAGGCTGG + Intergenic
1025870492 7:65427913-65427935 TAAGGAAAAAAGAACAAAGCTGG + Intergenic
1025919598 7:65899071-65899093 CATGGTAAAAAGTTGAAGGCTGG + Intronic
1026077830 7:67189099-67189121 CAGGGTAGATAGAAAAAGGAAGG - Intronic
1026699025 7:72623018-72623040 CAGGGTAGATAGAAAAAGGAAGG + Intronic
1026929201 7:74213811-74213833 CAGGGTGGGAAGAACACGGCGGG + Intronic
1027919715 7:84377543-84377565 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1028140201 7:87265050-87265072 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1028330014 7:89578779-89578801 CTAAGTAAAAAGAACAAAGCAGG + Intergenic
1028334416 7:89633921-89633943 CTGGGCAAAAAGCACAAAGCTGG - Intergenic
1028433119 7:90771126-90771148 CAGGATACAAAGAACAAGTGAGG - Intronic
1028444279 7:90902293-90902315 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1028459596 7:91076171-91076193 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1028543092 7:91966777-91966799 CAAAGCAAAAAGAACAAAGCTGG - Intronic
1029004221 7:97190642-97190664 CTGTGCAAAAAGAACAAAGCTGG + Intergenic
1029215987 7:98950038-98950060 GAGGGTCAAAAGAAGAAGACAGG - Intronic
1030756861 7:113296184-113296206 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1030759787 7:113336392-113336414 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1031182353 7:118434353-118434375 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031530087 7:122865634-122865656 CATGGTAGAAATAACAAAGCTGG + Intronic
1031651757 7:124300140-124300162 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1031738230 7:125394723-125394745 CTGCGCAAAAAGAACAAAGCTGG + Intergenic
1031787664 7:126055008-126055030 CTGAGCAAAAAGAACAAGGCTGG + Intergenic
1031859651 7:126963865-126963887 CAAAGCAAAAAGAACAAAGCTGG + Intronic
1032454540 7:132063556-132063578 TAAGGTCAAAAGAACAAGCCAGG - Intergenic
1032522960 7:132560315-132560337 CAGTGGAAAAAGAACAATCCCGG - Intronic
1032883035 7:136110344-136110366 CATAGCAAAAAGAACAAAGCTGG - Intergenic
1032901416 7:136313560-136313582 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
1032963036 7:137062273-137062295 TTGGGCAAAAAGAACAAAGCTGG + Intergenic
1033412900 7:141136077-141136099 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1033532771 7:142282060-142282082 CTGGGTAACAAGAATGAGGCAGG - Intergenic
1033614114 7:142995234-142995256 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1033833324 7:145279223-145279245 CTGGGCAAAAAGAACAAAACTGG - Intergenic
1034914988 7:155030665-155030687 CTGAGTAAAAAGAACAAAACTGG - Intergenic
1035567299 8:650072-650094 CCGGTTCAGAAGAACAAGGCCGG + Intronic
1037031990 8:14119003-14119025 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1037255873 8:16952874-16952896 CTGAGTAAAAAGAACAAAACTGG + Intergenic
1037277178 8:17193106-17193128 CTGAGTAAAAAGAACAAAACTGG - Intronic
1037282452 8:17257360-17257382 CTGAGCAAAAAGAACAAGGTTGG - Intronic
1037470603 8:19205684-19205706 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038936001 8:32252636-32252658 CTAGGCAAAAAGAACAAAGCTGG - Intronic
1039005582 8:33032964-33032986 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1039134283 8:34302262-34302284 CAAGACAAAAAGAACAAAGCTGG + Intergenic
1039145596 8:34443047-34443069 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1039331654 8:36543827-36543849 ATGAGCAAAAAGAACAAGGCTGG + Intergenic
1039421789 8:37449722-37449744 CAAGGTACAAAGAACTAGCCTGG + Intergenic
1039435245 8:37555632-37555654 GAGAGTAAAAAGTACAAGTCAGG + Intergenic
1040040165 8:42908362-42908384 CATGAGAAAAAGAACAAAGCTGG + Intronic
1040355374 8:46612578-46612600 CTGGGTAAGAAGAACAAAGCTGG + Intergenic
1040443398 8:47468403-47468425 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1040474857 8:47766731-47766753 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1040536059 8:48311458-48311480 TTGAGTAAGAAGAACAAGGCTGG + Intergenic
1040734556 8:50490212-50490234 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1041167835 8:55108198-55108220 GAGGCAAGAAAGAACAAGGCAGG + Intronic
1041575139 8:59385529-59385551 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1041764276 8:61401762-61401784 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1042129473 8:65573109-65573131 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1042634497 8:70858558-70858580 CTGAGCAAAAAGAACAATGCTGG + Intergenic
1043116448 8:76260081-76260103 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
1043129012 8:76437863-76437885 CTGGGTAAGAAGAACAAAGCTGG - Intergenic
1043145280 8:76646632-76646654 CTGGGTAAAAAGAATAAAACTGG + Intergenic
1043329772 8:79101202-79101224 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1043344020 8:79277931-79277953 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1043740726 8:83808277-83808299 CAGGAGAAAAAGATCAAGGGTGG - Intergenic
1043762848 8:84090873-84090895 CTGAGTAAAAATAACAAGGCTGG - Intergenic
1043836455 8:85052737-85052759 CAGGGCAAGAAGAACAAAGCTGG + Intergenic
1043929925 8:86079028-86079050 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1044101297 8:88143070-88143092 AAATCTAAAAAGAACAAGGCAGG + Intronic
1044143540 8:88684902-88684924 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1044241869 8:89898245-89898267 CTGGGTAAAAAGAACAAAACTGG + Intergenic
1044394507 8:91694248-91694270 CTGAATAAAAAGAACAAAGCTGG - Intergenic
1044508160 8:93044967-93044989 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1045030625 8:98131997-98132019 CAGTGGAAAAAGCACAAGCCAGG - Intronic
1045143112 8:99309623-99309645 CTTGGCAAAAAGAACAAAGCTGG - Intronic
1045155502 8:99464942-99464964 TAAGAAAAAAAGAACAAGGCAGG - Intronic
1045570786 8:103367235-103367257 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
1045572721 8:103386182-103386204 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1045592791 8:103617068-103617090 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1045812810 8:106243628-106243650 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1045933109 8:107649639-107649661 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1045945710 8:107793699-107793721 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1046068290 8:109221747-109221769 CAGCTCAAAAAGAACAAGACAGG + Intergenic
1046167331 8:110453720-110453742 CCAGGCAAAAAGAACAAAGCTGG + Intergenic
1046245068 8:111548838-111548860 CATGGTGGAAAGAACAAGACAGG + Intergenic
1046441248 8:114257720-114257742 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1046486024 8:114889859-114889881 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1046501738 8:115086598-115086620 CAGTCTAAATAAAACAAGGCAGG - Intergenic
1046887283 8:119381361-119381383 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1047036562 8:120945698-120945720 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1048428917 8:134349686-134349708 CAAAGAAAAAAGAACAAAGCTGG - Intergenic
1048916326 8:139187397-139187419 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1049123946 8:140768528-140768550 CAGTGGAAAAAGGGCAAGGCTGG + Intronic
1049136028 8:140900958-140900980 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1049800835 8:144516860-144516882 CAGGCTAATTAGCACAAGGCTGG + Intronic
1049829391 8:144690640-144690662 AAGGGAAAAAAAAAAAAGGCAGG - Intergenic
1050039948 9:1479277-1479299 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1050127519 9:2374453-2374475 CTGAGCAAAAAGAACAAAGCCGG + Intergenic
1050186813 9:2983384-2983406 TAGGTTAAAAAAAACAAGGTTGG + Intergenic
1050202887 9:3166505-3166527 CAAAGAAAAAAGAACTAGGCTGG - Intergenic
1050791340 9:9474383-9474405 CTGTGTAAAAAGAATAAAGCTGG - Intronic
1050877392 9:10655654-10655676 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1050963803 9:11770895-11770917 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1051199523 9:14600700-14600722 CGAAGCAAAAAGAACAAGGCTGG + Intergenic
1051230903 9:14954412-14954434 CTAAGCAAAAAGAACAAGGCTGG + Intergenic
1051354360 9:16228016-16228038 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1051514317 9:17911404-17911426 CACTGTAAAACGAAGAAGGCTGG + Intergenic
1051688660 9:19685460-19685482 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1052001455 9:23287008-23287030 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1052156604 9:25200651-25200673 GAGGGTAAAATGAAGAAGCCAGG + Intergenic
1052255560 9:26452361-26452383 CAGAGCAAAAAGAAAAAAGCTGG - Intergenic
1052386864 9:27832991-27833013 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1052644561 9:31216340-31216362 CTGAGTAAAAAGAACAAAACTGG - Intergenic
1052697746 9:31899849-31899871 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1052723137 9:32196895-32196917 CTGAGTAAAAAGAGCAAAGCTGG - Intergenic
1053028781 9:34756653-34756675 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1053216106 9:36271971-36271993 CAGAGAGAAAAGAACAAGGATGG - Intronic
1053460593 9:38267470-38267492 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1053558286 9:39161209-39161231 CAAGGCAAAAAGAACAAATCTGG + Intronic
1053571167 9:39309319-39309341 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1053822399 9:41981446-41981468 CAAGGCAAAAAGAACAAATCTGG + Intronic
1053837057 9:42149932-42149954 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1054092733 9:60868022-60868044 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1054114204 9:61143928-61143950 AAAAGTAAAAAGAACAAAGCTGG + Intergenic
1054125978 9:61309693-61309715 AAAAGTAAAAAGAACAAAGCTGG - Intergenic
1054138829 9:61457717-61457739 CAAGGCAAAAAGAACAAATCTGG - Intergenic
1054593548 9:67038584-67038606 AAAAGTAAAAAGAACAAAGCTGG - Intergenic
1054608177 9:67205932-67205954 CAAGGCAAAAAGAACAAATCTGG - Intergenic
1054770678 9:69080319-69080341 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1054908789 9:70434552-70434574 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1055015837 9:71616924-71616946 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
1055126863 9:72728910-72728932 CAAGGTAAAAATAACAAGCTGGG - Intronic
1055165694 9:73189772-73189794 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1055283732 9:74705167-74705189 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1055747076 9:79459854-79459876 CATGGGAAAAAGAACAAAGCAGG + Intergenic
1056174197 9:84018206-84018228 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1056282653 9:85056994-85057016 CAGCTTAAAAAGAACAAGAAGGG - Intergenic
1056441455 9:86625667-86625689 AAGGGTAATAAGAACAATGTAGG + Intergenic
1058227241 9:102380539-102380561 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1058671778 9:107366452-107366474 CAGAGTAAGAAGAACCAGGGAGG - Intergenic
1058709180 9:107664582-107664604 CAGGGTAAAATCGAGAAGGCTGG + Intergenic
1058759656 9:108118675-108118697 CAGGGCAAATGGACCAAGGCAGG + Intergenic
1059053874 9:110958278-110958300 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1059060023 9:111025969-111025991 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1059086821 9:111312141-111312163 CTGAGCAAAAAGAACATGGCTGG - Intergenic
1059095102 9:111404562-111404584 CAGGAGAAAAATAACAAAGCGGG - Intronic
1059683800 9:116614422-116614444 CTAAGTAAAAAGAACAAAGCTGG + Intronic
1059965266 9:119607735-119607757 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1060079686 9:120631417-120631439 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1060262440 9:122088255-122088277 CAGAGTAGGAACAACAAGGCAGG - Intronic
1061147900 9:128810472-128810494 CAGGGAAAAATGAACAGGGATGG + Intergenic
1061228607 9:129297542-129297564 CTGGGCAAGAAGAACAAAGCCGG - Intergenic
1203398148 Un_KI270519v1:47083-47105 CTGAGTCAAAAGAACAAAGCGGG + Intergenic
1186381506 X:9065130-9065152 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1186687742 X:11943234-11943256 AAGAGTAAAAAGAAAAAGGCAGG - Intergenic
1186769047 X:12799373-12799395 CAAGATAAAAAGGACAAGGTAGG + Exonic
1186934870 X:14437602-14437624 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1186937382 X:14464940-14464962 CTGGGAAAAAAGAACAAAACTGG - Intergenic
1187181043 X:16944560-16944582 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1187247945 X:17570110-17570132 CTGGGCAAGAAGAACAAAGCTGG - Intronic
1187267285 X:17746993-17747015 CTGGGATGAAAGAACAAGGCAGG - Intronic
1187294289 X:17984149-17984171 CAAGGTAGAAAAACCAAGGCAGG - Intergenic
1187620219 X:21044620-21044642 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1187620685 X:21050248-21050270 CTAAGCAAAAAGAACAAGGCAGG + Intergenic
1187705952 X:22009577-22009599 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1187713986 X:22083307-22083329 CTGGGCAAAAATAACAAAGCTGG - Intronic
1187729993 X:22242980-22243002 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1187738423 X:22328340-22328362 TAGGGTAGAAAGAACATGGAAGG + Intergenic
1188062722 X:25620386-25620408 CAGGGTAAAAGACACAAGACAGG - Intergenic
1188146439 X:26619567-26619589 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
1188288832 X:28363524-28363546 CTGAGCCAAAAGAACAAGGCTGG - Intergenic
1188492402 X:30751372-30751394 CTGAGCAAAAAGAACAATGCTGG - Intergenic
1188603204 X:31994881-31994903 CAGGTTTAAAAGACCAAGTCAGG + Intronic
1188730132 X:33635679-33635701 CTGCGTAAAAAGAACAAAGCTGG - Intergenic
1188995065 X:36874311-36874333 CTGAGCAAAAAGAACAAAGCAGG + Intergenic
1188995192 X:36876202-36876224 TTGAGCAAAAAGAACAAGGCTGG + Intergenic
1189721445 X:43923341-43923363 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1189761919 X:44330506-44330528 AACAGTAAAAAAAACAAGGCTGG + Intronic
1189900584 X:45702057-45702079 CAGGGTGGAAAGAACAACTCTGG - Intergenic
1189938198 X:46091816-46091838 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
1189951096 X:46231764-46231786 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1190437947 X:50445722-50445744 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1190621393 X:52290011-52290033 CTGGGCAAAAAGAAAAAAGCTGG - Intergenic
1190693180 X:52929302-52929324 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1190965351 X:55295022-55295044 CAAGGCAAAAAGAACAAAGCTGG - Intergenic
1191001968 X:55669771-55669793 CAGGGCAAGAAGAACAAAGCTGG - Intergenic
1191023016 X:55883000-55883022 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1191265100 X:58380913-58380935 CAGGATAAAAAAGACAAGGACGG - Intergenic
1191268452 X:58429515-58429537 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1191651747 X:63546034-63546056 CCAAGCAAAAAGAACAAGGCTGG + Intergenic
1191664924 X:63691755-63691777 CCGAGCAAAAAGAACAAAGCTGG + Intronic
1191792617 X:64986782-64986804 TGGGGCATAAAGAACAAGGCAGG + Intronic
1191815784 X:65242678-65242700 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1191909572 X:66134240-66134262 CAGAGCAAAAAGAACAAAACTGG - Intergenic
1191925650 X:66306953-66306975 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1192006661 X:67221255-67221277 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
1192058510 X:67798655-67798677 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
1192204688 X:69088222-69088244 CAGGGAAATCAGAACCAGGCTGG - Intergenic
1192258565 X:69488029-69488051 CAAGCAAAAAAGAACAAAGCTGG - Intergenic
1192302881 X:69924589-69924611 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1192655150 X:72985430-72985452 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1192886765 X:75343515-75343537 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1192892327 X:75403926-75403948 CAAAGCAAAAAGAACAAAGCTGG + Intronic
1192921031 X:75706480-75706502 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
1192948729 X:75993579-75993601 GTGAGCAAAAAGAACAAGGCTGG - Intergenic
1192957212 X:76084932-76084954 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1192976774 X:76294608-76294630 CTGGGCAACAAGAACAAAGCTGG - Intergenic
1193079769 X:77394893-77394915 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1193099621 X:77593975-77593997 GAGGGAAAAAAGAGAAAGGCAGG + Intronic
1193162706 X:78245777-78245799 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1193375400 X:80753962-80753984 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1193437061 X:81487895-81487917 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1193461745 X:81798327-81798349 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1193477656 X:81986291-81986313 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1193528071 X:82618242-82618264 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1193572222 X:83158203-83158225 CTGAGCAAAAAGAACAAGGCTGG - Intergenic
1193622859 X:83778023-83778045 CAAAGTAAAAAGAACAACGTTGG - Intergenic
1193671517 X:84392356-84392378 CTGGGAAAAAAGAACCAAGCTGG - Intronic
1193674532 X:84433627-84433649 CTGAGTAAAAAGAACAATGCAGG - Intronic
1193676581 X:84461221-84461243 CAGAGCAAAAAGATCAAAGCTGG + Intronic
1193725645 X:85035919-85035941 CTAAGTAAAAAGAACAAAGCTGG - Intronic
1193804203 X:85973773-85973795 CTGGGAAAAAAGAACAAAGTAGG + Intronic
1193821019 X:86164875-86164897 CTAAGTAAAAAGAACAAAGCCGG - Intronic
1193890161 X:87034037-87034059 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1193893312 X:87079253-87079275 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1193895574 X:87110600-87110622 CAAAGCAAAAAGAACAAAGCTGG + Intergenic
1193913481 X:87335176-87335198 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1193970439 X:88044474-88044496 CTGAGTAAAAAGAACAAAGATGG + Intergenic
1194030761 X:88810594-88810616 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1194118508 X:89932935-89932957 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1194208088 X:91035581-91035603 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1194324904 X:92502422-92502444 CATAGCAAAAAGAACAAAGCAGG + Intronic
1194462300 X:94186560-94186582 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1194537440 X:95122268-95122290 CTAAGTAAAAAGAACAAGACTGG + Intergenic
1194692444 X:97004229-97004251 CTGAGTAAAAAGAACAAAACTGG - Intronic
1194708564 X:97204872-97204894 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1194854317 X:98910383-98910405 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1194905265 X:99567969-99567991 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1194930558 X:99882059-99882081 CAGGGAAAACAGAACCAAGCTGG + Intergenic
1194986766 X:100498570-100498592 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1195149095 X:102047220-102047242 CTAAGCAAAAAGAACAAGGCTGG - Intergenic
1195205623 X:102597553-102597575 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1195236915 X:102909545-102909567 CAGACCAAAAAGAACAAAGCTGG + Intergenic
1195250910 X:103045977-103045999 CTGAGTAAAAAGAACAAAACAGG - Intergenic
1195475465 X:105279978-105280000 CTGGGTGAGAAGAACAAAGCTGG + Intronic
1195622470 X:106971015-106971037 CTGGGCAAGAAGAACAAAGCTGG + Intronic
1195976080 X:110528545-110528567 CTGAGTAAAAAGAATAAAGCTGG + Intergenic
1195988066 X:110653930-110653952 CAGGTTAAAAAGTAAAAGGATGG + Intergenic
1196312803 X:114188169-114188191 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1196534238 X:116823031-116823053 CATAGCAAAAAGAACAAAGCTGG + Intergenic
1196945450 X:120820419-120820441 CTCAGTAAAAAGAACAAAGCTGG - Intergenic
1196976112 X:121159424-121159446 CAGGGGAAAAAGTCCAGGGCAGG + Intergenic
1197096467 X:122602604-122602626 CTGTGTGAAAAGAACAAAGCTGG + Intergenic
1197156786 X:123278866-123278888 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1197166833 X:123386899-123386921 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1197346988 X:125336191-125336213 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1197356454 X:125441844-125441866 CAAGGTAAAAACAACAAAGTTGG - Intergenic
1197413442 X:126146384-126146406 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1197428460 X:126327620-126327642 CTAAGTAAAAAGAACAAAGCTGG + Intergenic
1197525935 X:127562866-127562888 CTAAGTAAAAAGAACAAAGCTGG - Intergenic
1197532959 X:127653322-127653344 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
1197594033 X:128445231-128445253 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1197684167 X:129421059-129421081 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1197700995 X:129599573-129599595 CATGGTAAAAAGCACAAAACAGG - Intergenic
1197765885 X:130059426-130059448 CAGGTTGGAAAGATCAAGGCAGG + Intergenic
1197858408 X:130944015-130944037 CAGGGTGAAAAGAACAATAAAGG - Intergenic
1198060143 X:133037616-133037638 CTGAGCAAAAAGAACAATGCTGG - Intronic
1198072575 X:133164054-133164076 CTGGGCAAGAAGAACAAAGCTGG + Intergenic
1198255190 X:134918258-134918280 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1198315909 X:135465935-135465957 CTGGGCAAAAAGAACAAAACTGG + Intergenic
1198490384 X:137134161-137134183 CTGGGTAAGAAGAACAAAGTTGG + Intergenic
1198584210 X:138101799-138101821 CTGAGTAAAAAGAACAAATCTGG + Intergenic
1198759179 X:140013024-140013046 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1198779560 X:140220548-140220570 CTAGGCAAAAAGAACAAAGCTGG + Intergenic
1199161557 X:144618050-144618072 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1199162726 X:144633257-144633279 CAAGGCAAAAAGAACAAAACTGG + Intergenic
1199167314 X:144692108-144692130 CTAGGCAAAAAGAACAAAGCTGG - Intergenic
1199183234 X:144883255-144883277 CTATGTAAAAAGAACAATGCTGG + Intergenic
1199332537 X:146579656-146579678 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1199376264 X:147113436-147113458 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1199563714 X:149191908-149191930 CAAAGCAAAAAGAACAAAGCTGG - Intergenic
1199735860 X:150686137-150686159 CAGGGCAAAATGAAAAATGCAGG - Intergenic
1199888718 X:152051688-152051710 CTGAATAAAAAGAACAAAGCTGG - Intergenic
1200194752 X:154240186-154240208 CAGGGAAAGAAGAGGAAGGCAGG + Intergenic
1200252041 X:154558978-154559000 CAGGGAAAAAGGCACAGGGCAGG + Intronic
1200265727 X:154645438-154645460 CAGGGAAAAAGGCACAGGGCAGG - Intergenic
1200471389 Y:3590501-3590523 CTGGGCAAGAAGAACAAAGCTGG - Intergenic
1200633636 Y:5621597-5621619 CATAGCAAAAAGAACAAAGCAGG + Intronic
1200819245 Y:7565140-7565162 CAGGCTATCAAGACCAAGGCAGG + Intergenic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1200839282 Y:7763877-7763899 CTAAGAAAAAAGAACAAGGCTGG + Intergenic
1201864728 Y:18637687-18637709 AAGGTTAAAGAGAAGAAGGCAGG - Intergenic
1201868594 Y:18682691-18682713 AAGGTTAAAGAGAAGAAGGCAGG + Intergenic
1202094712 Y:21236986-21237008 CAAAGCAAAAAGAACAAAGCCGG - Intergenic
1202112640 Y:21439619-21439641 CTGAGCAAAAAGAACAATGCTGG - Intergenic