ID: 1182178562

View in Genome Browser
Species Human (GRCh38)
Location 22:28319540-28319562
Sequence TGGGATGTCAATAATGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 3, 2: 22, 3: 107, 4: 519}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182178554_1182178562 15 Left 1182178554 22:28319502-28319524 CCTCTATAGATTATAACAAATAA 0: 1
1: 0
2: 2
3: 31
4: 333
Right 1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG 0: 1
1: 3
2: 22
3: 107
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182178562 Original CRISPR TGGGATGTCAATAATGGGGG AGG Intronic
900079681 1:846505-846527 GGGGATGTTGATAATGGGGGAGG + Intergenic
901446808 1:9313562-9313584 TGGGATGTGAATTCTGGGAGGGG + Intronic
901716317 1:11157546-11157568 TGGGAAGGAAATAATGGGGGAGG - Intronic
902070855 1:13735652-13735674 TAGGATGTTGATAATGGGGAAGG - Intronic
902193925 1:14783824-14783846 TGTGATGGAAGTAATGGGGGTGG + Intronic
902424928 1:16312726-16312748 GGGGATGTTGATAATGGGAGAGG + Intronic
902789436 1:18756682-18756704 GGGGATGTCAAGAGTTGGGGAGG + Intergenic
903333051 1:22607204-22607226 TGGGGTCTCAGAAATGGGGGTGG + Intergenic
907095093 1:51771023-51771045 TGGGATGTTGATCATGAGGGAGG + Intronic
907280015 1:53341226-53341248 AGGGACGTGAATCATGGGGGTGG + Intergenic
907982390 1:59496989-59497011 TGTTATGGCAATAATGAGGGGGG + Intronic
908279233 1:62513032-62513054 GGGGATGTTAATAATGGGGGAGG + Intronic
908562594 1:65321611-65321633 GGGGATGTTGATAATGGGAGAGG - Intronic
908674771 1:66591535-66591557 GGGGATGTTGATAATGGGGGAGG - Intronic
908793728 1:67810469-67810491 TGGGATGTGGATAGTGGAGGAGG + Intronic
908917294 1:69143483-69143505 GGGGATGTTGATAATGGGGAAGG + Intergenic
909186321 1:72491081-72491103 AGGGATGTTGATAATGGAGGAGG + Intergenic
909510361 1:76446265-76446287 ATGGATGTTGATAATGGGGGAGG - Intronic
910136121 1:83972043-83972065 GTGGATGTTGATAATGGGGGAGG - Intronic
910224283 1:84920351-84920373 TGGGATGTTGATAATGGCAGAGG + Intergenic
910767946 1:90801289-90801311 TGGGATGTTGAGAATGGGGGAGG - Intergenic
910804035 1:91172944-91172966 AGGAATGTTGATAATGGGGGAGG + Intergenic
910997525 1:93123874-93123896 AGGGATGTTGATAATGGAGGAGG - Intronic
911078355 1:93902596-93902618 GGGTATGTTGATAATGGGGGAGG - Intronic
911723387 1:101215566-101215588 TGGGATGTCAGTAATGAGAAAGG + Intergenic
912594021 1:110856092-110856114 TGAGATGTCAGTAGTGGGGAAGG + Intergenic
912970844 1:114281593-114281615 GGGGATGTTGATAATGGGGGAGG + Intergenic
913235476 1:116777469-116777491 GGGGATGTTGATAATGGGGAAGG + Intergenic
913380207 1:118202373-118202395 TGGGAGCTGAATTATGGGGGTGG - Intergenic
913404967 1:118480240-118480262 GGGGGTGTGCATAATGGGGGAGG + Intergenic
913462829 1:119106245-119106267 TGGGATGCCAGTAGTGGGGAAGG - Intronic
913955656 1:143289088-143289110 GGGGATGTCAAGACTGGTGGAGG - Intergenic
913981776 1:143526353-143526375 GGGGATGTCAAGACTGGTGGAGG + Intergenic
914076146 1:144353009-144353031 GGGGATGTCAAGACTGGTGGAGG + Intergenic
914103032 1:144613487-144613509 GGGGATGTCAAGACTGGTGGAGG - Intergenic
915973174 1:160367917-160367939 GGGGATGGCAATAGTGTGGGAGG - Intronic
916237061 1:162600605-162600627 TAGGATGTCATTCATGGGGTGGG + Intergenic
916241080 1:162640418-162640440 AGGGATGTCAATAGTGAGGGAGG + Intronic
916865781 1:168856641-168856663 TGTGATTTCAATAGTGGGGAAGG + Intergenic
917063144 1:171062895-171062917 GGGGATGTCGATAATGGGGGAGG - Intronic
918557618 1:185822267-185822289 GGGGATGTTGATAATGGCGGAGG + Intronic
918979733 1:191540647-191540669 GGGGATGTTGATAATGGGAGAGG - Intergenic
919153299 1:193727826-193727848 GGGGATGTCAATAATAGGGGAGG + Intergenic
920162217 1:204007737-204007759 TGGGATGTTAATAATGGGGGAGG + Intergenic
920286470 1:204883397-204883419 TGGGATGTAAGTGATGGGGAAGG - Intronic
920905422 1:210160418-210160440 TGGGAGGTCAAGGATGGGGTGGG + Intronic
920973599 1:210765194-210765216 TGGGATTCCAAAACTGGGGGTGG + Intronic
921914776 1:220595062-220595084 TGGGATGTTGATGGTGGGGGAGG + Intronic
922181318 1:223235291-223235313 GGGGATGTGAATAATGGGGGAGG - Intronic
923242383 1:232098419-232098441 TGAGATGTTGATAATGGGAGAGG + Intergenic
923514109 1:234680280-234680302 TGGGATGTTGACAGTGGGGGAGG + Intergenic
924124500 1:240836151-240836173 TGGGGGGTTGATAATGGGGGCGG + Intronic
1062778332 10:175163-175185 TGGGATGTTGATAATAGGGGAGG + Intronic
1062944276 10:1448887-1448909 TGAGATGTCAGTCATGGGGTCGG - Intronic
1063547637 10:6997938-6997960 GGGGATGTTAATACTGGGTGAGG - Intergenic
1063606447 10:7526851-7526873 TGGGATGTATATAATGTGGAGGG + Intergenic
1063650987 10:7936612-7936634 GGGGATGTTGATAGTGGGGGAGG - Intronic
1063686460 10:8241524-8241546 TGGGCTGTCACAAATGGGAGTGG - Intergenic
1064505289 10:16022809-16022831 TGGGATGTTGGTCATGGGGGAGG - Intergenic
1064889209 10:20150026-20150048 GGGTATGTCGATGATGGGGGAGG - Intronic
1065818643 10:29505737-29505759 GGGGATGTTGATAATTGGGGTGG + Intronic
1065954277 10:30678659-30678681 GGGGATGTTGATAATTGGGGTGG - Intergenic
1066408534 10:35143313-35143335 TGGGAAGTGAAGAAAGGGGGAGG + Intronic
1066489901 10:35884318-35884340 TGGTTTGACAATAATGGGGAAGG - Intergenic
1066779093 10:38923636-38923658 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1066952138 10:42129988-42130010 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1067397457 10:45935439-45935461 GGGGATGTTGATAATGGGGGAGG + Intergenic
1067529164 10:47057999-47058021 GGAGATGTTGATAATGGGGGAGG + Intergenic
1067865775 10:49904525-49904547 GGGGATGTTGATAATGGGGGAGG + Intronic
1068231821 10:54177485-54177507 TGGGGTGTTAATATTGGGGCAGG + Intronic
1068590921 10:58852228-58852250 AGGGATATTGATAATGGGGGAGG + Intergenic
1069022729 10:63506700-63506722 TGGGATGTTGATATTGGAGGAGG - Intergenic
1069107296 10:64398568-64398590 GAGGATGTTGATAATGGGGGAGG - Intergenic
1069149136 10:64933732-64933754 GGGGATGTTGATAATGTGGGAGG - Intergenic
1069928189 10:71865638-71865660 AGTGATGTCAATGCTGGGGGAGG + Intergenic
1069966630 10:72123492-72123514 TCAGATGCCAATAGTGGGGGAGG + Intronic
1070412871 10:76160085-76160107 GGGGATGTTGATAAGGGGGGAGG + Intronic
1070852594 10:79579259-79579281 GGGGATGTTCATAATGAGGGAGG + Intergenic
1071023562 10:81086001-81086023 TGGGATGTCAATATTGCGGGAGG - Intergenic
1071242966 10:83728442-83728464 GGGGATGTCAATAGTGAGGAAGG + Intergenic
1071535124 10:86422175-86422197 CTGGATGTTAATCATGGGGGAGG - Intergenic
1072010853 10:91301756-91301778 TGGGATGGCAAAAATTTGGGGGG + Intergenic
1073326607 10:102646942-102646964 AGGGATGTCTTTAATTGGGGTGG + Intronic
1074146620 10:110722349-110722371 GGGGATGCTGATAATGGGGGAGG - Intronic
1074509007 10:114096144-114096166 TGAAATGTCAAGAATGGGGGAGG + Intergenic
1074562937 10:114550486-114550508 GGGGATGTTGCTAATGGGGGAGG - Intronic
1075447438 10:122523498-122523520 AGGGATGTTGATAATGGGGGCGG + Intergenic
1075669581 10:124255141-124255163 TGGGAGGTAAATCATGGGGATGG + Intergenic
1079684784 11:23345322-23345344 CGGGATGTTAATAATGGAGTCGG + Intergenic
1079953477 11:26833488-26833510 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1080798429 11:35587514-35587536 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1081398049 11:42610717-42610739 TGGGATGCTAATAGCGGGGGTGG - Intergenic
1081459542 11:43259222-43259244 GGGGATGTTGATAATGGGAGAGG + Intergenic
1081590875 11:44422259-44422281 TTGGATGTCAAAAAGGGAGGAGG + Intergenic
1081839952 11:46192882-46192904 TGGGATGTTAATAATGAGAGAGG + Intergenic
1082192326 11:49261592-49261614 GGGGATGTTGATAATTGGGGAGG - Intergenic
1083171599 11:60926724-60926746 TGCCATGGCAATGATGGGGGAGG + Intronic
1083499972 11:63096138-63096160 TGAGATGTCAATAATGTGTCAGG + Intronic
1084924194 11:72498835-72498857 GGGGATGTTGATAATGGGGGAGG - Intergenic
1085452331 11:76642126-76642148 TGGGATGTAGATAATGGTAGTGG + Intergenic
1086150500 11:83604709-83604731 TGGAATTTTGATAATGGGGGTGG + Intronic
1086326391 11:85705513-85705535 TGGGATGTTGATAGTGGGGGAGG - Intronic
1086478247 11:87203136-87203158 CGGGATGTTAATAATGGGGGAGG - Intronic
1086663159 11:89446936-89446958 GGGGATGTTGATAATGGGGGAGG + Intronic
1086673799 11:89579367-89579389 GGGGATGTTGATAATTGGGGAGG + Intergenic
1087803806 11:102533892-102533914 AGGGATGTTGATAATGGGGGAGG + Intergenic
1088088463 11:106009152-106009174 TGGGTTGTCAAAACTGGGGTGGG - Exonic
1088911925 11:114198678-114198700 TGGGATGTTGATGGTGGGGGAGG - Intronic
1089021023 11:115215103-115215125 TGAGATGTTAACAATGGGTGAGG - Intronic
1089576225 11:119446295-119446317 GGGGATGTTGATGATGGGGGAGG + Intergenic
1089831618 11:121333846-121333868 TGGGATGTGGATAGTGGGGGAGG + Intergenic
1090306029 11:125692107-125692129 CAGGATGTTAATATTGGGGGAGG + Intergenic
1090466161 11:126935943-126935965 TGAGATATCAATACTGGGGGAGG + Intronic
1091454462 12:596429-596451 GGGGATGTTGATAATGGGGGCGG + Intronic
1091464607 12:673080-673102 TGGGATGTTGACAGTGGGGGAGG - Intergenic
1093109563 12:15133004-15133026 TGGGATATGAATAATGGGGGAGG - Intronic
1093176907 12:15922890-15922912 GGGGATGTTGATAATGGGGGAGG + Intronic
1093296418 12:17397423-17397445 TGGGATGTCGATAGTGGGGGAGG + Intergenic
1093343393 12:18007730-18007752 TGTGATGCCAATAGTGTGGGAGG + Intergenic
1093778202 12:23101988-23102010 TGGCATTTCCATAATGGTGGAGG + Intergenic
1094215341 12:27935021-27935043 GGGGATGTTGATAATGGGGAAGG + Intergenic
1094469500 12:30790599-30790621 TGAGGTGTGAATAGTGGGGGAGG - Intergenic
1095382668 12:41614470-41614492 TGGGAGTTGAATCATGGGGGTGG + Intergenic
1095409969 12:41910946-41910968 TGGGATTTCAATAAGGGGAATGG - Intergenic
1095681349 12:44980139-44980161 GGGGATGTTGATACTGGGGGAGG - Intergenic
1095909612 12:47413065-47413087 TGGGATGGCAATAGTGGTGGTGG - Intergenic
1098069356 12:66655410-66655432 TGGGATGTTGATAGTGGGGGAGG - Intronic
1098611696 12:72466747-72466769 TGAGATGTGAATAATGGTAGAGG - Intronic
1098710998 12:73761623-73761645 GGGGATGTTAATAATAGGAGAGG - Intergenic
1098881483 12:75921811-75921833 TGGCAGGCCAATGATGGGGGAGG + Intergenic
1099265833 12:80446589-80446611 CGGGATTTCAAAAATGGGGAGGG - Intronic
1099501931 12:83424070-83424092 TGGGATGTTGATAGTTGGGGAGG - Intergenic
1100911764 12:99372190-99372212 GGGGATGTTCATGATGGGGGAGG + Intronic
1101649435 12:106661474-106661496 AGGGATGTTGTTAATGGGGGAGG - Intronic
1102249978 12:111380190-111380212 AGGGTTGGCAATGATGGGGGTGG - Intergenic
1103009034 12:117443613-117443635 TGGGATGTCATAAGTGGAGGCGG - Intronic
1103227526 12:119300989-119301011 TGGGATGTTGACAGTGGGGGAGG - Intergenic
1103553355 12:121751375-121751397 TGGGATGTGAATATGGGGTGTGG - Intronic
1104364412 12:128164219-128164241 TGGGGTGTCACTAATGGTGGAGG - Intergenic
1105232805 13:18515198-18515220 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1105406251 13:20134899-20134921 TGGGATGGGAGTTATGGGGGTGG - Intergenic
1105604803 13:21918056-21918078 TAGGAGGTCAATAAAGGGAGAGG - Intergenic
1106110255 13:26771001-26771023 AAGGATGTGGATAATGGGGGAGG + Intergenic
1106902723 13:34371149-34371171 TGTGATGTCTTTAATGTGGGTGG + Intergenic
1107431847 13:40347363-40347385 TGGGATGTTGATAGTAGGGGAGG + Intergenic
1108090728 13:46846957-46846979 TGTGCTGGCAAAAATGGGGGTGG + Intronic
1108316129 13:49239354-49239376 GGGGATGTTAATAGTTGGGGAGG + Intergenic
1109988450 13:70020960-70020982 GGGGATGTTGATAATAGGGGAGG - Intronic
1110202959 13:72874857-72874879 GGGGATGTTCATAATGGGGTAGG - Intronic
1110458594 13:75718571-75718593 GGGGACGTTGATAATGGGGGAGG - Intronic
1110753432 13:79143103-79143125 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1110782290 13:79480721-79480743 GGGGATGTTGATAATGGTGGGGG + Intergenic
1110783973 13:79501367-79501389 GGGGATGTTGTTAATGGGGGAGG + Intronic
1110873496 13:80480398-80480420 GGGGATGCTGATAATGGGGGAGG - Intergenic
1111516273 13:89335779-89335801 TGGGATGTTGATAGTTGGGGAGG + Intergenic
1111599957 13:90460382-90460404 GGGGATGCTGATAATGGGGGAGG - Intergenic
1112146382 13:96705055-96705077 GGAGATGTCAATAGTGAGGGAGG - Intronic
1112240983 13:97680719-97680741 GGAGATGTTGATAATGGGGGAGG - Intergenic
1112939557 13:104844913-104844935 TGAGATGTTGATAGTGGGGGAGG + Intergenic
1113237588 13:108297745-108297767 GGGGATTTTGATAATGGGGGAGG - Intronic
1113971290 13:114192289-114192311 GGGCATGTTGATAATGGGGGAGG + Intergenic
1114042039 14:18688019-18688041 TGAGATGTTAATATTTGGGGAGG + Intergenic
1114239431 14:20852651-20852673 GGGGATGTCGATAATGGGGGAGG + Intergenic
1114546165 14:23503216-23503238 GGGGATGTTGATAATGGGGGAGG - Intronic
1115023609 14:28713587-28713609 TGGGAGCTCCAAAATGGGGGAGG + Intergenic
1116218037 14:42045505-42045527 GGGGATGTTGATAATGGGGGAGG - Intergenic
1116276223 14:42836141-42836163 GGGAATGTTGATAATGGGGGAGG + Intergenic
1116577945 14:46599477-46599499 GAGGATTTGAATAATGGGGGTGG + Intergenic
1116686927 14:48051796-48051818 TGGGATATTAATAATGGAGAAGG + Intergenic
1116839949 14:49809959-49809981 GGGGATATCGATAATAGGGGAGG + Intronic
1116987443 14:51236553-51236575 AGGGATTTGAATAAAGGGGGTGG - Intergenic
1117625417 14:57632576-57632598 GGGAATGTTGATAATGGGGGAGG - Intronic
1117794352 14:59376871-59376893 GGGGATGTTGATAATAGGGGAGG + Intergenic
1117927996 14:60805339-60805361 CAGGATGTTAATAATGGGGGAGG - Intronic
1119028941 14:71176415-71176437 GGGGATGTGGATAATGGGGGAGG - Intergenic
1120380424 14:83771669-83771691 TGGGATGTGAATGAAGGGTGTGG - Intergenic
1120751842 14:88204822-88204844 TGGGATGTTGATAGTGGGGAAGG - Intronic
1120837519 14:89054763-89054785 GGGGATGTTGATAATGGGGGAGG + Intergenic
1121150536 14:91629582-91629604 TGGGATGTGGATAGTGGGGAAGG + Intronic
1121734380 14:96207668-96207690 GGGGATGTCAGTAACGGGGGAGG + Intronic
1122463573 14:101916014-101916036 TGGGGTGTCAGTTATGGGGTGGG + Intronic
1202938164 14_KI270725v1_random:112616-112638 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1123395034 15:19925273-19925295 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1123972781 15:25524470-25524492 GGGGATGTTGATGATGGGGGAGG + Intergenic
1124723957 15:32138463-32138485 GGGGATGTTGATGATGGGGGAGG - Intronic
1125060346 15:35413045-35413067 GGGGAGGTTGATAATGGGGGAGG + Intronic
1125119917 15:36143556-36143578 TGGGATGTTGATCATGAGGGAGG + Intergenic
1125234361 15:37495388-37495410 GGGGATGTTGATAATGGAGGAGG - Intergenic
1125262383 15:37842100-37842122 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1125278217 15:38016122-38016144 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1125278820 15:38022718-38022740 GGAGATGTTGATAATGGGGGAGG + Intergenic
1126017427 15:44365899-44365921 GGGGATGTTAATAATCGGGGAGG + Intronic
1126298820 15:47171845-47171867 AGGGATGTTAATAATGGGAAAGG - Intergenic
1126641910 15:50836154-50836176 TAGGATGTCCATAGTGGGTGAGG - Intergenic
1127068042 15:55260989-55261011 TGGGATGTTGATAGTGGGGGAGG + Intronic
1127299084 15:57634932-57634954 TAGGAGGACAATAATGTGGGAGG - Intronic
1127492889 15:59482046-59482068 TGGGATGTTGATAGTGGGAGAGG - Intronic
1127681268 15:61300804-61300826 GGGGATGTTACTAATCGGGGAGG + Intergenic
1128023183 15:64411370-64411392 AGGGATGCTAATAATGGGGGAGG + Intronic
1131232223 15:90667561-90667583 GGGGATGTTAATCATCGGGGAGG + Intergenic
1131917753 15:97289240-97289262 AGGGATGTCAATAATGAAGAGGG - Intergenic
1132614979 16:835942-835964 TGGAAGGTCTGTAATGGGGGTGG + Intergenic
1134060910 16:11198989-11199011 TGGCAAGTCAATACTGGGTGTGG - Intergenic
1134676666 16:16095415-16095437 TGGGATGTCAAAACTGGAGTGGG + Intronic
1135433621 16:22409030-22409052 GGGGATGTTGACAATGGGGGAGG - Intronic
1135778219 16:25275794-25275816 GGGGATGTCGATCATGGGGGAGG + Intergenic
1135914286 16:26591040-26591062 CAGGATGTTAATAATAGGGGAGG + Intergenic
1136527963 16:30845073-30845095 TGTGGTGTCCATATTGGGGGAGG - Intronic
1136701131 16:32143702-32143724 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1136766529 16:32783760-32783782 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1136770226 16:32831446-32831468 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1136801569 16:33086618-33086640 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1136936348 16:34469355-34469377 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1136963472 16:34879215-34879237 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1137088105 16:36154502-36154524 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1137092618 16:36213702-36213724 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1137220585 16:46445862-46445884 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1137238647 16:46636272-46636294 GGGGCTGTTGATAATGGGGGAGG + Intergenic
1138268909 16:55680750-55680772 TGGGATGTGGACAGTGGGGGTGG + Intronic
1138356123 16:56381882-56381904 AGGGATGTTGATAATGGGGAAGG + Intronic
1138812983 16:60172272-60172294 TGGGATGTTGATAGTGGAGGAGG + Intergenic
1139232915 16:65303696-65303718 CAGGATGTCAATAGTGGGGGAGG + Intergenic
1139784736 16:69383757-69383779 TGGGATCCCAAAGATGGGGGTGG - Intronic
1140030642 16:71335495-71335517 TGGCAACTCAAAAATGGGGGAGG - Intergenic
1140860996 16:79017780-79017802 TGTTATGCAAATAATGGGGGTGG - Intronic
1141511430 16:84514566-84514588 TGGGATGAAAATAATGGGGGTGG + Intronic
1141847929 16:86623541-86623563 TGGGAAGTCAGTAAATGGGGAGG + Intergenic
1203068918 16_KI270728v1_random:1046010-1046032 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1142941317 17:3382058-3382080 TGGGAAGTCAAGAAAGGAGGTGG + Intergenic
1143521618 17:7447362-7447384 AGGGAAGCCATTAATGGGGGAGG - Intronic
1143947303 17:10604647-10604669 TGGGATGTTGATAGTCGGGGAGG - Intergenic
1144488484 17:15687056-15687078 GGGCATGTCAACAATGGGAGTGG + Intergenic
1144912528 17:18695249-18695271 GGGCATGTCAACAATGGGAGTGG - Intergenic
1145108254 17:20138319-20138341 GGGGATGTTGATAATGGGAGAGG - Intronic
1145229378 17:21161260-21161282 AGGGATGTGGATAATGGGGGAGG + Intronic
1145691653 17:26747676-26747698 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1145708393 17:26944315-26944337 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1146091142 17:29879491-29879513 GGAGATGTTGATAATGGGGGAGG - Intronic
1148023166 17:44567003-44567025 AGGGATGTTGATAATGGGGAAGG - Intergenic
1148222659 17:45874882-45874904 GGGGATGTCGATAGTGCGGGAGG - Intergenic
1148599748 17:48885267-48885289 TGGATGGTGAATAATGGGGGTGG - Intergenic
1149853656 17:60058697-60058719 TGAGATGGCAAAAATGGGAGTGG + Intronic
1149999376 17:61423925-61423947 GGGGATGTTGAAAATGGGGGAGG + Intergenic
1150061082 17:62068678-62068700 GGGGATGTTGATAATGAGGGAGG + Intergenic
1150680988 17:67284326-67284348 GGGGATATTGATAATGGGGGAGG + Intergenic
1150865856 17:68849365-68849387 GGGGATGTGGATGATGGGGGAGG + Intergenic
1150878570 17:68997728-68997750 GGGAATGTTAATAATGGCGGAGG - Intronic
1151044211 17:70900282-70900304 ATGGATATTAATAATGGGGGAGG + Intergenic
1151516031 17:74596513-74596535 GGGGATGTTGATAATGGGGGAGG - Intergenic
1203183173 17_KI270729v1_random:85223-85245 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1153404999 18:4727852-4727874 TGGGATGTTGCTAATGGGGGAGG + Intergenic
1154398659 18:14013689-14013711 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1154520496 18:15223254-15223276 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1154944425 18:21147661-21147683 TGGAATGTTGATAGTGGGGGAGG - Intergenic
1155072900 18:22331772-22331794 TGGGAGATCAATAATGGATGGGG + Intergenic
1155564369 18:27117341-27117363 AGGGATGTTGAAAATGGGGGAGG - Intronic
1156054523 18:32983020-32983042 TGGGTTGTTGATAATGGAGGAGG + Intronic
1157418498 18:47526047-47526069 TGGGATGTACAGGATGGGGGTGG - Intergenic
1157431400 18:47630017-47630039 TGGGATGACACTAGTGGCGGAGG + Intergenic
1157503906 18:48212549-48212571 GGGGATGTCAATAATGTGGGAGG + Intronic
1158730956 18:60022036-60022058 GGGGATGTTGGTAATGGGGGAGG - Intergenic
1159326181 18:66922264-66922286 GGGGATGCTAATAATGGGAGAGG - Intergenic
1159736511 18:72105611-72105633 TGGAATGTTGATAATGGGGGAGG + Intergenic
1159818288 18:73105593-73105615 GGGGATGTTGATAATGGAGGAGG - Intergenic
1162044944 19:7992806-7992828 TGAGATGCTAATAATGGGTGTGG + Intronic
1164817666 19:31217581-31217603 GGGGCTGTCGATAATGGAGGAGG - Intergenic
1164894352 19:31858257-31858279 GGGGTTGTTAACAATGGGGGAGG + Intergenic
1164969052 19:32514931-32514953 GGGGATGTGAATAATAGGGGAGG + Intergenic
1165613924 19:37182047-37182069 GGGGATGTTGATGATGGGGGAGG + Exonic
1165931784 19:39363925-39363947 GGGGCTGTAAATAATGGGTGGGG - Intronic
1166564301 19:43754477-43754499 TGGGTTGGCAGGAATGGGGGCGG - Intronic
1167764947 19:51475856-51475878 GGGGCTGTTGATAATGGGGGTGG + Intergenic
1167975066 19:53219540-53219562 TGGGTTGTTAATAATGGGGGAGG - Intergenic
1167997562 19:53418654-53418676 TGGGAGGCCAATGGTGGGGGGGG + Intronic
1168329324 19:55557551-55557573 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1168415804 19:56167436-56167458 TGGGAGGTCAGCACTGGGGGCGG - Intergenic
1202671283 1_KI270709v1_random:55768-55790 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1202681641 1_KI270712v1_random:10535-10557 GGGGATGTCAAGACTGGTGGAGG + Intergenic
924971839 2:135583-135605 GGTGATGTTGATAATGGGGGTGG + Intergenic
925483001 2:4297323-4297345 TGGGATGTTGATAATGGAGAAGG - Intergenic
926204728 2:10828037-10828059 TGGGATGTTGATAGTGGGGAAGG - Intronic
926780874 2:16470770-16470792 GGGGATGTTGATAATGGGGGAGG + Intergenic
927378288 2:22445133-22445155 TAGGATGTCAATTATGGGTGTGG - Intergenic
927384548 2:22518106-22518128 TTGGATGTGGATGATGGGGGAGG - Intergenic
927918689 2:26954115-26954137 TAGGATGTTAGTAATAGGGGAGG - Intergenic
927931064 2:27044613-27044635 TGGGATGTTGATGGTGGGGGAGG - Intronic
928020766 2:27703036-27703058 GGGAATGTTGATAATGGGGGAGG - Intergenic
929344844 2:40869426-40869448 CGGGATGTTGATAATGGGAGAGG - Intergenic
930920237 2:56744334-56744356 TGGGATGTCAAGAGTGGTGGCGG + Intergenic
930941164 2:57015792-57015814 GGAGATGTCAATAATGGGGGAGG + Intergenic
931965501 2:67529216-67529238 CAGGATGTCTATAATGGGGGAGG + Intergenic
932026703 2:68141004-68141026 TGGGAGGTGATTAATGGGGGCGG - Intronic
932488920 2:72106071-72106093 GGGGATGTTAATAATGGGGGAGG - Intergenic
932923764 2:75946404-75946426 GGGGATGTTGACAATGGGGGAGG - Intergenic
933531130 2:83513740-83513762 GTGGATGTTGATAATGGGGGAGG + Intergenic
934250127 2:90344517-90344539 GGGGATGTCAAGACTGGTGGAGG - Intergenic
934259440 2:91458899-91458921 GGGGATGTCAAGACTGGTGGAGG + Intergenic
934302736 2:91790820-91790842 GGGGATGTCAAGACTGGTGGAGG + Intergenic
934330520 2:92061946-92061968 GGGGATGTCAAGACTGGTGGAGG - Intergenic
934468743 2:94291832-94291854 GGGGATGTCAAGACTGGTGGAGG - Intergenic
935209245 2:100924179-100924201 GGGGATGCTGATAATGGGGGAGG - Intronic
935518517 2:104076270-104076292 TGGGATGTTATTACTGGGGGAGG - Intergenic
936707225 2:115088964-115088986 TGGGATGGCAATAAAGGTTGTGG - Intronic
936919414 2:117672212-117672234 GGGGATGTTGATAATGGGGGAGG + Intergenic
936941909 2:117892116-117892138 TGGGATGTTGATGGTGGGGGAGG - Intergenic
938129979 2:128706989-128707011 TGGGAGGTAGATAATGGGGGTGG - Intergenic
938268177 2:129944513-129944535 TGAGATGTTAATATTTGGGGAGG - Intergenic
938519851 2:132057028-132057050 GGGGATGTCAAGACTGGTGGAGG - Intergenic
938826761 2:135013392-135013414 GGCGATGTTAATAATGGGTGAGG - Intronic
939857850 2:147382033-147382055 TGGGATGTTGATAATTGGGGAGG + Intergenic
939962094 2:148574223-148574245 TGGGGTGTTGATAGTGGGGGAGG + Intergenic
941089553 2:161159283-161159305 AGGGATGTTGATAATGGGGAAGG + Intronic
941508625 2:166377487-166377509 GGGAATGTTGATAATGGGGGAGG - Intergenic
941611000 2:167662421-167662443 TGGGATGTTGATGATGTGGGAGG - Intergenic
941717429 2:168778834-168778856 GGTGATGTTGATAATGGGGGAGG + Intergenic
941733400 2:168945179-168945201 GGAGATGTTGATAATGGGGGAGG + Intronic
942287018 2:174429555-174429577 TGGGATGTTGATAGTGGGGGAGG - Exonic
942434102 2:175952251-175952273 TTGGATTTTAGTAATGGGGGTGG + Intronic
942530890 2:176909129-176909151 GGGGATGTTGATAATGGAGGAGG + Intergenic
942660443 2:178258491-178258513 TGGGATATCAATAATTGTCGTGG - Intronic
942720198 2:178942720-178942742 GGGGATGTTGATTATGGGGGAGG + Intronic
942919028 2:181348300-181348322 GGGGATGTTGATAATGGGGGAGG + Intergenic
942991264 2:182206333-182206355 GGGGATGTTGACAATGGGGGAGG - Intronic
943032005 2:182696679-182696701 GGGGATGTTGACAATGGGGGAGG + Intergenic
944326383 2:198409763-198409785 TGTGATGGCGACAATGGGGGAGG + Intronic
944726795 2:202479555-202479577 GGGAATGTTGATAATGGGGGAGG - Intronic
945212505 2:207398039-207398061 TGGGCTGTCAAAAAGGGAGGAGG - Intergenic
945674131 2:212834348-212834370 TGGGATATTGATAGTGGGGGAGG - Intergenic
945809468 2:214530960-214530982 AGCAATGTCAACAATGGGGGTGG + Intronic
946671748 2:222112137-222112159 GAGGATGTTGATAATGGGGGAGG + Intergenic
947213127 2:227725968-227725990 TGGGATGTCAGTAGTGAAGGAGG - Intergenic
1169107469 20:3009239-3009261 TGGGATGTCATTGATGGGGGTGG + Intronic
1170417042 20:16155675-16155697 GAGGATGTTCATAATGGGGGAGG + Intergenic
1170449737 20:16470397-16470419 AGGGATGGCAACAATGGGGGAGG + Intronic
1170530245 20:17284075-17284097 TGAGATGGCAATGGTGGGGGTGG - Intronic
1170530835 20:17289401-17289423 CTGAATGTCAATAATGGGAGAGG + Intronic
1170651476 20:18246493-18246515 GGGGATGTTAATAATGGGGGAGG - Intergenic
1170880294 20:20291094-20291116 GGGGATGTTGATAGTGGGGGAGG - Intronic
1171115811 20:22523968-22523990 AGGGCTGTCACCAATGGGGGTGG + Intergenic
1171384522 20:24761156-24761178 TGGGATGTTGATAATGGGGAAGG + Intergenic
1172077065 20:32307151-32307173 GGAGATGTCCATAATGGGGGAGG - Intronic
1173787179 20:45802581-45802603 CCTGATGTCGATAATGGGGGAGG - Intronic
1175188432 20:57195448-57195470 TGGGACGGCAAGAATGGGGAGGG - Intronic
1175511604 20:59531529-59531551 GGCGATGTTGATAATGGGGGAGG + Intergenic
1176585152 21:8576520-8576542 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1176776784 21:13143500-13143522 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1176889148 21:14293371-14293393 GAGGATGTTGATAATGGGGGAGG + Intergenic
1177001123 21:15614493-15614515 GGGGATGTTGATAATGGGGAAGG + Intergenic
1177633877 21:23761001-23761023 TGGGATGTTGATAATGGAAGAGG + Intergenic
1177670000 21:24212646-24212668 GGGGATGTTGATAATAGGGGAGG + Intergenic
1178101698 21:29275856-29275878 GGGGATGTCAATAATGGTGGAGG - Intronic
1178381157 21:32110040-32110062 GGGGATGTTGATAATGGGGAAGG + Intergenic
1178594984 21:33945220-33945242 GGGGACGTCCATAGTGGGGGAGG + Intergenic
1179057541 21:37949953-37949975 GGGGATGTTGATAGTGGGGGAGG + Intergenic
1179227644 21:39469198-39469220 GGGGATGTTGATAATGGGGGAGG - Intronic
1179300492 21:40104760-40104782 GGGGATGTCGATAGTGGGGGAGG + Intronic
1180019330 21:45111396-45111418 ACGGATGTTGATAATGGGGGAGG - Intronic
1180126067 21:45791032-45791054 TGGGATGCCCAGGATGGGGGTGG + Intronic
1180237399 21:46471431-46471453 TGGGATGCTGATAATGCGGGAGG - Intronic
1180267961 22:10553420-10553442 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1181000507 22:19985901-19985923 TGGGAGGGCCATAATGGGGATGG - Intronic
1181497208 22:23294155-23294177 TGGGATGTCCATAATTGAGATGG - Intronic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
1183466107 22:37981204-37981226 TGGGATGTCAAGAAGTGGGGTGG - Intronic
1183766456 22:39880538-39880560 GGGGATGTTTATAATGGGGGAGG + Intronic
1183952600 22:41359886-41359908 TGGCATGGCAAGCATGGGGGCGG + Exonic
1203236993 22_KI270732v1_random:13715-13737 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1203290772 22_KI270735v1_random:36206-36228 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1203323606 22_KI270737v1_random:94039-94061 GGGGATGTCAAGACTGGTGGAGG - Intergenic
949499289 3:4663582-4663604 TAGGATGTCGGTAGTGGGGGAGG - Intronic
949982964 3:9514436-9514458 GGGGATGTCGATAGTGAGGGAGG - Intronic
951436649 3:22672986-22673008 TGGGATGTTGATAGTTGGGGAGG + Intergenic
952542424 3:34380256-34380278 TAGGAGGTCAATAGTGAGGGAGG + Intergenic
954555240 3:51512508-51512530 TAGGATGTTGATAATGGAGGAGG + Intergenic
956092567 3:65683354-65683376 GGGGATGTTGATAATGTGGGAGG + Intronic
956115862 3:65917986-65918008 GGGGACGTTGATAATGGGGGAGG + Intronic
956756296 3:72391045-72391067 TGGCATGTGAAGAATGAGGGTGG - Intronic
956771426 3:72529291-72529313 GGGGATGTTGATAGTGGGGGAGG + Intergenic
957192365 3:77025984-77026006 TTGGCTGTCAATGATGGTGGTGG - Intronic
957676423 3:83372770-83372792 GGGGATGTTGATAATGGGAGAGG + Intergenic
957901756 3:86503333-86503355 AGGAATGTTGATAATGGGGGAGG - Intergenic
958889974 3:99772514-99772536 CAGGATGTTCATAATGGGGGAGG + Intronic
959243273 3:103828559-103828581 GTGGATGTTTATAATGGGGGAGG + Intergenic
959633042 3:108530634-108530656 GGGGATGTTGATAATGGGTGAGG + Intergenic
959753567 3:109868460-109868482 TGGGATGTTGATAATGGCTGAGG + Intergenic
959877001 3:111395050-111395072 AGGGATGTTGATAATGAGGGAGG - Intronic
959898827 3:111636986-111637008 TCAGATGTCTATAATGGGGAAGG - Intronic
959933512 3:112007184-112007206 GGGGATGTTGATAATGGGGAAGG - Intronic
960088789 3:113617860-113617882 GGAAATGTCAATAGTGGGGGAGG - Intronic
960513232 3:118575428-118575450 AGTGATGAGAATAATGGGGGGGG + Intergenic
960717365 3:120590029-120590051 GAGGATGTCGATAACGGGGGAGG + Intergenic
962621408 3:137183643-137183665 CGGGGTGTTGATAATGGGGGAGG - Intergenic
962699906 3:137987787-137987809 GGGGATGTTGATAATGGGAGAGG - Intergenic
962992899 3:140595667-140595689 GGGGATGTTGATGATGGGGGAGG - Intergenic
963858870 3:150286018-150286040 TGGTATGTTAATATTGGAGGTGG - Intergenic
964591004 3:158361531-158361553 TGGGCTGTCCACAGTGGGGGAGG - Intronic
964650020 3:159000540-159000562 TGTGATGATAATAATGTGGGAGG + Intronic
964917729 3:161856316-161856338 GGGTATGTTGATAATGGGGGAGG + Intergenic
965181693 3:165412166-165412188 TGGGATGTTTATAGTGGGAGAGG + Intergenic
965641520 3:170833741-170833763 GGGGATGTTGATAATGGGAGAGG - Intronic
965890776 3:173511329-173511351 GTGTCTGTCAATAATGGGGGAGG - Intronic
966399361 3:179532663-179532685 TGGGATGTTGACAGTGGGGGAGG - Intergenic
968703930 4:2069496-2069518 TGGGGTGGCAAAAATGGGGCGGG - Intergenic
969109675 4:4836077-4836099 AGGGATGTTGATAATGGTGGAGG + Intergenic
971306065 4:25482717-25482739 GGGAATGTTGATAATGGGGGAGG + Intergenic
971595926 4:28528733-28528755 TGAGATGGAAATAATGGGGGTGG - Intergenic
971949552 4:33327397-33327419 GGGAATGTTAATAATGGAGGAGG + Intergenic
971992682 4:33920363-33920385 GGGGATGTTGATAATGGGGGAGG - Intergenic
973289172 4:48453404-48453426 GGGGATGTTGATAATGGGGGAGG + Intergenic
974129488 4:57735742-57735764 TGTGGTCTCAATAATGGTGGTGG + Intergenic
974178802 4:58359178-58359200 TGGTAATTGAATAATGGGGGTGG + Intergenic
974394026 4:61311950-61311972 TGGGATGTTAATAATGGGGGAGG + Intronic
974632618 4:64513423-64513445 GGGGATGTTAATAATGGGGGAGG + Intergenic
975124500 4:70766660-70766682 TGGGATGTTGATAATGAGGGAGG - Intronic
976280620 4:83323381-83323403 GGGGATGTTGATAATGAGGGAGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
976818696 4:89180235-89180257 TGGGATGTTGATAGTTGGGGAGG - Intergenic
977155071 4:93561467-93561489 GGGGATGTTAATAATAAGGGAGG - Intronic
977314621 4:95430221-95430243 CAGGATGTTAATAATGAGGGAGG + Intronic
977574387 4:98660502-98660524 GGGGATGTTGACAATGGGGGAGG - Intergenic
977655728 4:99518724-99518746 TGGCATATGCATAATGGGGGAGG - Intronic
977706225 4:100073865-100073887 TGGGATGTTAATAGTTGGGGAGG - Intergenic
978033016 4:103959006-103959028 GGGGATGTTGATAATGGAGGAGG + Intergenic
978129552 4:105178629-105178651 TGGGATGTTGATAATGGGGAAGG + Intronic
978243668 4:106547414-106547436 TGGGATGTTGATAATGGGGGAGG + Intergenic
978686157 4:111446012-111446034 AGGGATGTTGATAATGTGGGAGG + Intergenic
978714465 4:111824942-111824964 TGGGAGGTAAATTATTGGGGTGG + Intergenic
978920043 4:114173172-114173194 GGGGATGTAGATAATAGGGGAGG - Intergenic
979035926 4:115717423-115717445 TGGGATGGTGATAATGGGTGAGG - Intergenic
979162932 4:117486782-117486804 GGGGATGTTAATAATGGGGGAGG - Intergenic
979696525 4:123618932-123618954 TGGGAAGTCCATAAGGGGTGTGG - Intergenic
980411806 4:132429799-132429821 TGGGATGGGAATTATGGGGAAGG + Intergenic
981118256 4:141017434-141017456 TGGGATGTTGATGATGGAGGAGG - Intronic
981509854 4:145544166-145544188 GGGGATATTAATAATGAGGGAGG + Intronic
982033855 4:151326248-151326270 GGGGATGTTGATAATGGGGGAGG + Intergenic
982168357 4:152637061-152637083 GGGGACGTTGATAATGGGGGAGG + Intronic
982211938 4:153044828-153044850 GGGTATGTTGATAATGGGGGAGG + Intergenic
982852162 4:160332046-160332068 TGGGATGTTGATAGTGGGAGAGG + Intergenic
983110702 4:163745947-163745969 GGGGGTGTTGATAATGGGGGAGG - Intronic
984292630 4:177814564-177814586 GGGGATGTTGATAATAGGGGAGG - Intronic
984313617 4:178097368-178097390 GGGGATGTTGATAATGGGGAAGG + Intergenic
984356965 4:178673338-178673360 TGGGATGTCAATTATAGGTACGG - Intergenic
986021824 5:3811819-3811841 GGGGATGCTCATAATGGGGGAGG + Intergenic
986373944 5:7110970-7110992 GGGGATGTTGATAATGGGAGAGG + Intergenic
986385052 5:7224973-7224995 GGGGATGCAAATAATTGGGGTGG - Intergenic
986603061 5:9493076-9493098 GGGAATGTCAACAATGGAGGAGG + Intronic
986839000 5:11674451-11674473 GGGGATGTTGATAATGAGGGAGG - Intronic
986877426 5:12128355-12128377 GGGGATGTTGATAATGAGGGAGG + Intergenic
987024085 5:13906317-13906339 GGGGATGTTCATAATGGGGGAGG + Intronic
987420740 5:17717297-17717319 GGGGATGTTGTTAATGGGGGAGG + Intergenic
989809003 5:45649350-45649372 GGGGATGTTGATAATGGGGAGGG - Intronic
991683985 5:69165374-69165396 TGGGGTGTCAATAGTGGGGAAGG + Intergenic
991688307 5:69201981-69202003 GGGGATGTTGATAATGGGAGAGG + Intronic
992134646 5:73731966-73731988 GGGGATGTGGATACTGGGGGAGG - Intronic
992857818 5:80881282-80881304 CAGGATGTCAATAGTGAGGGAGG - Intergenic
993049003 5:82903629-82903651 TGTGATATCAAAAGTGGGGGAGG - Intergenic
993528576 5:88997976-88997998 TGTGATGTCAATAATAGGTATGG - Intergenic
995469688 5:112488014-112488036 AGGGATGTTGGTAATGGGGGAGG - Intergenic
995577000 5:113547553-113547575 GGGGATGTTGATAATGGGGGAGG + Intronic
996002434 5:118380827-118380849 AGGGATGTTGATAATGGGGTGGG - Intergenic
996610903 5:125379099-125379121 TGGGTTATAAATAATGGGGGCGG - Intergenic
996643096 5:125781217-125781239 TGGGATGGACATATTGGGGGAGG + Intergenic
997054952 5:130431110-130431132 GGGGATGTTGATAATGGAGGAGG + Intergenic
998259704 5:140620588-140620610 GGGGTTGTCGATAATGAGGGAGG + Intergenic
998361889 5:141595377-141595399 GGGGATGTTGACAATGGGGGAGG + Intronic
999189554 5:149736859-149736881 GGGAATATTAATAATGGGGGAGG - Intronic
999427866 5:151503287-151503309 GGGAATGTTAATAATGAGGGAGG + Intergenic
999846146 5:155482683-155482705 GTGGATGTAGATAATGGGGGAGG + Intergenic
1000405393 5:160882317-160882339 GGGGATGTTGATAATGGGAGAGG + Intergenic
1000808381 5:165827101-165827123 TAGGGTTACAATAATGGGGGAGG + Intergenic
1001791602 5:174462267-174462289 TGGGATGTTAATCATGGGAAAGG - Intergenic
1002084511 5:176764215-176764237 GGGGACGTTGATAATGGGGGAGG - Intergenic
1002573511 5:180158018-180158040 GGTGACGTCGATAATGGGGGAGG + Intronic
1002910324 6:1486318-1486340 GGGGATGTCTATAGTGAGGGAGG + Intergenic
1003152302 6:3563112-3563134 TGAGATCCCAATAATGGAGGTGG + Intergenic
1003632087 6:7796194-7796216 TGGAATCTCAAAAATGGAGGAGG + Intronic
1004471475 6:15933355-15933377 GGGGATGTTAATAATAGGGGAGG - Intergenic
1004690937 6:17991568-17991590 TGGGATGTGAAGATTGAGGGAGG + Intergenic
1005006903 6:21296593-21296615 AGAGATGTCAATAACGCGGGAGG + Intergenic
1005227903 6:23664324-23664346 TGGGATGTCAATAGTGGGGGAGG - Intergenic
1005688453 6:28278700-28278722 GGGGATGTTGATAATAGGGGAGG - Intronic
1006565431 6:34952402-34952424 TGTGATTTCCCTAATGGGGGAGG + Intronic
1006590637 6:35153291-35153313 GGGGATATTGATAATGGGGGAGG - Intergenic
1006952413 6:37833944-37833966 TGAGATGTCGATAGTAGGGGAGG - Intronic
1007624339 6:43234795-43234817 AGGGATGTTGATAATGGCGGAGG + Intergenic
1008358088 6:50579260-50579282 GGGGATATTAATAATGGGGGAGG + Intergenic
1009616624 6:66016483-66016505 TGGGATGTTAATAATGTGAGTGG - Intergenic
1010372113 6:75122389-75122411 TGGGATGTTAATAGTGGAGGAGG + Intronic
1010908171 6:81519150-81519172 TGGGATGTTGATAGTGAGGGAGG + Intronic
1011007723 6:82666172-82666194 CAAGATGTCAATAGTGGGGGAGG + Intergenic
1011169276 6:84488006-84488028 GGGGATGTCAATAATGAGTGAGG + Intergenic
1011351428 6:86427865-86427887 TGGGGTATTAATAATGAGGGAGG - Intergenic
1011694485 6:89899731-89899753 TAGGATGTCAATAGTTGGGGAGG - Intergenic
1012163472 6:95918215-95918237 GGGGATGTTGATAATGAGGGAGG + Intergenic
1012320906 6:97844390-97844412 AGGGATGTTGATAATGGGGAAGG - Intergenic
1013845629 6:114447593-114447615 AGGAATGTTGATAATGGGGGAGG - Intergenic
1014333798 6:120105669-120105691 GAGGATGTTGATAATGGGGGAGG - Intergenic
1014775276 6:125501929-125501951 GGGGATGTTGATAATGAGGGCGG + Intergenic
1015173366 6:130279278-130279300 AGGTATGTGAATCATGGGGGCGG + Intronic
1015689909 6:135910519-135910541 GGGGATGTGGATAATGGAGGAGG - Intronic
1015767450 6:136733727-136733749 GGGGATGTTGACAATGGGGGAGG - Intronic
1016221344 6:141674012-141674034 TGGGATGTTGATGGTGGGGGAGG + Intergenic
1016430297 6:143977105-143977127 GGGGATGTCGATAATGGAGAAGG - Intronic
1016678462 6:146799688-146799710 GGGGATGTTAATAATGGGGGAGG + Intronic
1017661429 6:156677910-156677932 GGAGATGTCAATAGTGGGGAAGG + Intergenic
1017768513 6:157626600-157626622 GGAGATGTTGATAATGGGGGAGG - Intronic
1017828406 6:158100868-158100890 GGGGAAGTCAATAGTGGAGGAGG - Intergenic
1020346655 7:7172739-7172761 TGAGATGTTGATAGTGGGGGAGG - Intronic
1020866327 7:13568662-13568684 GGGGATGTTGATAATGAGGGAGG - Intergenic
1020874980 7:13681818-13681840 GGGGATGTTGATAATGGGGGAGG + Intergenic
1021086375 7:16424913-16424935 GGAGATGTTAATAATGTGGGAGG - Intergenic
1021341040 7:19463067-19463089 GGGGATGTTGATAATGGGGGAGG + Intergenic
1022689102 7:32628421-32628443 CGGGATGTCAATAGAGGGGTAGG + Intergenic
1022916680 7:34962822-34962844 CGGGATGTCAATAGAGGGGTAGG + Intronic
1024035958 7:45507627-45507649 GGGGATGTTGATAATGGGGGAGG - Intergenic
1024144288 7:46496441-46496463 GGGGATGTTGATAATGAGGGAGG + Intergenic
1024293155 7:47820990-47821012 TGGGATGTGAAACATGGGGAAGG + Intronic
1024923171 7:54582506-54582528 GGGGATGTTAATAGTGTGGGAGG + Intergenic
1025473947 7:60896294-60896316 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1025480108 7:60972449-60972471 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1025488813 7:61085397-61085419 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1025513057 7:61593580-61593602 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1025551860 7:62259907-62259929 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1025557610 7:62328628-62328650 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1025565014 7:62423775-62423797 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1025885874 7:65591029-65591051 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1026167668 7:67924587-67924609 GGGGATGTTAATAGTGGGAGAGG + Intergenic
1026420970 7:70236793-70236815 TGGGATGGCAATGAGGGGGAAGG - Intronic
1027393651 7:77730332-77730354 GGGGATGTTAATAATGGGGAAGG - Intronic
1028723003 7:94055449-94055471 GGGGATGTTGATAATGGTGGAGG + Intergenic
1028770188 7:94610418-94610440 GGGGATGTTGATAATGGGGGAGG + Intronic
1028987180 7:97017738-97017760 TGCGATGTCAAGAGTGGGGCCGG + Intergenic
1029537755 7:101166028-101166050 TGGGAGCTCAATACTGGGGAGGG + Intergenic
1029675780 7:102067685-102067707 TGAGTTGCTAATAATGGGGGAGG + Intronic
1029726405 7:102408534-102408556 TGGGCTGTGAATAAGGGTGGGGG + Intronic
1029846108 7:103413895-103413917 GGGGATGTTGATAGTGGGGGAGG - Intronic
1029920930 7:104262539-104262561 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1030290528 7:107867676-107867698 GGGGATGTTGATAATGGGAGAGG + Intergenic
1030714380 7:112790701-112790723 TGGGCTGTAAATACTGCGGGAGG + Intergenic
1030857677 7:114581546-114581568 TGGGATGTTTATAATAGGAGAGG - Intronic
1030877201 7:114828682-114828704 TGGAAAGTTGATAATGGGGGAGG + Intergenic
1030877240 7:114829734-114829756 TGGAAAGTTAATAATGGGGGAGG + Intergenic
1031379005 7:121061518-121061540 GGGGATGTTAATAATGGAGGAGG + Intronic
1031995535 7:128227947-128227969 TGGGATGTTAGTAACGGAGGTGG - Intergenic
1032757307 7:134903355-134903377 AGGGATGTTTATAATGGGAGAGG + Intronic
1033402708 7:141042071-141042093 GGGGGTGTTAATAATGGGGGAGG + Intergenic
1034014773 7:147570196-147570218 TGGGGTGTCACTAATGGGACCGG - Intronic
1035525823 8:312411-312433 GGGGATGTTGATAATGGGGGAGG - Intergenic
1035963375 8:4162678-4162700 TGGGATGTTGATAGTTGGGGAGG - Intronic
1036563903 8:9921753-9921775 TGGGATGACATTCACGGGGGTGG + Intergenic
1036703223 8:11027888-11027910 TGGGATGTTGATAATGGGGGAGG - Intronic
1036971538 8:13360972-13360994 TGCGATCTCAATACTTGGGGAGG + Intronic
1037287353 8:17315526-17315548 GGGGATGTGAATAATGCAGGTGG + Intronic
1037526134 8:19725832-19725854 GGGTATGTGAGTAATGGGGGAGG - Intronic
1037713706 8:21377688-21377710 GGGGATGTCACTAGTGGGGGAGG + Intergenic
1038044471 8:23754455-23754477 GGGGATGTCCACAGTGGGGGAGG - Intergenic
1038118086 8:24580506-24580528 TAGGATGTGAATAAATGGGGTGG - Intergenic
1038122788 8:24636848-24636870 TGGGATGTTTATAGCGGGGGAGG + Intergenic
1038473879 8:27848224-27848246 GGGGATGTTGATAATGGGGAAGG - Intergenic
1038477955 8:27881801-27881823 GGGGATGTTGATAATGGGGGAGG - Intronic
1039195426 8:35025825-35025847 TTGGTTGTCAAAAATGGGTGGGG - Intergenic
1039333363 8:36563230-36563252 AGGGATGTTGATAATGGGGGAGG + Intergenic
1039583313 8:38684549-38684571 TGGGATGAAAAAAAGGGGGGAGG + Intergenic
1039925137 8:41923190-41923212 GAGGATGTCAATAATCGGGGAGG + Intergenic
1039940956 8:42090700-42090722 GGGGATGTTTATAATGGGGGAGG + Intergenic
1040004847 8:42611227-42611249 TGGGATGTTGATAATGGGGAAGG + Intergenic
1041093288 8:54324929-54324951 GGGGGTGTTGATAATGGGGGAGG + Intergenic
1042306886 8:67342758-67342780 TGGTATGTCAAGATTGGGTGTGG - Intronic
1042427800 8:68669232-68669254 GGGGATGTTGATAATGGGGGAGG + Intronic
1043739710 8:83795363-83795385 GGGCATGTTGATAATGGGGGAGG + Intergenic
1043830880 8:84987422-84987444 GAGGATGTTGATAATGGGGGAGG - Intergenic
1043987688 8:86713950-86713972 GGGGATGTTGATAATGGGGAAGG - Intronic
1044013232 8:87020300-87020322 AGTGATTTGAATAATGGGGGAGG - Intronic
1044057789 8:87593867-87593889 GGGGATGTTTATAATGGGAGAGG - Intronic
1044325302 8:90851708-90851730 GGGGATGTTAATAATGGGGCAGG - Intronic
1044956887 8:97490437-97490459 GGGGACGTCGATAATGGGGGAGG + Intergenic
1045350916 8:101338867-101338889 TGGGATGTTGACAATGGTGGAGG - Intergenic
1045650262 8:104335746-104335768 GGGGATGTTGATATTGGGGGAGG + Intronic
1045885572 8:107093831-107093853 GGGGATTTTAATAACGGGGGAGG - Intergenic
1046465762 8:114601115-114601137 TGAGATGTCAATATTGAGGGTGG + Intergenic
1047640650 8:126817978-126818000 GGGGATGTTGATAATGGGGGAGG - Intergenic
1048318644 8:133381166-133381188 GGGGATGTTGATAATGGGGGAGG + Intergenic
1048414350 8:134209741-134209763 TGGGATGTTGATAGTGGGGCAGG - Intergenic
1048810722 8:138283657-138283679 GGAGATGTTGATAATGGGGGAGG + Intronic
1050145629 9:2564378-2564400 AGGGATGTTGATAATGGGTGAGG + Intergenic
1050163099 9:2738176-2738198 TGGGAGGTCAACAATGCAGGAGG + Intronic
1050196768 9:3093093-3093115 GGGGATGTTGATAATGGGTGAGG + Intergenic
1050229485 9:3505749-3505771 TGATATGTAAATGATGGGGGTGG - Intronic
1050777353 9:9282286-9282308 GGGGATGTTGATAATGGGGCAGG + Intronic
1050847241 9:10237141-10237163 GGGGATGTTGATAATGGGTGAGG + Intronic
1051442178 9:17097087-17097109 TGGGATGTTGATAGTGGGGGAGG - Intergenic
1051746710 9:20301676-20301698 GGGGATGTTGATAATGGAGGAGG - Intergenic
1052764446 9:32626460-32626482 AGTGATGTGAAGAATGGGGGAGG - Intergenic
1053624760 9:39857820-39857842 GGGGATGTTTATTATGGGGGAGG - Intergenic
1053699136 9:40669864-40669886 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1053838118 9:42162779-42162801 GGGGATGTTTATTATGGGGGAGG - Intergenic
1053880110 9:42585408-42585430 GGGGATGTTTATTATGGGGGAGG + Intergenic
1053892551 9:42708901-42708923 GGGGATGTTTATTATGGGGGAGG - Intergenic
1053945141 9:43300108-43300130 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1054219135 9:62392878-62392900 GGGGATGTTTATTATGGGGGAGG + Intergenic
1054231578 9:62516295-62516317 GGGGATGTTTATTATGGGGGAGG - Intergenic
1054310425 9:63469265-63469287 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1054409212 9:64793415-64793437 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1054442377 9:65277232-65277254 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1054487904 9:65744264-65744286 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1055092244 9:72374784-72374806 TGGGATGTTGATAATGGGGAAGG + Intergenic
1055102261 9:72478227-72478249 TGGGCTTTGAAGAATGGGGGTGG + Intergenic
1055542036 9:77319821-77319843 GGGAATGTTAATAAAGGGGGAGG - Intronic
1055931997 9:81568628-81568650 TGGGATGTTGATAGTGGGGAAGG - Intergenic
1056084345 9:83130347-83130369 TGGGATGTTGATAATTGGGGAGG - Intergenic
1056096927 9:83264520-83264542 TGGGATGTTGATGATGGGGGAGG + Intronic
1056212443 9:84377238-84377260 GGGGATGTTGATAATGAGGGAGG - Intergenic
1056466591 9:86861808-86861830 GGGGATGTGGATAATAGGGGAGG + Intergenic
1056701467 9:88914634-88914656 TGGGATGTTGATAGTGGGGGAGG + Intergenic
1057011108 9:91602115-91602137 GGGGATGTTAATAATGTGGGAGG - Intronic
1057858687 9:98623009-98623031 GGGGATGTTGATAATGGGGGAGG + Intronic
1058863801 9:109143377-109143399 CAGGATGTTGATAATGGGGGAGG + Intronic
1059685225 9:116628788-116628810 GGAGATGTTAATAGTGGGGGAGG + Intronic
1059894827 9:118850976-118850998 GGGGATGGTAATAATGGTGGAGG + Intergenic
1060111069 9:120906586-120906608 GGGGATGTTGATAGTGGGGGAGG - Intronic
1060371621 9:123078819-123078841 TAGGATGTTAATAATGAAGGTGG - Intronic
1060772350 9:126341755-126341777 TGGGTTGTCACCACTGGGGGAGG - Intronic
1203581023 Un_KI270746v1:5031-5053 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1203588276 Un_KI270747v1:28686-28708 GGGGATGTCAAGACTGGTGGAGG - Intergenic
1203615053 Un_KI270749v1:54038-54060 GGGGATGTCAAGACTGGTGGAGG + Intergenic
1185776667 X:2808795-2808817 TGAGTTTTCAATTATGGGGGAGG + Intronic
1185819241 X:3185657-3185679 GGGGATGTTCATAGTGGGGGAGG + Intergenic
1185852362 X:3500986-3501008 GGGGATATTGATAATGGGGGAGG + Intergenic
1186248233 X:7637663-7637685 GAGGATGTTAATAATGGGGGAGG - Intergenic
1187128143 X:16473676-16473698 TGGGATGTTGGTAATGGAGGAGG + Intergenic
1187314317 X:18178331-18178353 TGGGGTGGGAATAATGGGGTGGG - Intronic
1187783287 X:22854258-22854280 AGGGATGTTGATAGTGGGGGAGG + Intergenic
1187934174 X:24319790-24319812 TGGGATGTTGATAGTTGGGGAGG - Intergenic
1188269050 X:28116092-28116114 GGGGATGTTGATAATGGGGGAGG - Intergenic
1189464969 X:41271638-41271660 GGGGATATTGATAATGGGGGAGG + Intergenic
1189937545 X:46085581-46085603 GGGGATGTTGATAGTGGGGGAGG - Intergenic
1190157844 X:48008107-48008129 TGTGAAGGCAATAATGGTGGTGG - Intronic
1190173616 X:48130992-48131014 TGTGAAGGCAATAATGGTGGTGG - Intronic
1191963115 X:66725591-66725613 TGGGATTTCTATATTGGGGATGG + Intergenic
1192187645 X:68962863-68962885 GGGGATGTTGATAATGGGGGAGG - Intergenic
1192601297 X:72467306-72467328 TAAGATGTCAACATTGGGGGAGG + Intronic
1192735639 X:73847117-73847139 TGGGATGTAAATACAGTGGGTGG + Intergenic
1192903643 X:75525670-75525692 GGGGATGTTGATAATGGAGGTGG - Intergenic
1194184444 X:90756510-90756532 GGGGATATTGATAATGGGGGAGG + Intergenic
1195952704 X:110292902-110292924 TGGGGTGTTGTTAATGGGGGAGG + Intronic
1195999788 X:110769780-110769802 CGGGAGGTCAGTTATGGGGGCGG - Intronic
1197271139 X:124425921-124425943 TGGGATGGCAACAATGGGTATGG + Intronic
1198372786 X:136007274-136007296 TTGGCTGTCATCAATGGGGGGGG + Intronic
1198502376 X:137264252-137264274 GAGGATGTTGATAATGGGGGAGG + Intergenic
1200531033 Y:4338423-4338445 GGGGATATTGATAATGGGGGAGG + Intergenic
1201273920 Y:12281570-12281592 GGGGATGTGGATACTGGGGGAGG + Intergenic
1201293318 Y:12442673-12442695 TGAGTTTTCAATTATGGGGGAGG - Intergenic