ID: 1182175172

View in Genome Browser
Species Human (GRCh38)
Location 22:28278522-28278544
Sequence CTGAAAAATAGGAAGCCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182175172_1182175177 2 Left 1182175172 22:28278522-28278544 CCTATAGGCTTCCTATTTTTCAG 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1182175177 22:28278547-28278569 TAAAATGAGAGGGTTAGCCCTGG 0: 1
1: 0
2: 4
3: 25
4: 223
1182175172_1182175176 -8 Left 1182175172 22:28278522-28278544 CCTATAGGCTTCCTATTTTTCAG 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1182175176 22:28278537-28278559 TTTTTCAGGATAAAATGAGAGGG 0: 1
1: 0
2: 6
3: 84
4: 708
1182175172_1182175175 -9 Left 1182175172 22:28278522-28278544 CCTATAGGCTTCCTATTTTTCAG 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1182175175 22:28278536-28278558 ATTTTTCAGGATAAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182175172 Original CRISPR CTGAAAAATAGGAAGCCTAT AGG (reversed) Intronic
900820894 1:4887583-4887605 TTGAAAAATGGGAATCCTATGGG + Intergenic
903634909 1:24805848-24805870 ATGAAAAGGAGGAATCCTATAGG - Intronic
904765418 1:32842435-32842457 CTGAAAAATAAGAACACTAGTGG - Intronic
905904123 1:41605517-41605539 CTGAAAAATACAAAGCTTATAGG + Intronic
906535162 1:46547474-46547496 CTGAAACATGGGAACCCTGTGGG + Exonic
908017321 1:59856971-59856993 CTGAGAAATAAGATGCCCATAGG - Intronic
909124434 1:71648069-71648091 CTGAAAAATATGCAGCCAACTGG + Intronic
910452055 1:87357414-87357436 CTTAAAAAGAGGGAGACTATGGG + Intergenic
915858461 1:159416842-159416864 CTAACAAATAGGAAACCTAGAGG - Intergenic
919197922 1:194312690-194312712 CTGAGAAATAGGAAGATCATGGG - Intergenic
920393926 1:205630419-205630441 CTGAAAAATAGTTGGGCTATGGG - Intronic
923752835 1:236762333-236762355 CTAAAGAATAGGGAGTCTATTGG - Intronic
1066219801 10:33324634-33324656 CTCAAAAAAAAGAAGCCTGTGGG - Intronic
1067896194 10:50182370-50182392 ATGAAAAATTAGAAGCCTAGGGG - Intergenic
1067952784 10:50759631-50759653 ATGAAAAATTAGAAGCCTAGGGG + Intronic
1068407742 10:56613297-56613319 CTTAAAAATAGCAAGAGTATTGG + Intergenic
1068411937 10:56667568-56667590 CAAAAAAATAGAAAGCCTCTAGG + Intergenic
1069213751 10:65793818-65793840 CAGAAAAATATGAAGCTTCTGGG + Intergenic
1069793692 10:71039520-71039542 CTGAAAAATAGGGAGCCCTGAGG + Intergenic
1071137795 10:82471538-82471560 TTGAGAAAAAGTAAGCCTATAGG - Intronic
1071756654 10:88549209-88549231 ATTAAAAATAGGAAGCAAATTGG - Intronic
1073559911 10:104487787-104487809 CTGAAATCTAAGAAGCCTCTAGG - Intergenic
1075882449 10:125865526-125865548 CAGAAAAAAAGAAAGCCCATGGG - Intronic
1076257961 10:129043562-129043584 CTGAAAAATAAGAAGCTAACAGG - Intergenic
1078954144 11:16170901-16170923 CGGAAAAACATGAAGGCTATGGG + Intronic
1079850204 11:25523497-25523519 GTGATAAATATGAAGCATATGGG + Intergenic
1081348264 11:42017178-42017200 CTGAAAAACAAGAAGCGCATAGG - Intergenic
1082682888 11:56200361-56200383 CTGAAAACAAGGATGCCTCTTGG + Intergenic
1083079846 11:60079898-60079920 CTGAAAAATAGAAAGAATAAAGG - Intergenic
1084039552 11:66533804-66533826 CTGAGAAATAGGAAGCCATCAGG - Intronic
1084851848 11:71948138-71948160 CTGAAAAATAGGAATTTGATGGG + Intronic
1085917933 11:80913598-80913620 CTGAAAATTTGGAAGTCTTTGGG - Intergenic
1087053986 11:93914564-93914586 CAGAAAAAAAGAAAACCTATGGG - Intergenic
1087362371 11:97177366-97177388 CTGAAAAAGTTGAAGCCTACAGG + Intergenic
1090681279 11:129059944-129059966 ATGAAAAATAGCATTCCTATAGG + Intronic
1091005566 11:131950174-131950196 ATGAAAAACAGGAGGCCTCTAGG - Intronic
1091042713 11:132297049-132297071 CAGAAGAGCAGGAAGCCTATTGG - Intronic
1092040957 12:5383828-5383850 ATGAAAAATAGAAGGCCTACAGG - Intergenic
1093548721 12:20380371-20380393 CTGAAAAATCAGAAGCTTATAGG + Intronic
1095668151 12:44826802-44826824 GTGTAAAATAGGAAGCACATTGG - Intronic
1096591495 12:52662923-52662945 ATGGAAAATAGGAAGCAAATAGG + Intergenic
1100458825 12:94778537-94778559 CTGAAAAATAGGGATAGTATAGG - Intergenic
1101443620 12:104721477-104721499 CTGCAAAATAGGAATGCTAATGG + Intronic
1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG + Intergenic
1104031869 12:125070597-125070619 CTGAAAATTCAGAAGCCTGTAGG + Intronic
1104229050 12:126865841-126865863 CTGAAAAACAGAAAGCATGTAGG - Intergenic
1105022189 12:132824217-132824239 CCGTAAAAGAGGAAACCTATGGG + Intronic
1105612878 13:21984616-21984638 TATAAAAATAAGAAGCCTATTGG - Intergenic
1107992955 13:45834487-45834509 CTGAGGAATAGGAAACCAATAGG + Intronic
1108160913 13:47638203-47638225 CTAAAAAATTGGAAACCTAGAGG + Intergenic
1108178192 13:47816043-47816065 CTGAAAAGATGGAAGGCTATAGG + Intergenic
1110756958 13:79186121-79186143 CTCAAAAAGAGGATGCCTTTGGG + Intergenic
1113008254 13:105733004-105733026 CTGAAAAAATGGAAGCCTTTTGG - Intergenic
1113008452 13:105735342-105735364 CTGAAAAAATGGAAGCCTGTTGG - Intergenic
1117068261 14:52032237-52032259 CTGAAAATAAGGAGGGCTATGGG + Intronic
1118857241 14:69633103-69633125 CTCAAATATAGGAGGCCTTTAGG + Intronic
1119211156 14:72833124-72833146 CTCAAAGCTAGGAAGACTATCGG + Intronic
1119978904 14:79057655-79057677 CTGAAAAATGGCAAGTCCATTGG + Intronic
1122648157 14:103208454-103208476 CTGAAAAATAAGAAGCAAAGAGG - Intergenic
1124799595 15:32818528-32818550 CGCAAAAATAGGAAGACTAAAGG - Intronic
1133625055 16:7563297-7563319 CTAGAAAATAGGAATACTATTGG - Intronic
1133771183 16:8868149-8868171 CTGCCAAATAGGAGGCCTCTCGG - Exonic
1137766118 16:50979021-50979043 CTGAAAAATGGGGATCCTAACGG - Intergenic
1139246912 16:65453697-65453719 CTGAAACTTAAGAAGACTATTGG + Intergenic
1143223277 17:5280207-5280229 CTGAAAAAAAGGGAGGCTAAAGG - Intergenic
1144383994 17:14731741-14731763 GTGAAAAACAGGAAGACTACTGG - Intergenic
1147693033 17:42329714-42329736 CGGAACAAAAGGAAGCCTCTAGG + Intronic
1149432112 17:56602749-56602771 TTGCAAAACAGGAAGCCTAAGGG + Intergenic
1149734459 17:58979302-58979324 CTAAAAAATAGAAAGCCAAGTGG + Intronic
1152545646 17:80998931-80998953 GTGACAAACAGGAAGCCAATGGG - Intronic
1154365395 18:13703353-13703375 CTGAAAGATAAGACTCCTATAGG + Intronic
1156019892 18:32588044-32588066 TTGAAAAATAAAAAGCATATTGG - Intergenic
1157017911 18:43741356-43741378 CTCAAAAGCAGGAAACCTATAGG + Intergenic
925028360 2:627396-627418 CTGTAAGATAGGCAGCCTTTCGG + Intergenic
925651990 2:6100609-6100631 CTGGAAACTAGAAAGCCTAGAGG - Intergenic
926025097 2:9535229-9535251 CTGAAAAATGAGAAGACTCTGGG - Intronic
928672083 2:33612133-33612155 CTAAATAATAGGAAGGGTATTGG + Intergenic
928817532 2:35317494-35317516 TTGAAAAACAGGCAGCCCATGGG + Intergenic
929254582 2:39795933-39795955 CTGTAACAAAGGAAGCCTAGAGG - Intergenic
929713751 2:44290659-44290681 CTTAAAAATAAGTAGTCTATAGG - Intronic
931609945 2:64088286-64088308 CTGAAAAATAGGAAGGGAAAAGG - Intergenic
931743352 2:65269007-65269029 AGTGAAAATAGGAAGCCTATAGG - Exonic
932014347 2:68009275-68009297 CTGAAAAGCAGGGAGTCTATAGG - Intergenic
933422901 2:82074699-82074721 TGGAAAAATAGGAAGACTAATGG - Intergenic
941789493 2:169535931-169535953 CTGAAAAATAGAAGTCTTATGGG - Intronic
942454237 2:176126845-176126867 CTGGAAAATAAAAAGCCTCTTGG + Intergenic
944405458 2:199378930-199378952 CTGGAAGATAGGAAGGCTATTGG - Intronic
945491599 2:210462199-210462221 CAGAAAAATAGCAAGCCTGGAGG - Intronic
945826491 2:214726189-214726211 CTGAAAAATAGAAACCAGATGGG - Exonic
946031879 2:216711851-216711873 CTGAGAAATAGGAAGGATGTAGG - Intergenic
946183933 2:217966155-217966177 CTGAAAAATATGAGACCTTTGGG + Intronic
1170813723 20:19695696-19695718 CTGAAAAACAGGAAGGCCAGAGG - Intronic
1173562498 20:44016218-44016240 CTGAAAAATAGGCACCCTAATGG - Intronic
1178470175 21:32885447-32885469 CTAAAAGAAGGGAAGCCTATCGG - Intergenic
1181924197 22:26345080-26345102 CTGAAGAACAGGAAGGTTATAGG + Intronic
1182175172 22:28278522-28278544 CTGAAAAATAGGAAGCCTATAGG - Intronic
1182862132 22:33569364-33569386 CTGCAAAACAGGAAGACTACAGG + Intronic
949488315 3:4563150-4563172 CTGAACAGCAGGGAGCCTATTGG + Intronic
952430940 3:33222178-33222200 CTGAAAAAAAGGATACCCATAGG + Intergenic
952803089 3:37316108-37316130 CTGAAAAATTGAAAATCTATGGG - Intronic
959143456 3:102514809-102514831 CTGAAAAATAAAAAGCCTGTTGG + Intergenic
960077693 3:113506262-113506284 CTGAAGAATTGGAATCCTAAGGG - Intronic
962468100 3:135679225-135679247 CTGGAAGATAGGAAGCAGATGGG - Intergenic
962922458 3:139963418-139963440 CTTAATATTAGGAAGTCTATTGG - Intronic
963980014 3:151527205-151527227 CTGGAAAATAGGAAGATTTTTGG + Intergenic
964508040 3:157421095-157421117 CTGAAAAGTAGGATGCCTAGAGG + Intronic
965008958 3:163061154-163061176 CTGAAAAAAAAGAAGCCTACTGG - Intergenic
966688029 3:182716823-182716845 CTGAAAAAAAGGAAACCTTGGGG + Intergenic
967996394 3:195169695-195169717 TAGAAAACTAGGAAGACTATAGG - Intronic
969066547 4:4486583-4486605 CTGTAAAAGAGGAATCCTAGGGG - Intronic
969125678 4:4946093-4946115 ATGAAAAATAGGAAGCCTCAGGG + Intergenic
971169527 4:24219078-24219100 CTGAAAATTTGGAATCCTAAGGG - Intergenic
972028854 4:34426248-34426270 CTGATAGAGAGGAAGTCTATAGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
977298663 4:95241323-95241345 CATAAAAATAAGAGGCCTATTGG + Intronic
977660848 4:99583714-99583736 CAGAAAAATAGGAAACAAATTGG - Intronic
981122389 4:141067737-141067759 CTCAAAAATAGGAATCATAGTGG - Intronic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
982620722 4:157701025-157701047 CAGAAAAGAAGGAAGCCAATGGG - Intergenic
983047703 4:163006436-163006458 CAGAAAAATAGGAAGTCATTAGG - Intergenic
984253856 4:177366716-177366738 CAGAAGAATAGGAAGAGTATGGG - Intergenic
990130980 5:52582785-52582807 CTGGAGAATAAGAAGCCCATAGG + Intergenic
991394625 5:66191311-66191333 CTGACAACTAGGAAGGATATGGG - Intergenic
991460078 5:66849014-66849036 CTGCAAAACAGGAAACCTGTTGG + Intronic
992318537 5:75585651-75585673 CTTAAAAAGAGGAACCCTAGAGG + Intronic
995604354 5:113835438-113835460 CTGAAATATGGGAAGCATGTGGG - Intergenic
995960927 5:117838467-117838489 CTGCAAACTATAAAGCCTATTGG - Intergenic
995976454 5:118041867-118041889 GTGAAAAAAATGAAGACTATAGG + Intergenic
998283931 5:140839958-140839980 CTGTAAAATATGACTCCTATTGG + Intronic
998508613 5:142692577-142692599 ATGAAATATAGAAAGCCTACTGG + Intronic
1000321057 5:160134760-160134782 CTGACAAAAAGGAAGCCCTTGGG - Intergenic
1008367815 6:50703486-50703508 CTGACAAATAGGAAGAATAAAGG - Intergenic
1008703590 6:54130687-54130709 CAGAAAAGTGGGAAGCCTACGGG + Intronic
1011073721 6:83415038-83415060 ATGATAACTAGGAAGTCTATTGG - Intronic
1011908190 6:92400012-92400034 CTGAAAAATAAGCAGCATATTGG - Intergenic
1013581479 6:111539068-111539090 ATGAAAAATAGGAACACTTTTGG - Intergenic
1013654795 6:112235129-112235151 CTGCAAAATAGGAAGGTTTTTGG - Intronic
1015156914 6:130106870-130106892 CTGAAAAGGAGGAAACCCATTGG - Intronic
1017918454 6:158851694-158851716 GGGAAAAATAGTAAACCTATGGG - Intergenic
1017929913 6:158943308-158943330 CTGAAAAATTTGAAGTCTACAGG + Intergenic
1021254013 7:18367329-18367351 CTGAAAAATAGGAAGAACAGGGG - Intronic
1022183504 7:27944394-27944416 CTTCAAAATAGGAAGCCAAATGG - Intronic
1022615302 7:31923652-31923674 CTGAAAAGTTAGAAGCCTATGGG + Intronic
1022855100 7:34305684-34305706 CTGAAATATATGAAGCACATTGG - Intergenic
1023365028 7:39455455-39455477 CTGAGAAATAGGAAGCCATTTGG - Intronic
1023768648 7:43535009-43535031 CTGCAAAATGGGAATCATATTGG - Intronic
1024236621 7:47403374-47403396 GTGAAAAATAGGAATCTTACAGG - Intronic
1027457489 7:78411661-78411683 CAGGAAAATATGAAGACTATTGG - Intronic
1027730979 7:81872223-81872245 CTGAACAATCGGAAGCCATTGGG + Intergenic
1027998213 7:85454528-85454550 CTGAACAATAGGAAGGCTGGGGG - Intergenic
1029364589 7:100108478-100108500 CTGACAATCAGGACGCCTATCGG - Exonic
1030054141 7:105567347-105567369 CTAAGAAAGAGGAAGCCAATTGG + Exonic
1030992831 7:116321093-116321115 CTGAAAAAAAGCAAAACTATAGG + Intronic
1031125248 7:117765974-117765996 GTGAAAAATATGAAGCATATTGG - Intronic
1032465119 7:132139451-132139473 CTTAAATATAGGAAACCTAGAGG - Intronic
1034948275 7:155278516-155278538 CCGATAAATAGAAAGCCAATAGG - Intergenic
1036534926 8:9639110-9639132 CTGGACAATAGCAAACCTATTGG - Intronic
1038650507 8:29398745-29398767 CTGAAAAATATAAAGACTATAGG - Intergenic
1038947375 8:32376216-32376238 CTGAATATTAGGAAGCCTGTAGG - Intronic
1040725315 8:50375708-50375730 GGGAAAAATAGTAACCCTATAGG + Intronic
1041371730 8:57168148-57168170 CAGAAAAATAGGTAGAGTATAGG - Intergenic
1041420235 8:57659853-57659875 CTGAGAAATAAGATGTCTATAGG - Intergenic
1042744584 8:72094056-72094078 CTGTAAAATAGGAAAAATATAGG - Intronic
1043984699 8:86680282-86680304 CTGAAAGTTAGAAAGCATATGGG + Intronic
1045861400 8:106818398-106818420 CTGATAAATAGAAAGCCTTCTGG + Intergenic
1046981229 8:120338491-120338513 CTGGAAAATAGGAATAATATAGG + Intronic
1047014600 8:120710281-120710303 CTAAACAACAGGAAGCTTATTGG + Intronic
1050073819 9:1843329-1843351 CTGACTAATAGGAAGGCTTTGGG + Intergenic
1050853758 9:10323302-10323324 CTGAAAAAGAGGAAGGGAATGGG - Intronic
1051921129 9:22266825-22266847 CTGAAGGATAGGATGCCCATTGG + Intergenic
1055805121 9:80084178-80084200 CTGAAGAATAGAAAGCTGATAGG - Intergenic
1055905034 9:81283664-81283686 TTGGAAAATAGGAAGAATATAGG + Intergenic
1058024828 9:100130282-100130304 CTGAATACTAGGGAGCCTTTGGG + Intronic
1058445041 9:105047407-105047429 ATGAAAAATAGGAATCATACTGG - Intergenic
1059260569 9:112972164-112972186 CTGAAAAATCTGAGGCCTATAGG + Intergenic
1059567168 9:115394459-115394481 CTGAAAAGAAGGGAGCGTATTGG + Intronic
1059570152 9:115425506-115425528 GTGAAAAATTGGCAGCCTAATGG - Intergenic
1059588428 9:115631280-115631302 CTGTCAAATAGGATGCCTATAGG + Intergenic
1061008874 9:127943706-127943728 CTGAAAATGAGGAAGCATCTTGG - Intronic
1187310741 X:18138965-18138987 CATAAAAAAAGGAAGACTATTGG + Intergenic
1189645175 X:43120476-43120498 TTTAATAATAGGCAGCCTATAGG + Intergenic
1190435643 X:50421887-50421909 CTGAAAAATAGAAAGCTTGGTGG - Intronic
1190589301 X:51982363-51982385 CTGTGAAATAGGAAACCAATAGG - Intergenic
1191019593 X:55845034-55845056 CTGAGAAATAGGAACACTGTTGG + Intergenic
1191991896 X:67046802-67046824 CTGAAAAATGGGAATACTAGTGG + Intergenic
1192215712 X:69156770-69156792 CTGAAAAACATGAAGCTGATAGG - Intergenic
1192630613 X:72775126-72775148 CTGACATATAGGAAGCCTACTGG - Intergenic
1192651097 X:72945678-72945700 CTGACATATAGGAAGCCTACTGG + Intergenic
1194853977 X:98905535-98905557 CTGAAAAATGAGAAGACAATTGG - Intergenic
1195033611 X:100950168-100950190 CAGAAAAATAGAAAGACTAGGGG + Intergenic
1197082483 X:122436470-122436492 CTTAAAATTAGCAAGCCTACAGG - Intergenic
1199890082 X:152070395-152070417 CTGAAAAATCTGAAGCTTAATGG - Intergenic