ID: 1182173735

View in Genome Browser
Species Human (GRCh38)
Location 22:28261076-28261098
Sequence AAGGCTAGGAAGAAAGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182173735_1182173742 20 Left 1182173735 22:28261076-28261098 CCTGTAACTTTCTTCCTAGCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1182173742 22:28261119-28261141 GGCTCTCTTGATTCCTCCCAAGG 0: 1
1: 0
2: 1
3: 12
4: 196
1182173735_1182173739 -1 Left 1182173735 22:28261076-28261098 CCTGTAACTTTCTTCCTAGCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1182173739 22:28261098-28261120 TAGGTGTATCACCCTAATTTAGG 0: 1
1: 0
2: 2
3: 5
4: 113
1182173735_1182173743 21 Left 1182173735 22:28261076-28261098 CCTGTAACTTTCTTCCTAGCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1182173743 22:28261120-28261142 GCTCTCTTGATTCCTCCCAAGGG 0: 1
1: 0
2: 1
3: 18
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182173735 Original CRISPR AAGGCTAGGAAGAAAGTTAC AGG (reversed) Intronic
903179511 1:21598166-21598188 ATGGCAAGGAAGAAAGTTAAGGG - Intronic
904234378 1:29105091-29105113 AAGGCTATGAAGCCAGTTTCAGG - Intronic
904936133 1:34131031-34131053 AATGCTAGGCAGAAAGGAACAGG - Intronic
906478851 1:46187442-46187464 AAGCTCAGGAAGAGAGTTACAGG - Intergenic
906756034 1:48316148-48316170 AATTCTATGAAGAAAGTCACTGG - Intronic
907134519 1:52127181-52127203 AGGGCTAGCAAGAAAGTGCCAGG - Intergenic
907759291 1:57342188-57342210 AAGGGTTGGAAGGAAGTTCCAGG - Intronic
907978481 1:59457005-59457027 AAGGCTGGGACGACAGTTTCTGG + Exonic
909239058 1:73189339-73189361 AAGGATAGGGAGAAAATAACTGG + Intergenic
909919786 1:81367097-81367119 AGGGCTAGCAGGAAAGTTGCTGG - Intronic
910106058 1:83632336-83632358 AAAGATAGGAAGAAAGTTAGAGG - Intergenic
910505108 1:87941619-87941641 ATGGCTAGGTAGAAAGATTCAGG + Intergenic
910905869 1:92177312-92177334 AAGCCTTTGAAGAAAGCTACAGG + Exonic
911295918 1:96114568-96114590 AAGACAAGGAAGAAACTTAAAGG + Intergenic
914863600 1:151406858-151406880 AAGGGGAGGAAAAAAGATACAGG - Intronic
915832984 1:159148124-159148146 AAGACTGGGAAGAAAGTTGGGGG - Intergenic
916373062 1:164121232-164121254 AATTCTGGGAAGAAAGTTATTGG - Intergenic
916955314 1:169827047-169827069 AAGGCTTGGAGGAAACTTGCTGG - Exonic
917274849 1:173320943-173320965 AATTCTGGGAAGAAAGTCACTGG - Intergenic
917668588 1:177249916-177249938 AGGGCAAGGAAGAAACTTATTGG + Intronic
917779557 1:178378244-178378266 AAGACTATCAAAAAAGTTACTGG + Intronic
917918984 1:179733805-179733827 AAGGCTTGGGAGAAGGTCACAGG + Intergenic
918044422 1:180933199-180933221 TAGGCTAAGAAGAAAGATCCAGG + Intronic
918637679 1:186797901-186797923 AATGTGAGGAAGAAAGTTGCAGG + Intergenic
918937223 1:190937549-190937571 AAGCCTGGGAAGAAAATGACTGG + Intergenic
918958972 1:191246258-191246280 AATTCTATGAAGAATGTTACTGG + Intergenic
919204928 1:194409619-194409641 AAGGATAATAAGAAAGTTTCAGG + Intergenic
920332360 1:205218986-205219008 AGTGCTTGGAAGAAAGTTCCCGG + Intergenic
920942043 1:210492704-210492726 AAGACTGGGATGAAAGATACAGG + Intronic
921625108 1:217371030-217371052 AAGGCAAAAAAGCAAGTTACCGG - Intergenic
922072696 1:222211754-222211776 AGGGCTAGGAAGAACGGTTCTGG - Intergenic
1063884406 10:10562938-10562960 AAAGCTAGGAACAAAGATAAAGG + Intergenic
1064248197 10:13686228-13686250 AAGGCCAGGAACAGAGATACAGG + Intronic
1065427857 10:25624142-25624164 AATTCTAGGAAGAAAGTCATTGG - Intergenic
1067483132 10:46618977-46618999 AAGGCAAGAAAGAGAGTTCCAGG - Intergenic
1067611621 10:47722667-47722689 AAGGCAAGAAAGAGAGTTCCAGG + Intergenic
1068719145 10:60222945-60222967 AATACTAGGTAAAAAGTTACAGG - Intronic
1069379529 10:67828710-67828732 AAGGCTAGGAAATAAATTAAAGG - Intronic
1070465775 10:76722203-76722225 CAGAGTAGGAAGAAAGTTAAGGG - Intergenic
1070700897 10:78601022-78601044 AATGCTAGGAAGGAAAATACAGG + Intergenic
1071627041 10:87182908-87182930 AAGGCAAGAAAGAGAGTTCCAGG + Intronic
1071906431 10:90179557-90179579 ATGCTTAGGAAGAAAGTTACTGG + Intergenic
1073749971 10:106514287-106514309 AGGACTAGAAAGAAAATTACAGG + Intergenic
1074150540 10:110755813-110755835 AAGGCAAGGATGAAACTTATTGG - Intronic
1075839648 10:125489846-125489868 AGGGCTAGGAAGAAAGTTGTGGG - Intergenic
1077840597 11:5970655-5970677 AAGACTAGGAAGAAAAATATTGG + Intergenic
1078455423 11:11471000-11471022 AAGGCAGGGAAGGAAGATACAGG - Intronic
1079576512 11:22010013-22010035 AAAACTATGAAGAAAGCTACAGG + Intergenic
1080572604 11:33569834-33569856 AATGACAGGAAGAAAGTCACTGG + Intronic
1080661885 11:34303202-34303224 AAGGCTAGGAAGAAATATAAAGG + Intronic
1081239847 11:40691629-40691651 AAGCCTTTGAAGAAAGTGACTGG + Intronic
1083944026 11:65913957-65913979 AAGGTTATGAAGAAAGTAAGTGG - Intergenic
1086728906 11:90223375-90223397 AAGGCAAGGAAGAAGGGTGCTGG - Intergenic
1087159569 11:94935658-94935680 ATGGCAAGGAAGAGAGTTAGGGG - Intergenic
1088747180 11:112813933-112813955 AAGTCTAGGGAGAAGGTCACAGG + Intergenic
1089058325 11:115606028-115606050 GAGGCGAGGATGAAAATTACAGG + Intergenic
1089087131 11:115829725-115829747 ATAGGTAGGATGAAAGTTACAGG + Intergenic
1089362056 11:117897374-117897396 AAGCCTAGGAACAAAGTTTATGG + Intergenic
1090952596 11:131486715-131486737 AAGGAAAGGAAGAAGGTGACAGG - Intronic
1091645064 12:2266991-2267013 AAGGAAAGGAAGAAAGGTCCTGG - Intronic
1092846488 12:12589681-12589703 AAGGTTAGGAGGAAGGTTAGTGG + Intergenic
1094306926 12:29030611-29030633 AAGTTTAGGAAGCAAGTTGCAGG + Intergenic
1094420474 12:30265562-30265584 ATTTCTATGAAGAAAGTTACTGG - Intergenic
1095157594 12:38877445-38877467 AATGGTAGGAACAAAGTTACAGG - Intronic
1095208574 12:39466979-39467001 CAGGCTAAGAAGAAAGCTGCTGG - Intergenic
1096265464 12:50119060-50119082 CAGGCTAAAAAGAAACTTACTGG - Intronic
1097373746 12:58816005-58816027 AAGGAAAGGAAGAAAGTTGAAGG - Intergenic
1097602095 12:61705829-61705851 AAGACGAGGAAGAAAACTACAGG - Intergenic
1097687206 12:62702377-62702399 AAGACTAGGAAGAACTTTAAAGG - Intronic
1098125244 12:67284919-67284941 AGGGGTAGGAAGAAAGTTAGAGG + Intronic
1098174348 12:67775401-67775423 AAGGCCATGAAGAATGTCACAGG + Intergenic
1101310310 12:103572630-103572652 TAGGCTAGGAAGAAATAAACAGG + Intergenic
1101531859 12:105580714-105580736 AAGGCTAGGAAGAAGGCAAGGGG - Intergenic
1101696811 12:107134702-107134724 AGGGCAAGGAGGAAGGTTACAGG + Intergenic
1105453411 13:20520190-20520212 ATGGATAGGAAGAAAGAAACTGG + Intronic
1107178883 13:37432898-37432920 AAGGCTAGGTAAAAAATTACAGG + Intergenic
1107242829 13:38257813-38257835 ATGGCTAGGAAGATTGTTAGGGG + Intergenic
1107717460 13:43215024-43215046 AAGGATAGCATGAAAATTACTGG + Intronic
1107980069 13:45726804-45726826 AATGCTATGAAGAAAGTAATAGG + Intergenic
1108334939 13:49430494-49430516 AGGGCAGGGAAAAAAGTTACTGG + Intronic
1109328258 13:60896464-60896486 AAGGCTGGGAACAAAGAAACTGG - Intergenic
1109549438 13:63874263-63874285 AAGGCTGGGCAGGAAGTTGCTGG - Intergenic
1110349821 13:74494234-74494256 AAGTCTGTGAAGAAAGTCACTGG - Intergenic
1111690990 13:91562804-91562826 AAGTCTTGTAAGAAAGTTTCTGG - Intronic
1112083280 13:96000307-96000329 AAGGCTTGGTAGAAAGTTTAGGG - Intronic
1112681694 13:101774334-101774356 AAGGGTAGAGAGAAAATTACAGG - Intronic
1115507071 14:34102825-34102847 AAGGCCAGAAGGAAAGTGACAGG - Intronic
1117931979 14:60853070-60853092 AACTCTGGGAAGAAAGTCACTGG + Intronic
1118675636 14:68181664-68181686 AATACTAGAAAGGAAGTTACGGG + Intronic
1118762132 14:68886387-68886409 AAGCTTAGGAAAAAAATTACAGG + Intronic
1119567439 14:75640753-75640775 AAGGCCAGGAAGAAGTTCACAGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120557935 14:85953589-85953611 ATTGCTAGGATGAAAGTTTCTGG + Intergenic
1120663318 14:87276469-87276491 AAGGTTTGAAAGCAAGTTACTGG - Intergenic
1121985046 14:98497178-98497200 AAGGAGAGGGAGAAAGTTGCCGG + Intergenic
1122511585 14:102272869-102272891 AAGGCTAGAAAAAAAGTCATGGG + Intronic
1124704222 15:31948418-31948440 ATGGCTTGAAAGAAAGTTTCAGG - Intergenic
1125020975 15:34986847-34986869 CAGGCTAGGAAAGAAGTTATGGG + Intronic
1125238644 15:37547764-37547786 CAGGCTAGGAAGAAGGTAAAGGG + Intergenic
1126566534 15:50107070-50107092 TTGTCTAGGAAGAAAGTTAAAGG - Intronic
1127032198 15:54876302-54876324 AATTCTATGAAGAAAGTCACTGG - Intergenic
1128928253 15:71678869-71678891 AAGGCCACAAAGAAAGTTAAAGG - Intronic
1129728037 15:77911636-77911658 AAAGTTATGAATAAAGTTACTGG - Intergenic
1131423264 15:92325241-92325263 TAGGAGAGGAAGAAAGGTACTGG + Intergenic
1134396742 16:13872144-13872166 AAGGCTACAAAGAAGGTGACAGG + Intergenic
1135523693 16:23197211-23197233 AAGGCTAGGAAAACATTTCCTGG - Intronic
1135922425 16:26663227-26663249 GAGGCCAAGAAGAAAGTGACAGG + Intergenic
1137247008 16:46714065-46714087 AAGGCTAGGAAGAGAGTCAACGG + Intronic
1138074649 16:54029552-54029574 GACGGTAGGAAGAGAGTTACAGG - Intronic
1139286860 16:65823037-65823059 AAGGCCATGCAGAAAGTCACAGG + Intergenic
1140340888 16:74160144-74160166 AAAACTAGAAAGAAAATTACTGG - Intergenic
1144512173 17:15886707-15886729 AAGGAGAGGAAGAAAATTCCAGG + Intergenic
1147438448 17:40432087-40432109 AGAGCTAGGGAGAAAGTGACAGG - Intergenic
1149244521 17:54689922-54689944 AAAACTAGGGAGAAAGATACTGG + Intergenic
1150368356 17:64611992-64612014 AAGCCTAGGAAGAATGTTTCAGG - Intronic
1152991218 18:365612-365634 GAGGCAAGGAAGAAGGTGACAGG + Intronic
1153760825 18:8330291-8330313 AAGGCAAGAAAAAAAGTCACTGG - Intronic
1155382570 18:25240230-25240252 AAGACTAGGGACAAAGTTGCTGG + Intronic
1155882807 18:31170528-31170550 AAGGCTAGTGAGAGAATTACAGG + Intergenic
1158300524 18:56047165-56047187 AAGCCCAGGAAGAGAGTTCCAGG + Intergenic
1158871874 18:61696093-61696115 AAGGCGATAAAGAAAGGTACTGG + Intergenic
1160341174 18:78090080-78090102 AAGGTAAGAAAGAAAGATACTGG + Intergenic
1165219862 19:34306657-34306679 CAGCCTAGGAAGTCAGTTACTGG + Intronic
1165339951 19:35204238-35204260 GAGGCTAGGAAGAGGGTTAAAGG + Intergenic
1166046547 19:40233791-40233813 AAGGCTAAGTAAAAAGTTAGGGG + Exonic
927596368 2:24401547-24401569 AAGGGTAGGAGGAAAGCTAGAGG + Intergenic
927838325 2:26419811-26419833 AAGGCTAGGAGTGAAGATACTGG + Intronic
928909433 2:36403856-36403878 AAGGGGAGGATGAGAGTTACAGG + Intronic
930718959 2:54620372-54620394 ATGGATAGTAAGAAAGTTATGGG + Intronic
931432681 2:62221080-62221102 AAGGATAGGAAGGAACTTCCTGG - Intronic
931519980 2:63085253-63085275 AATTCTAGGAAAAATGTTACTGG + Intergenic
932864839 2:75330778-75330800 AATTCTGTGAAGAAAGTTACTGG - Intergenic
933183977 2:79258682-79258704 CAGACTAGGAAGAAAAATACAGG + Intronic
933974514 2:87497458-87497480 AAGGCTAGGAATGCAGTTATGGG + Intergenic
934872235 2:97877321-97877343 AATTCTATGAAGAAAGTTAGTGG - Intronic
936319310 2:111453361-111453383 AAGGCTAGGAATGCAGTTATGGG - Intergenic
937106480 2:119319748-119319770 AAGGGTAGGGAGACAGTGACTGG + Intronic
937365928 2:121261291-121261313 AACACTTGGAAGATAGTTACTGG + Intronic
937996152 2:127696397-127696419 AAGGCAATGAAGACAGTGACAGG + Intergenic
938543263 2:132304337-132304359 GAGACTAGGAAAAAAATTACAGG + Intergenic
939100115 2:137886370-137886392 AAGGCTAGTGGGAAAGTTGCAGG + Intergenic
939423506 2:142004134-142004156 AAGGTTAGGAAGAAATTTACAGG + Intronic
944865616 2:203858453-203858475 GAGGCAAGGAAGAAAGATTCTGG - Intergenic
944952242 2:204764982-204765004 AAGGGAAGGAACAAATTTACAGG + Intronic
945021031 2:205571877-205571899 ATGCATAGGAAGAAAGTTACAGG + Intronic
945440286 2:209870490-209870512 AAGACTAGGAAGCAGGTCACAGG - Intronic
946093639 2:217252786-217252808 AAGACTAGGAAGGAAGCTGCTGG - Intergenic
1168874200 20:1159460-1159482 AAGGCTAGAAAGGCAGTTGCAGG - Intronic
1169032903 20:2425609-2425631 AAGGAGAGGAACAAAGTTAGAGG - Intronic
1171063865 20:21994073-21994095 TAGGTTAGGAAGCAAGTTTCTGG - Intergenic
1171872145 20:30537171-30537193 GAGACTAGGAAAAAAATTACTGG + Intergenic
1172413044 20:34740746-34740768 AAGGCATGTAAGAAAGTTACAGG - Exonic
1173104139 20:40116272-40116294 AATGCTGGGAAGATATTTACTGG - Intergenic
1173814273 20:45975143-45975165 AAGGCTTGGAAGAAGGCTCCAGG + Intergenic
1176016268 20:62934875-62934897 AAGGGTAGCAAGAAAGTGGCCGG - Intronic
1181337258 22:22147074-22147096 AAGGAGGGGAAGAAGGTTACAGG - Intergenic
1182173735 22:28261076-28261098 AAGGCTAGGAAGAAAGTTACAGG - Intronic
1182546435 22:31079424-31079446 TAGGCTAGGAGGAATGGTACAGG - Intronic
1182877681 22:33706458-33706480 AAGGCTAGGAAAGAAGCCACAGG + Intronic
950579513 3:13853282-13853304 AAGGCTAGGAAGGAATGTAAAGG + Intronic
952212383 3:31241388-31241410 CAGGATAGGAAGAAAGCAACGGG - Intergenic
952602544 3:35102532-35102554 AAGGTGAGGAAGAAAGTTGTTGG - Intergenic
952734521 3:36675568-36675590 AGGGCTAAGAAGAAAGTTCCTGG - Intergenic
955642557 3:61101579-61101601 AATTCTATGAAGAAAGTCACTGG + Intronic
957003711 3:74918224-74918246 ATGGCAAGGAAGAAGGTCACTGG - Intergenic
957492214 3:80943210-80943232 AAGGTTAGGAACAATGTCACTGG + Intergenic
960021580 3:112961540-112961562 AAAACTAGGAAAAAAGTTCCAGG + Intronic
961632327 3:128310253-128310275 AAGGGTAGGGAGAAAGTCACAGG + Intronic
962565317 3:136652039-136652061 AAGTCTCAGAAGAAAGTTTCAGG + Intronic
962624857 3:137215632-137215654 AATTCTATGAAGAAAGTTACTGG - Intergenic
963190186 3:142462237-142462259 AATGGTAGGAAGGAAGCTACTGG + Intronic
963607040 3:147420778-147420800 ATGACTAGGAAGAAAGTGGCCGG + Intronic
964603619 3:158532837-158532859 AAGACAAGTAACAAAGTTACTGG - Intronic
964912081 3:161795060-161795082 CAGGTTAGAAAGAAAATTACAGG + Intergenic
966293209 3:178385289-178385311 AAGGCTATGAAAGAAGTCACAGG - Intergenic
967081969 3:186058170-186058192 AAGGCAAGGCAAAAAGTTAAAGG + Intronic
969925781 4:10584483-10584505 TAGGCTATGAAGAGAGATACAGG + Intronic
970656533 4:18236570-18236592 AAGGTTATGAATAGAGTTACTGG + Intergenic
971091137 4:23346947-23346969 AAGGCTAGGTTCAAATTTACAGG - Intergenic
971708767 4:30084365-30084387 AAGTTTAGGAAAAAAGATACTGG + Intergenic
971949807 4:33330273-33330295 AAGACAAGAAAGAAAGGTACAGG + Intergenic
973329633 4:48899836-48899858 AATGTCAGGAAGAAAGTTTCTGG - Exonic
973587969 4:52411129-52411151 AAGGCCAGAGAGAAAGTTTCAGG - Intergenic
975552271 4:75625909-75625931 AAGTGTAGGAATAAAGATACTGG - Exonic
978646089 4:110933294-110933316 AAGGAAAGAAAGAAAGTCACAGG - Intergenic
979741656 4:124158958-124158980 AAGGCCAGGAAGCTAGTTAGTGG - Intergenic
981297530 4:143149217-143149239 GAGGCTAGAAATAAAGTTAGGGG + Intergenic
981886833 4:149685584-149685606 AAGGCTATGAAGAACTTTATGGG - Intergenic
982081006 4:151790050-151790072 AGAGCTAGGAAGAAACTTGCAGG - Intergenic
982908806 4:161113680-161113702 AATTCTATGAAGAAAGTTAATGG + Intergenic
984460570 4:180031087-180031109 AAGACTAAGAAGAAAGTAAAGGG + Intergenic
987205400 5:15620043-15620065 ATGGACAGGAAGAATGTTACTGG + Intronic
987617226 5:20291955-20291977 GAGGCTAGGAAGGAAATTACGGG - Intronic
989244352 5:39237242-39237264 AAGGCAAGGAAGGCAGTTAGGGG + Intronic
992692184 5:79251663-79251685 AAGGGTAGGAAGGAAGTTGAGGG - Intronic
992976454 5:82125800-82125822 AAGTCTGTGAAGAAAGTCACTGG + Intronic
992977288 5:82133749-82133771 AAGTCTGTGAAGAAAGTCACTGG + Intronic
993231682 5:85245872-85245894 TAGGCTAAGAAGGGAGTTACAGG - Intergenic
993782701 5:92088178-92088200 AAGGCAGGGAAGAAAAATACAGG - Intergenic
994743904 5:103655181-103655203 AAGACTTGGAAGAAAGTTTTTGG + Intergenic
995577395 5:113554312-113554334 AATACTAGGAAGAAAGTAAAGGG + Intronic
996592905 5:125167904-125167926 AAGGAGAGGAACAAAGTTAGAGG + Intergenic
999202400 5:149825602-149825624 AAGGCTAGGAAGAAAATAAAAGG - Intronic
1000592018 5:163169662-163169684 AATTCTATGAAGAAAGTTATTGG - Intergenic
1001476060 5:172051733-172051755 CAGGCGAGGAAGAGAGTGACTGG + Intronic
1003051573 6:2785326-2785348 AGGGCCAGAAAGAAAGTTAGTGG + Exonic
1003950473 6:11111204-11111226 AAGGCAGAGAAGAAAGTTGCAGG + Intronic
1004633375 6:17443057-17443079 AATGTTAGGAAGAAAGTTGCTGG - Intronic
1005652856 6:27900485-27900507 AAGGTTAGACAGACAGTTACTGG + Intergenic
1006979997 6:38139770-38139792 TAGCCTCGGAAAAAAGTTACTGG + Intronic
1008952260 6:57173356-57173378 AGGGGTAGGCAGTAAGTTACCGG + Intronic
1009283019 6:61775758-61775780 AATTCTATGAAGAAAGTCACTGG - Intronic
1010585433 6:77652621-77652643 AAGGATAGGAAGGAAGATATTGG + Intergenic
1010728654 6:79364419-79364441 AATTCTATGAAGAAAGTCACTGG + Intergenic
1011162054 6:84402606-84402628 AAGGCTAGAAAGAAAACCACTGG + Intergenic
1012083650 6:94793906-94793928 TAGGATAGAAAGAAAGATACAGG - Intergenic
1014561213 6:122892993-122893015 AATGCTATGAAGAAAGTCAATGG + Intergenic
1015606797 6:134965410-134965432 TAGGAAAGGAAGAAAGTTGCAGG - Intronic
1016079752 6:139841495-139841517 AAGGCTGAGAAGAAAGTTAGAGG + Intergenic
1016353992 6:143197922-143197944 AAGGCTATGAAAGAAGTTATGGG - Intronic
1016924451 6:149328914-149328936 TAGGCAAGGAAGAGAGTTACAGG + Intronic
1017109335 6:150917615-150917637 AAGGCTCAGAAGAAAGGAACAGG - Intronic
1017977669 6:159372420-159372442 AAGACTAGGGAGAAACTGACAGG - Intergenic
1018160758 6:161040249-161040271 AAGGCCAGTATGAAATTTACTGG + Intronic
1018663094 6:166106407-166106429 AAGGATAGCAAGATAGGTACAGG - Intergenic
1020690283 7:11346504-11346526 AAGGCAAGGCAGAAAGTAATCGG + Intergenic
1021206176 7:17784076-17784098 AAGGCTAGGAAGAATGTCAGTGG - Intergenic
1021214935 7:17904234-17904256 AAGGTTATGCAGAAAGTTAGCGG - Intronic
1022803701 7:33800306-33800328 AGGGCTAGGAAGAGCATTACAGG - Intergenic
1024420399 7:49159241-49159263 AAGGGTAGGGAAAGAGTTACAGG + Intergenic
1024682817 7:51711484-51711506 AAGACATGGAAGAAAGTCACTGG + Intergenic
1024695603 7:51853884-51853906 AAGTCTTGGAAGAGAGTTCCTGG - Intergenic
1025586064 7:62789339-62789361 AAAGCTAGAAAGAAACTTTCTGG + Intergenic
1025789002 7:64670304-64670326 AAGGTTAGAAAGAAGGTCACAGG + Intronic
1026165724 7:67907563-67907585 GAGGCTAGGAGGATACTTACAGG - Intergenic
1028283089 7:88957786-88957808 AAGACTAAGAAGAAAGTTTAGGG - Intronic
1029888314 7:103897910-103897932 TAGGCTAGGGAGAGAGTGACTGG - Intronic
1030153685 7:106430515-106430537 AAGGCAAGGCAGAAAGTGAAGGG - Intergenic
1031014315 7:116556708-116556730 AAGGTTAGGAAGCAATTTACCGG - Intronic
1035954974 8:4067150-4067172 AAAGCAAGGATGAAAGATACTGG + Intronic
1036007697 8:4685906-4685928 AACTCTATGAAGAAACTTACTGG + Intronic
1037132005 8:15417884-15417906 AAGGAAAGGAAGGAAGGTACAGG + Intronic
1037166608 8:15838150-15838172 CAGGCTAGGAAGATATTTTCAGG - Intergenic
1037196228 8:16193603-16193625 GAGGCTAGGGATAAAGGTACAGG - Intronic
1037358228 8:18045639-18045661 AAGGATAGGAAGAAGGGTGCTGG + Intergenic
1038119463 8:24596350-24596372 GAGGCTATGCAGTAAGTTACTGG - Intergenic
1039221677 8:35338732-35338754 AAGGCGAGGAAGAAGGAAACTGG - Intronic
1039819730 8:41125067-41125089 AAGGCTAGGAAGAAAATACATGG + Intergenic
1043618805 8:82161973-82161995 AAGGCTATGAAGAATGTTAAAGG - Intergenic
1043928720 8:86066673-86066695 AAGGCAAAAAAAAAAGTTACAGG - Intronic
1045683617 8:104688828-104688850 GAGGCTAGGAAAAGAGTAACTGG - Intronic
1047305367 8:123648754-123648776 AAGGCCAGGTGGAAAGGTACAGG + Intronic
1047428512 8:124768607-124768629 AAGGCTACAAAGAAAGTCAGAGG + Intergenic
1048540726 8:135339993-135340015 AATTCTGGGAAGAAAGTCACTGG - Intergenic
1053065729 9:35067642-35067664 AAAGCCATCAAGAAAGTTACAGG + Intronic
1053381681 9:37654228-37654250 AAGGCTGGGAAGAAAATAAGTGG + Intronic
1053611010 9:39713017-39713039 CAGGCAAGGAAGAGAGTTACTGG + Intergenic
1053869052 9:42471039-42471061 TAGGCAAGGAAGAGAGTTACTGG + Intergenic
1054087244 9:60758141-60758163 CAGGCAAGGAAGAGAGTTACTGG - Intergenic
1054242511 9:62629378-62629400 CAGGCAAGGAAGAGAGTTACTGG - Intergenic
1054556635 9:66663896-66663918 CAGGCAAGGAAGAGAGTTACTGG - Intergenic
1055727718 9:79249447-79249469 CAGCCAAGGAAGAAAGTTCCTGG + Intergenic
1057111516 9:92476584-92476606 TATGCTAGGAAGGAGGTTACAGG + Intronic
1057256546 9:93553277-93553299 AAGGCAAGGGAGAAAGAAACTGG - Intronic
1057703826 9:97383988-97384010 AAGCCCAAGAAGGAAGTTACAGG + Intergenic
1058167826 9:101640167-101640189 AATGCTGGGTAGAAAGCTACAGG - Intronic
1060522508 9:124301647-124301669 AAGGCCAGGAAGGAAGACACCGG - Intronic
1061901764 9:133676524-133676546 GAGGCTAGGAACTAAGTGACCGG + Intronic
1186770521 X:12813546-12813568 AAGGCTGTGTAGAAAGTCACTGG - Intronic
1187243913 X:17537436-17537458 CAGGCTAGGAAGCATATTACTGG - Intronic
1187901513 X:24030504-24030526 CAAGCTAGAGAGAAAGTTACTGG + Intergenic
1188089191 X:25941320-25941342 AAGGCTGAGAAAAAAGTCACAGG + Intergenic
1188618185 X:32185309-32185331 AAGGCTAATCAGATAGTTACTGG - Intronic
1189646472 X:43138224-43138246 AAGGGAAGGAAGAAAGTTATAGG + Intergenic
1189706206 X:43761320-43761342 AAGGCTAAGAAGAAAGTAAAGGG + Intergenic
1190029327 X:46956686-46956708 AAGGGAAGGAAGAAAGTAGCTGG - Intronic
1192011606 X:67278753-67278775 ATGGATAGGAACAAAGTTAATGG + Intergenic
1192794652 X:74416900-74416922 AAGGGTGGGAAGAAAATGACAGG + Intergenic
1193033923 X:76928968-76928990 AAGTCTATGAAGAAAGTCATTGG - Intergenic
1193794213 X:85853314-85853336 GAGGATAGGAAAAAAATTACAGG - Intergenic
1194149661 X:90308749-90308771 AAGGCTAAGAATAAAGTTACAGG + Intergenic
1194859339 X:98977391-98977413 AAGTGTAGGAAAAAAGTCACTGG + Intergenic
1195509280 X:105695955-105695977 AAGGCCAGGAGGACAGTTAGAGG + Intronic
1195662077 X:107389033-107389055 ACAATTAGGAAGAAAGTTACAGG + Intergenic
1196049020 X:111285308-111285330 TAGGCTAGGATCAATGTTACTGG - Intergenic
1196396063 X:115262841-115262863 AAGGCTAGGAGGAAAGGTATAGG + Intergenic
1196404844 X:115350356-115350378 AATTCTAGGAAGACAGTTCCTGG - Intergenic
1198038735 X:132827661-132827683 GAGGCTAGGAACAACGTTAGGGG - Intronic
1198404405 X:136298147-136298169 AATTCTGTGAAGAAAGTTACTGG - Intergenic
1199923608 X:152437584-152437606 AAGAATAGGAATAAAGTTAGAGG + Intronic
1200131368 X:153849147-153849169 AAGGCTAGTGGGAAAGTTCCAGG + Intergenic
1200496039 Y:3885484-3885506 AAGGCTAAGAATAAAGTTACGGG + Intergenic
1201794835 Y:17883701-17883723 AAAGCCAGGAAGAAAGACACAGG + Intergenic
1201806720 Y:18022284-18022306 AAAGCCAGGAAGAAAGACACAGG - Intergenic
1202356210 Y:24051480-24051502 AAAGCCAGGAAGAAAGACACAGG + Intergenic
1202514568 Y:25618629-25618651 AAAGCCAGGAAGAAAGACACAGG - Intergenic