ID: 1182176804

View in Genome Browser
Species Human (GRCh38)
Location 22:28298535-28298557
Sequence AGGATTTACTTGAGTCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182176804_1182176810 12 Left 1182176804 22:28298535-28298557 CCTTCTAGACTCAAGTAAATCCT 0: 1
1: 0
2: 0
3: 26
4: 212
Right 1182176810 22:28298570-28298592 TCCCAAGTAGCTAGGACCACAGG 0: 362
1: 7533
2: 60813
3: 176590
4: 231523
1182176804_1182176808 4 Left 1182176804 22:28298535-28298557 CCTTCTAGACTCAAGTAAATCCT 0: 1
1: 0
2: 0
3: 26
4: 212
Right 1182176808 22:28298562-28298584 CCTCAGCCTCCCAAGTAGCTAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182176804 Original CRISPR AGGATTTACTTGAGTCTAGA AGG (reversed) Intronic
901665187 1:10822230-10822252 AGGAATCACTTGAGTCCAGGAGG - Intergenic
902258900 1:15209157-15209179 AGGATCTGCTTGAGCCTAGGAGG - Intronic
903408532 1:23120029-23120051 AGGATTTGCTTGAGTCCAGGGGG - Intronic
903502947 1:23811831-23811853 AGAATTTGCTTGACTCTAAAGGG - Intronic
904144072 1:28376221-28376243 AGGAATCACTTGAGCCTAGGAGG + Intronic
905420791 1:37842176-37842198 AAGATCCACTTGAGTCTGGAAGG + Intronic
906233906 1:44191568-44191590 AGGATTTGCTTGAGCCCAGGAGG - Intergenic
906363955 1:45189664-45189686 GGGAATTACCTGAGCCTAGAAGG + Intronic
907365688 1:53957553-53957575 AGGACTCACTCCAGTCTAGATGG - Intronic
909135558 1:71795489-71795511 GGGAATTTCTTGAGTATAGATGG - Intronic
909289510 1:73864592-73864614 AGGGCTTACTTGAGGCTGGAGGG + Intergenic
909436937 1:75652840-75652862 AGAATTTACTTTTGTCAAGAAGG - Intergenic
909547454 1:76863531-76863553 AGGATTTGCTTGAGCCTGGGAGG - Intergenic
909654956 1:78021445-78021467 AGGATTGACTTGAGCCTGGGAGG - Intronic
910148253 1:84108312-84108334 AGGATATACTTGAGGGTGGAAGG + Intronic
910476397 1:87612025-87612047 AGGATGAGCTTGAGTCTAGAAGG + Intergenic
911543929 1:99192703-99192725 AGGGTCTACTTGAGGGTAGAGGG + Intergenic
911950434 1:104167050-104167072 AACATTTACTTCATTCTAGATGG - Intergenic
913302937 1:117392087-117392109 AGGATTGACTTGAGGCAAGGTGG - Intronic
916285780 1:163103417-163103439 AGGACCTACTTGAGGGTAGAGGG - Intergenic
917775605 1:178331258-178331280 TGGATTTGCTTGAGCCTAGGAGG - Intronic
917870839 1:179240626-179240648 AGGAATTGCTTGAGCCTAGGAGG - Intergenic
917983454 1:180290276-180290298 AGGATTTGCTTGAGCCCAGAAGG - Intronic
918499317 1:185176313-185176335 AAGATTTACTGGAGGCTGGAGGG + Intronic
921956683 1:220992327-220992349 ATGATTTACTTGACCCTGGATGG - Intergenic
922282762 1:224141976-224141998 AGGATTGTCTTGAGTCTAGGAGG - Intronic
1063756679 10:9018656-9018678 AGCATTTGCTAGAGTTTAGAAGG + Intergenic
1065192213 10:23223167-23223189 AGGATTTGCTTGAGCCCAGGAGG - Intronic
1065417597 10:25505250-25505272 TGGATTTATTTGAATCCAGAAGG - Intronic
1065527120 10:26633927-26633949 AAGATTTACTTGAACCCAGAAGG + Intergenic
1066500791 10:35992559-35992581 AGGATTTGCTTGAGCCCAGGAGG - Intergenic
1066628680 10:37436809-37436831 AGGATTTGCTTGAGCCCAGGAGG - Intergenic
1068086581 10:52381097-52381119 AGGGTCTACTTGAGGGTAGAAGG - Intergenic
1068248651 10:54407655-54407677 AGGATTCACTTGTGTCCACAAGG + Intronic
1070048695 10:72865628-72865650 AGGATCTGCTTGAGTCTGGGAGG - Intronic
1072903811 10:99432065-99432087 GGGACCTACTTGAGGCTAGAGGG - Intergenic
1074325917 10:112450461-112450483 ATAATTTACTTGAGTTAAGAAGG + Intronic
1075154357 10:119962064-119962086 AAGATTTGCTTGAGCCTGGAAGG + Intergenic
1075657686 10:124172988-124173010 AGGTTTAACTTGAGTCTTGACGG + Intergenic
1076393920 10:130124681-130124703 AGGACTTACCTGATTCAAGAGGG + Intergenic
1077763270 11:5127412-5127434 AGCATTTACTTGAGGTCAGAGGG + Intergenic
1080548506 11:33347092-33347114 AGGATCCACTTGAGTCCAGGAGG + Intronic
1083508304 11:63182024-63182046 TGGATTTGCTTTAGGCTAGAAGG + Intronic
1083938305 11:65881868-65881890 GGGAATTGCTTGAGTCTAGGAGG - Intronic
1085223227 11:74894249-74894271 AGGATCTACTTGAGGGTAGAGGG + Intronic
1086209885 11:84307334-84307356 AGGACTTACTTGAGGGTGGATGG + Intronic
1086515207 11:87604007-87604029 AGGATATAGCTGAGTCTACAGGG - Intergenic
1086645725 11:89217679-89217701 AGGAATTACTGGATCCTAGAGGG - Intronic
1087385795 11:97466891-97466913 ATGATTTAGTAGAGTCTATAAGG + Intergenic
1088041225 11:105384663-105384685 TGTACTTACATGAGTCTAGATGG + Intergenic
1089999643 11:122944680-122944702 AGGATTTACTTCAGAATAAAGGG - Intronic
1091989654 12:4944703-4944725 ATGTTTTACCTGAGTCTTGAAGG - Intergenic
1094722590 12:33079590-33079612 AGGGTCTACTTGAGGGTAGAGGG - Intergenic
1098028327 12:66229548-66229570 AGGTTTTACTTAGTTCTAGAGGG + Intronic
1099647162 12:85372650-85372672 AGGACTTACTTGAGGGTGGAGGG - Intergenic
1100675068 12:96857293-96857315 AGGGTCTACTTGAGGGTAGAAGG - Intronic
1103092483 12:118107134-118107156 AGGATTGACTTAAGCCTAGGAGG - Intronic
1104300633 12:127562078-127562100 AAGAATTGCTTGAGTCTAGGAGG - Intergenic
1106731708 13:32548002-32548024 AGGATTTGCTTGAGCCTGGGTGG + Intergenic
1106812226 13:33370259-33370281 ATCATTTATTTGATTCTAGAAGG - Intergenic
1110527179 13:76551970-76551992 ATTATTAACTTGAGTCTATAAGG + Intergenic
1111577587 13:90176698-90176720 AGTATTTACTTGTCTGTAGATGG - Intergenic
1112479886 13:99765631-99765653 AGGATTTGCTTGAGCCTAGGAGG - Intronic
1114345360 14:21789258-21789280 AGGAATTACTTGAGGCTGGATGG + Intergenic
1114390863 14:22307069-22307091 AGGATGTACTTGAGTCTCCGAGG - Intergenic
1115203501 14:30877030-30877052 AGGATTTGCTTGAGTCCAGGAGG - Intronic
1116182575 14:41553869-41553891 AGGACCTACTTGAGTGTGGAGGG + Intergenic
1117712333 14:58544021-58544043 GGGATCTACTTGAGACTGGAGGG - Intronic
1119067276 14:71541681-71541703 GAGGATTACTTGAGTCTAGAAGG + Intronic
1120010294 14:79405969-79405991 AGCATTTACTAGAATGTAGAAGG - Intronic
1123769663 15:23516096-23516118 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1124448082 15:29757313-29757335 AGGTTTCACTTGAGTGTAAAAGG - Intronic
1126765535 15:52007611-52007633 AGGATTTGCTTGAGCCCAGGAGG + Intronic
1127188617 15:56506465-56506487 TGGATCAACTTGAGCCTAGAGGG - Intergenic
1130677308 15:85964672-85964694 AGGAAATCCTTGAGGCTAGAAGG - Intergenic
1133612660 16:7448096-7448118 AGCATTTACTTGAGACTCAAAGG + Intronic
1135059151 16:19256051-19256073 ATTATTTCCTTGAGCCTAGAGGG - Intronic
1135595093 16:23736217-23736239 AGGATTCACTTGAGCCTGGGAGG - Intergenic
1140138377 16:72229007-72229029 TGGGCTTACTTGAGGCTAGAGGG - Intergenic
1141390040 16:83656834-83656856 AGGAATTACTTGATTTTAGAAGG + Intronic
1142532119 17:587150-587172 AAGAATCACTTGAGTCCAGAAGG - Intronic
1143094329 17:4469172-4469194 AGGATCCACTTGAGCCCAGAAGG - Intronic
1144512146 17:15886507-15886529 AGCATTTACCTGTGTCCAGAAGG - Intergenic
1147180196 17:38679720-38679742 AGGAATTACTTGAGTCCAGCAGG + Intergenic
1150903500 17:69311296-69311318 AGGATTTACATGAATAAAGAGGG + Intronic
1151841899 17:76624877-76624899 AGGAGTTATCTGATTCTAGAAGG - Exonic
1152484135 17:80578726-80578748 TGGAGTTACTTAAATCTAGATGG + Intronic
1152696020 17:81796023-81796045 AGGATTTGCTTGAGCCCAGGAGG - Intergenic
1153623182 18:6998941-6998963 AGGAATCACTTGAGTCCAGGAGG + Intronic
1154352163 18:13593221-13593243 AAGAATTACTTGAATCCAGAAGG + Intronic
1156860335 18:41828762-41828784 AGGATATGCTTGAGCCTAGGCGG - Intergenic
1157898405 18:51490264-51490286 ATGATGTACATGAGTCTCGATGG - Intergenic
1159432938 18:68379264-68379286 AGAATTGTCTTGAGTTTAGATGG - Intergenic
1160374241 18:78399066-78399088 AGGATCTGCTTGATTCTAGGGGG + Intergenic
1160496915 18:79381232-79381254 AGGCATTACTTGTGTCTGGATGG + Intergenic
1161810677 19:6469415-6469437 ATGGATTGCTTGAGTCTAGAAGG - Intronic
1162761209 19:12889498-12889520 AGGAATCACTTGAGCCTAGGAGG - Intergenic
1163965835 19:20746449-20746471 AGGGTCTACTTGAGAGTAGAGGG - Intronic
1165706344 19:37978884-37978906 AGGATCTGCTTGAGTCCAGGAGG + Intronic
1168611912 19:57807707-57807729 AGGATTTGCTTGAGCCTGGGAGG - Exonic
925079341 2:1050620-1050642 AGGATTTCCTTGACTATAGTTGG + Intronic
926641433 2:15241953-15241975 AGCATTTCCTTGAGACAAGACGG - Intronic
927231823 2:20831462-20831484 ATGGTTTACATGGGTCTAGAAGG + Intergenic
927381965 2:22489597-22489619 AGGATCTACTTGAGGGTAGAGGG + Intergenic
927906493 2:26862446-26862468 ATGATCTACTTGGGTCTATAGGG + Intronic
929427946 2:41863235-41863257 AGCATTTACTGGAGTCTGAATGG + Intergenic
929704986 2:44201102-44201124 AGGAGTTACTAGACTATAGAGGG + Intronic
930325134 2:49906730-49906752 AGGATCTACTTGAGCCTGGAAGG + Intergenic
931554762 2:63490244-63490266 ATGATGTACTTCAGTCTAAATGG - Intronic
932940623 2:76160528-76160550 AGGATTTGCTTGAGCCCAGGAGG + Intergenic
933080885 2:77984042-77984064 GGGATTTACTTGAGTGTGGAGGG + Intergenic
933214802 2:79617977-79617999 AGGATTTACTGGAGCCTAATTGG - Intronic
933844041 2:86310985-86311007 AGAATCTACTTCAGTCTAGAAGG + Intronic
935483074 2:103617373-103617395 AGGATCTGCTTGAGTCTGGGAGG - Intergenic
939347042 2:140979066-140979088 AGGATTTGCTTGAATCTGGGAGG - Intronic
940497307 2:154448495-154448517 GGAATTTACCTGAGTCTAAAAGG + Intronic
942316374 2:174699907-174699929 AGGATCTGCTTGAGCCCAGAAGG + Intergenic
943507137 2:188775336-188775358 AAGGATTACTTGAGTCTAGGAGG - Intronic
944158565 2:196634943-196634965 AGTAATTGCTTGAGTCTAGGAGG + Intergenic
944231288 2:197395515-197395537 AGGCTGTACGTCAGTCTAGATGG + Intronic
946520869 2:220463545-220463567 AAGATCTACTTGAGTCTTGAGGG + Intergenic
1169833443 20:9851551-9851573 AAGAATTACTTGAACCTAGAAGG + Intergenic
1177923380 21:27183018-27183040 AAGAATCACTTGAGTCTGGAAGG - Intergenic
1178411023 21:32363877-32363899 AGGATTGGCTTGAGGCCAGAAGG - Intronic
1182176804 22:28298535-28298557 AGGATTTACTTGAGTCTAGAAGG - Intronic
1182651478 22:31854936-31854958 AGGACTTAATTGAGTCTTGCTGG + Intronic
949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG + Intronic
950037898 3:9900255-9900277 AGGATTCACTTGAGTCCAGGAGG + Intergenic
951224306 3:20103497-20103519 ATGAATTGCTTGAGTCTAGGAGG - Intronic
952745303 3:36771308-36771330 AAGATTTCCTTGACTCTAGTAGG - Intergenic
955538003 3:59944679-59944701 AGGACATATTTGAGTGTAGAAGG - Intronic
955584660 3:60463375-60463397 AGGATTTAATTGCATTTAGAAGG + Intronic
955882483 3:63562613-63562635 AGGATTGTTTTGAGGCTAGATGG - Intronic
956028553 3:65010677-65010699 AGAATTTTCTTGAGTGTAGGTGG - Intergenic
956350759 3:68333464-68333486 GGGACCTACTTGAGTGTAGAGGG + Intronic
957866977 3:86038463-86038485 AGGATTAATTGGAGTTTAGAGGG - Intronic
958414622 3:93859056-93859078 AGGAATTGCTTGAGTCTGGAGGG + Intergenic
959263604 3:104111514-104111536 AGAATTGAATTGAGTCTAGTTGG + Intergenic
959528627 3:107407013-107407035 AGGGTTTACATGAATCTAAAAGG + Intergenic
963411168 3:144930054-144930076 AGGACTTACTTGAGGATGGAGGG + Intergenic
964687693 3:159415451-159415473 AGGGTGTACTTGAGGGTAGAGGG - Intronic
965332122 3:167388659-167388681 AGAATTTAGTTGTGTCCAGAGGG + Intergenic
967758243 3:193195038-193195060 AGGAATTATTTAAGTCTTGAAGG - Intergenic
971004091 4:22354743-22354765 GGGGTTTACTTGAGAGTAGAGGG + Intronic
971544780 4:27871392-27871414 AGGATTTACTTCTGTCTTTAAGG - Intergenic
974598587 4:64045968-64045990 AGGGCCTACTTGAGTGTAGAGGG + Intergenic
974923960 4:68275210-68275232 AAGAATTGCTTGAGTCCAGAAGG - Intergenic
977329468 4:95619335-95619357 AGGGCTTACTTGAGGATAGAGGG + Intergenic
978323526 4:107524795-107524817 AGGCTTTGCTTGATTCTAGTTGG - Intergenic
978712866 4:111806668-111806690 AGGCATTACTTGAGGCTAGGTGG - Intergenic
979669542 4:123347546-123347568 ATGATTTCCTTGAGCCTTGAAGG - Intergenic
979811266 4:125038846-125038868 AGCATTTACATGAGTATACAAGG - Intergenic
982943350 4:161586700-161586722 AATATTTACCTGAGTCTACAGGG + Intronic
983486712 4:168340800-168340822 AGGGCCTACTTGAGTGTAGAGGG - Intergenic
987021260 5:13874605-13874627 AAGATTTGCCTGAATCTAGAAGG - Intronic
987494179 5:18621819-18621841 GGGAATTACTTGAGACTAGGAGG - Intergenic
987634685 5:20525155-20525177 AGGATATACTTCATTCTGGAAGG + Intronic
987900690 5:24007623-24007645 AGGGCTTACTTGAGGCTGGAGGG - Intronic
988004068 5:25385077-25385099 GGGATCTACTTGAGGGTAGAGGG - Intergenic
988163267 5:27548958-27548980 AGGATCTACTTGAGTGTGAAGGG + Intergenic
989054075 5:37349128-37349150 AGGATTTATTTGACTCTTAATGG + Intronic
989491541 5:42060922-42060944 GGGATCTACTTGAGCGTAGAGGG + Intergenic
990708927 5:58562013-58562035 AGGTTCTACTTCAGTCTAGCAGG + Intergenic
993572430 5:89558111-89558133 AGCATTTACTAGAATGTAGAGGG - Intergenic
993659226 5:90610141-90610163 ATCATTTATTTGAGTCAAGATGG + Intronic
994312792 5:98295278-98295300 AGGATTTACATGAATGTATATGG - Intergenic
994686747 5:102964535-102964557 AGGCTTTAATTGAGTCTGTAGGG + Intronic
996470547 5:123855369-123855391 AGGATTTAGATGAGCATAGATGG - Intergenic
997518733 5:134508600-134508622 AGGATCAACTTGAGCCCAGAAGG + Intergenic
998094068 5:139387578-139387600 GGGTTTTATTTGAGTCCAGAGGG + Exonic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
999761718 5:154706546-154706568 AGGATTTACTTGAGAGTGGAGGG + Intergenic
1000678441 5:164152919-164152941 AGGATCTACTTGAGGGTGGAGGG + Intergenic
1001102903 5:168828868-168828890 AGCCTTTACTTAAGTGTAGAGGG + Intronic
1001767975 5:174269410-174269432 AGGACCTACTTGAGGGTAGAAGG + Intergenic
1002119733 5:176993273-176993295 AAGAATTGCTTGAGTCTAGGAGG - Intronic
1002583932 5:180229485-180229507 AGGATTTCCTGGAATCTGGAAGG - Intergenic
1002908694 6:1471705-1471727 AGGCGTTACCTGAGTCTAGAGGG + Intergenic
1004038357 6:11947759-11947781 TGTATTTACATAAGTCTAGATGG - Intergenic
1004533874 6:16480577-16480599 AGGATGTTCTTGAGTCTATCAGG - Intronic
1004534682 6:16489122-16489144 TGGATTTATTTAAGTCTTGAAGG + Intronic
1006387827 6:33741554-33741576 AGGAATTGCTTGAATCTAGGAGG + Intronic
1014293899 6:119594352-119594374 AGGACTTGCTTGAGTCCATATGG - Intergenic
1014370143 6:120596292-120596314 TGGCTTTACTTGAATCTAAAAGG - Intergenic
1014991513 6:128085058-128085080 AGGATTTATTTCAATCTACAAGG + Intronic
1015769435 6:136753803-136753825 AGGATGCACTTGAGGGTAGATGG + Intronic
1017501051 6:155023284-155023306 AGGATGAAGTTAAGTCTAGACGG + Intronic
1017593203 6:155999241-155999263 AGGATCTGCTTGAGCCTAGGAGG - Intergenic
1019681561 7:2353293-2353315 AGGATTCTCTTGAGGCTGGAAGG + Intronic
1020782510 7:12534862-12534884 GAGATTTACTTGAGCCCAGAAGG + Intergenic
1022290971 7:29002417-29002439 AGGATTTAATTTTTTCTAGAAGG - Intronic
1022951583 7:35343653-35343675 AGGATTAACTGTAGTTTAGATGG + Intergenic
1023036853 7:36138712-36138734 AGGTGCTACTGGAGTCTAGAGGG + Intergenic
1023476374 7:40583293-40583315 AGTTTTTTCTTGAGTATAGAGGG + Intronic
1025064793 7:55844045-55844067 AGGATTCACTTGAGCCTGGGAGG + Intronic
1026046800 7:66911349-66911371 AGGATCTACTTGAATTTGGAAGG + Intergenic
1027547319 7:79544359-79544381 AGGATATCCTTGAGTATAAAAGG + Intergenic
1027754133 7:82189006-82189028 GGGACCTACTTGAGTGTAGAGGG + Intronic
1027975853 7:85154438-85154460 AGGATTTGCATGAGGCTTGATGG - Intronic
1029081299 7:97975918-97975940 ATGATTTACTTGTGCATAGAAGG + Intergenic
1030454410 7:109754967-109754989 AGGCTTTACTTGAGGTTGGAGGG - Intergenic
1032532896 7:132636639-132636661 AGGCTTTACGTGAATCTGGAAGG - Intronic
1035216067 7:157368038-157368060 AGGATTTCCTTGAGCCTGGGAGG + Intronic
1036372424 8:8172864-8172886 AGGATTTAATGGAGACTATAGGG + Intergenic
1036878479 8:12492777-12492799 AGGATTTAATGGAGACTATAGGG - Intergenic
1040875024 8:52141949-52141971 AGGCTACACATGAGTCTAGAAGG + Intronic
1043489358 8:80732862-80732884 AGGAGTTACTTGAGTCCAGGAGG + Intronic
1045043280 8:98247791-98247813 AGGGTTTACCTGAGACAAGAAGG + Intronic
1046137223 8:110043734-110043756 ATTATTTACTAGACTCTAGATGG - Intergenic
1046226509 8:111286985-111287007 AGGAGATAATTGAGTCTTGAAGG + Intergenic
1046255087 8:111686102-111686124 AGGAATTACCTGAGTCATGAGGG - Intergenic
1046798957 8:118403840-118403862 GCGATTAACTTGAATCTAGATGG + Intronic
1047897504 8:129383006-129383028 AGGATTTCCTTGAGTCTTAATGG - Intergenic
1048668716 8:136693432-136693454 AGGATGTACTTGAGGATAGAGGG - Intergenic
1049137236 8:140914578-140914600 GGGATTTACTTGAGGGTGGAGGG - Intronic
1049652673 8:143780477-143780499 AGGATCTACTTGAGGGTGGAGGG - Intergenic
1049958589 9:716027-716049 AAGATATACTGGAGTATAGAAGG + Intronic
1054932472 9:70650145-70650167 AGGACTTACTTGAGGGTGGAGGG + Intronic
1055387808 9:75782570-75782592 AGGACTTACTTGAGAGTGGAGGG - Intergenic
1055667337 9:78565924-78565946 AGGAATTACCTGAGTGTGGATGG + Intergenic
1056048662 9:82745586-82745608 AGGATTTATTTTAGTTAAGAAGG - Intergenic
1058942067 9:109822528-109822550 AGGGCTTACTTGAGGGTAGAAGG - Intronic
1060345411 9:122811606-122811628 AGGATTTATTTGAGTTGACAAGG + Intronic
1060562035 9:124553737-124553759 AGTTTTTAGTAGAGTCTAGAAGG - Intronic
1060566219 9:124594439-124594461 AGTAATTACATGAGTTTAGAAGG - Intronic
1060763386 9:126275014-126275036 AGGATTTGCCTGAGCCCAGAAGG + Intergenic
1185795489 X:2960993-2961015 AGGATTTGCTTGAGCCCAGGAGG + Intronic
1186435544 X:9539927-9539949 AGGACTTATTTGGCTCTAGATGG + Intronic
1186442219 X:9596268-9596290 TCGAGTTGCTTGAGTCTAGAAGG + Intronic
1186640156 X:11447139-11447161 AGGAGGTACTTGAGTCTTCAAGG + Intronic
1188482717 X:30651785-30651807 AGGATTTTCTTGGTTCTAGAAGG - Intergenic
1188848786 X:35106615-35106637 AGGACTTACTTGAGGGTGGAGGG + Intergenic
1189463412 X:41260472-41260494 AGGATTTGCTTGAGTCCAGGAGG - Intergenic
1192115204 X:68403860-68403882 AGCATTTTTCTGAGTCTAGATGG - Intronic
1196439692 X:115707017-115707039 AGAATATACTTGAGCCTAGGAGG + Intergenic
1196565453 X:117199135-117199157 TGGATTTTGTTGAGTCTAGTAGG - Intergenic
1196756508 X:119161984-119162006 AGGGATTGCTTGAGTCTAGGAGG - Intergenic
1197949415 X:131877927-131877949 AGGATTGACTCCAGTCTTGAAGG + Intergenic
1198875591 X:141222557-141222579 AGTATTTACTAGAGGATAGATGG - Intergenic