ID: 1182183115

View in Genome Browser
Species Human (GRCh38)
Location 22:28372102-28372124
Sequence CTGGACTCTCTTTTTTAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182183115_1182183120 22 Left 1182183115 22:28372102-28372124 CCGCCTTAAAAAAGAGAGTCCAG 0: 1
1: 0
2: 1
3: 23
4: 202
Right 1182183120 22:28372147-28372169 GACAGATGATAGATTTAATCAGG 0: 1
1: 0
2: 1
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182183115 Original CRISPR CTGGACTCTCTTTTTTAAGG CGG (reversed) Intronic
901698193 1:11026750-11026772 CTGGAGTCTGTTTTTTTGGGTGG + Exonic
902773143 1:18657799-18657821 CTGGCGTCTTTTTTTTTAGGGGG - Intronic
903259262 1:22122502-22122524 GTGGACTCTCTTTCTGGAGGTGG + Intronic
903580862 1:24369635-24369657 CTGGTCTTTCTTTTGAAAGGTGG - Intronic
905058252 1:35117637-35117659 CTGTTTTCTCTTTTTTAAGGTGG - Intergenic
905322648 1:37128878-37128900 ATGGACTCTCATTTGGAAGGCGG - Intergenic
905537242 1:38732062-38732084 CAGGACTCTCTCTATTATGGAGG + Intergenic
911680831 1:100713340-100713362 CTGGAGTTTCTTTTTTCTGGTGG - Intergenic
911856472 1:102883834-102883856 ATGTACTCTCTCTTTGAAGGGGG + Intronic
912157261 1:106937003-106937025 ATGGACTCTTATTTTTAATGAGG - Intergenic
913196776 1:116463417-116463439 ATAGATTCTCATTTTTAAGGAGG + Intergenic
914806367 1:150995085-150995107 CTGGGTTTTCTTTTTTAAGATGG - Intronic
915132935 1:153708524-153708546 CTGTATTCTTTTTTTTAAAGGGG - Intergenic
915327854 1:155090335-155090357 CCTGACTCTTTTTTTTGAGGTGG + Intergenic
916523459 1:165587157-165587179 TGGGACTCTCTTTTTAAAAGGGG - Intergenic
918101498 1:181379655-181379677 CTGGGATCTCTTTTATAAGAGGG + Intergenic
919071340 1:192759201-192759223 CTAGACTCACTTGTTTAATGTGG + Intergenic
920952465 1:210585415-210585437 CTGGACTCTTTTTTTTGAGACGG + Intronic
922502906 1:226110136-226110158 CGGGGCTCCCTTTTTTAAGCAGG - Intergenic
922905761 1:229172446-229172468 CTGGTCTCTCTTATTTGAGTTGG - Intergenic
1066646269 10:37613336-37613358 CTTGAATTTCTTTTATAAGGTGG + Intergenic
1067382425 10:45787340-45787362 TTTGACTCTCCTTTTGAAGGAGG + Intronic
1067890125 10:50127888-50127910 TTTGACTCTCCTTTTGAAGGAGG + Intronic
1067963653 10:50885085-50885107 CAAGACTTTCTTTTTTATGGTGG + Intronic
1068746878 10:60542414-60542436 CTGTATTCTCTTTTATAAGCAGG + Intronic
1070119332 10:73560351-73560373 CTGGTCTCACTTTTTTTAGTAGG - Intronic
1072771068 10:98138204-98138226 CTTTACTCTCTTTTTTGATGTGG + Intronic
1078535439 11:12169894-12169916 CTGCACTCTCTTTTTAAAGAAGG - Intronic
1078637835 11:13068558-13068580 CTGGTCTCTCTTTTTCTAGGAGG - Intergenic
1080079042 11:28192657-28192679 CTGGACTTTCCTTTATTAGGTGG + Intronic
1083406662 11:62462100-62462122 CAGCAATCTCATTTTTAAGGTGG + Intronic
1085920115 11:80944226-80944248 CTTGACTATCTCTTTCAAGGTGG - Intergenic
1086879936 11:92141139-92141161 CTGCACTCTCTTTTTAAAGTTGG - Intergenic
1087729393 11:101760956-101760978 CTGAGGTCTCTTTTATAAGGAGG + Intronic
1088039510 11:105361107-105361129 ATATACTCTCTTTTTTAAGGGGG - Intergenic
1089031823 11:115338827-115338849 CTGTACTTTCTATTTTAAAGAGG + Intronic
1090140783 11:124258253-124258275 CATGAATGTCTTTTTTAAGGAGG - Intergenic
1090426752 11:126612538-126612560 CTGAACTGTCTATTTTAAAGGGG - Intronic
1093177524 12:15929194-15929216 AAGGACTCCCTTTTTAAAGGTGG + Intronic
1094189439 12:27682597-27682619 CTGGCCTCTCTCTTTTAGGATGG + Exonic
1096475058 12:51904275-51904297 CTGAACTCACTTATTCAAGGGGG - Intergenic
1096608937 12:52788481-52788503 CTGGATCCACTTTTTGAAGGAGG - Intergenic
1098357371 12:69624335-69624357 CTGTATTCTTTTTTTTAAGACGG + Intergenic
1104466358 12:128993994-128994016 CTGGACTTTCCTTTTTTGGGGGG - Intergenic
1106292823 13:28381024-28381046 CTGGACTCTTTTTTTGCATGTGG + Intronic
1107146650 13:37067576-37067598 CTGGAATGTCTTTCTTAAGGAGG + Intergenic
1107565762 13:41602422-41602444 CTGGTCTCTCATTTATAAAGCGG + Intronic
1109429318 13:62211878-62211900 CTGGAGTTTCTTCCTTAAGGTGG + Intergenic
1110754631 13:79158004-79158026 CTGAACTTTCTTTTTTAAGGGGG - Intergenic
1112608879 13:100936077-100936099 ATGGATTATCTCTTTTAAGGGGG - Intergenic
1113384263 13:109833731-109833753 CTGGAATCTCTTTTTTTTGTTGG - Intergenic
1115409173 14:33052843-33052865 TTGAACTTTTTTTTTTAAGGAGG + Intronic
1116014028 14:39385318-39385340 CTGAACTTTTTTTTTTAAAGAGG - Intronic
1116175056 14:41458589-41458611 CTGGACTTTTATTTTTAATGTGG - Intergenic
1117259309 14:54014246-54014268 CTAGATTCTTTTTTTTGAGGGGG + Intergenic
1117396869 14:55319679-55319701 CTGAACTTTCTTTTTTTAGATGG + Intronic
1120490898 14:85177329-85177351 CTGGTGTCTCTTCTTTAAGGTGG + Intergenic
1123020141 14:105394174-105394196 CAGGGGTCTCTGTTTTAAGGGGG + Intronic
1123044718 14:105505963-105505985 CTGGGCTCTTTTTTTTGAGACGG + Intergenic
1123735113 15:23176972-23176994 CCGGTCTCTCTTTTTTTTGGCGG - Intergenic
1124285628 15:28398286-28398308 CCGGTCTCTCTTTTTTTTGGCGG - Intergenic
1124297074 15:28513375-28513397 CCGGTCTCTCTTTTTTTTGGCGG + Intergenic
1125300190 15:38246712-38246734 CTGGAGTCTCTTTTGTAAATTGG - Intergenic
1126730767 15:51680413-51680435 CTGCACCCTCCTTTTCAAGGAGG - Intergenic
1127351964 15:58162175-58162197 CTGGGCTCTGTGTTTTAAGAGGG + Intronic
1127732727 15:61815461-61815483 CTGGCCTCCCTTTCTTAGGGAGG - Intergenic
1128123708 15:65174267-65174289 CTGGCCTCTTTTTTTTGAGATGG + Intronic
1129273033 15:74429339-74429361 CTGGGCTCTGTTTTTTGAGGAGG - Intronic
1130102287 15:80903181-80903203 CTGGACACCATATTTTAAGGTGG + Intronic
1130209431 15:81909674-81909696 CCTGACTGTCTTTTTTAAAGAGG + Intergenic
1130454130 15:84087958-84087980 CTGGACTTTATTTTTTAAGATGG - Intergenic
1130796618 15:87216587-87216609 ATGGAGTCTTGTTTTTAAGGTGG - Intergenic
1131205059 15:90437541-90437563 TTGGAATTTCTTTTTTAAAGAGG + Intronic
1135039030 16:19103631-19103653 GTTGACTCTCTTTTTTTAGCGGG - Intergenic
1138315966 16:56070367-56070389 CTGCATTCTTTTTCTTAAGGAGG - Intergenic
1138825814 16:60318425-60318447 CTGTATTCTCTTCTTTAAGATGG + Intergenic
1140196767 16:72861576-72861598 CTGGACTCTGGTTTTCCAGGAGG - Intronic
1140235811 16:73157543-73157565 CTCGACCCCCTTTTTTAAGGAGG - Intergenic
1140852246 16:78946073-78946095 CTGGACTTTCTTAAATAAGGTGG + Intronic
1141427694 16:83954529-83954551 TTGAACTCTCTTTTGTAAGTTGG + Intronic
1141433026 16:83980690-83980712 CTGCACCCTCTTCTGTAAGGCGG + Intronic
1143568102 17:7737450-7737472 CTGGACTTTCTGTTTCTAGGTGG + Intronic
1144302255 17:13932741-13932763 CTGGAATCTCCTTTCTAAGATGG - Intergenic
1149500510 17:57148878-57148900 TTGGACACTCTTTTTTTTGGTGG + Intergenic
1152166158 17:78708259-78708281 CTGGACTGTCTGTTTTATAGAGG - Exonic
1154031752 18:10759172-10759194 CTGGTCTGTCTTTTGAAAGGTGG + Intronic
1155333622 18:24742931-24742953 GTGCACTCTCTGCTTTAAGGAGG - Intergenic
1157365391 18:47059537-47059559 CTTGTCTCTCTTTCTTCAGGAGG + Exonic
1158666566 18:59438143-59438165 CTGGCCTTTCTGTTTTTAGGGGG - Exonic
1159073309 18:63650286-63650308 CAGAACTGTCTTTTTTATGGTGG + Intronic
1159074952 18:63669929-63669951 CAGAACTGTCTTTTTTATGGTGG + Intronic
1160264537 18:77328670-77328692 AGGGTCTCTTTTTTTTAAGGCGG + Intergenic
1163689989 19:18733282-18733304 CTGGAGTCTCTTTTGTGGGGAGG + Intronic
1164377634 19:27702962-27702984 CTTGTTTCTCGTTTTTAAGGTGG + Intergenic
1165733530 19:38161720-38161742 CTTGACTGTCTTTTTTGAGATGG - Intronic
1165946665 19:39447170-39447192 GTGGACCCCCTTTTTTTAGGGGG - Intronic
1166653537 19:44593706-44593728 CTGGGGTCTCTTTTATAAGAGGG - Intergenic
1166656983 19:44619505-44619527 CTGGACTATCTTCTAAAAGGAGG - Intronic
1168345020 19:55646171-55646193 CTGGCCTCTTTTTTTTTAGACGG + Intronic
1168598508 19:57699086-57699108 CTGGCCTCTTTTTTTTGAGACGG + Exonic
925022721 2:584545-584567 CTGGGCTCTGATTTTTAACGTGG + Intergenic
926709325 2:15864807-15864829 CTGTACTCTCTATTTTAATTGGG + Intergenic
927176474 2:20412345-20412367 CTGGACTCTGGTTTTTCAGCTGG + Intergenic
928110112 2:28500567-28500589 AGGGAATCTCTTTTTTATGGAGG - Intronic
928140346 2:28723374-28723396 CTGGCCTTTCTTTTTTTGGGGGG - Intergenic
929593410 2:43161179-43161201 CTGGACTTTTTTTTTTGAGACGG + Intergenic
930379177 2:50605959-50605981 GCTGATTCTCTTTTTTAAGGCGG - Intronic
930788881 2:55302602-55302624 CTGGATTTTCTTTTTTTATGTGG - Intronic
930864391 2:56108409-56108431 CAGCACTCTCTCTTCTAAGGAGG - Intergenic
933806770 2:86003831-86003853 CTGGCATCTCTTTTTTGAGATGG - Intergenic
933878011 2:86638236-86638258 ATGTACTCTTTTTTTTAAGCAGG + Intronic
934612993 2:95754524-95754546 CTGGAGTTTCTTTTTTGAGATGG - Intergenic
935077862 2:99763203-99763225 CTGGAATCTGTGTTTAAAGGGGG - Intronic
937907316 2:127058613-127058635 CTGGCCTCTCTCTCTTAAAGGGG - Intronic
938404859 2:131026045-131026067 CTGGACTCTCTTCTTGCAGGAGG - Intronic
938749737 2:134317271-134317293 CTTGGCTCACTTTTTTAAGCCGG + Intronic
941410280 2:165147266-165147288 CTGGATTGTCTTTTTTTTGGGGG + Intronic
944541523 2:200758059-200758081 CAGGACTTTCTTTTTTGAGACGG - Intergenic
947925343 2:233916433-233916455 TTTGTCTCTCTTTGTTAAGGGGG + Intergenic
1169642099 20:7764065-7764087 TTGGTCTCTCTTTTTTAAGTTGG - Intergenic
1171175030 20:23045425-23045447 TTGGGCTCACTTTTCTAAGGTGG - Intergenic
1173414729 20:42845556-42845578 CTGGACTCTCCTTGTTGAGAGGG + Intronic
1173516732 20:43669596-43669618 CTGGACTCTGCTTTTTCAGCTGG + Intronic
1174818812 20:53710008-53710030 CAGAATTCTATTTTTTAAGGTGG + Intergenic
1177503229 21:21986238-21986260 ATGGAGTCTCTTTCTTAAGGGGG + Intergenic
1179340003 21:40498163-40498185 CTGAACTCTCATTGTGAAGGAGG - Intronic
1182183115 22:28372102-28372124 CTGGACTCTCTTTTTTAAGGCGG - Intronic
1184023194 22:41834237-41834259 CTGGACTCTTTCTTGAAAGGAGG - Intronic
1184489035 22:44798769-44798791 CTGGACTTTTTTTTTTGAGAGGG + Intronic
952097670 3:29973131-29973153 ACAGACTCTCTTATTTAAGGAGG + Intronic
952964504 3:38612771-38612793 CTGGGCTGTCTTTTTAAAAGAGG + Intronic
953138217 3:40202239-40202261 CTGGACTCTTTTTTAAAAGGTGG + Intronic
955581605 3:60429042-60429064 CTGTCCTCTCTTTGGTAAGGTGG - Intronic
956425197 3:69127202-69127224 CTGGACTCTGTTGTGCAAGGAGG + Intergenic
956973055 3:74549547-74549569 CTGGACTTTTTTTTTTAAATGGG + Intergenic
958949934 3:100405600-100405622 CTGGAGTCTCATTTTTATAGGGG + Intronic
959047809 3:101493869-101493891 CTGGACTCTCCCTTTGCAGGTGG - Exonic
959440628 3:106370607-106370629 CTGGATTCACTTTTTAAATGTGG + Intergenic
959766219 3:110032643-110032665 CTGGTTTCTTTTTTTTAAGTTGG - Intergenic
960056894 3:113282331-113282353 TTTGAGTCTCTTTTCTAAGGAGG + Intronic
961191687 3:124967818-124967840 CTGGAGTCTGTTTCTTTAGGCGG - Exonic
966577766 3:181522164-181522186 CTGGTATCTCTTCTTTAAAGGGG + Intergenic
968334449 3:197901141-197901163 CTTGACTCTTTTTTTTGAGATGG + Intronic
968656515 4:1780662-1780684 CGGGACTCTTTTTTTTGAGACGG - Intergenic
969288049 4:6220413-6220435 TTGTACTCACTTTGTTAAGGAGG + Intergenic
971477036 4:27082134-27082156 CTGGATTTTTTTTTTTAATGTGG + Intergenic
971879854 4:32357538-32357560 ATTGTCTCTCTTTTTAAAGGAGG - Intergenic
973233548 4:47870665-47870687 CTAGGCTCTCTGTTTTAATGAGG - Intronic
974845127 4:67342714-67342736 CTGGCCTCTCTTTTTGTATGTGG - Intergenic
974928345 4:68329637-68329659 GTGGACAGTATTTTTTAAGGAGG - Intronic
979466369 4:121043325-121043347 CTGGAATTTCTTTTTTTAGTTGG + Intronic
979679422 4:123443534-123443556 CTTGTTTCTCTTTTTTGAGGGGG - Intergenic
979809801 4:125022268-125022290 CTAGAATCTCCTTTTCAAGGTGG - Intergenic
979812572 4:125056651-125056673 GTGGAATCTCTTTTTTGAGGGGG - Intergenic
980381505 4:132025665-132025687 CTGGACTCTCCTCTTTTAAGAGG - Intergenic
981019979 4:140016063-140016085 CTGGACTCACTAGTTTTAGGAGG - Intronic
981761986 4:148204710-148204732 CTGAATTATCCTTTTTAAGGTGG - Intronic
982642387 4:157979505-157979527 CTGGTCTCTCTTTTATAAAGTGG - Intergenic
983498659 4:168474676-168474698 CTGGACTCTGTCTTTTAACTTGG - Intronic
984228468 4:177064558-177064580 CTTGACTTTCTTTGTAAAGGGGG + Intergenic
990894635 5:60685496-60685518 GTGTACTCTATTTTTTAAAGGGG + Intronic
991720482 5:69491059-69491081 GTGAACTCTCTTTTATAAAGTGG + Intergenic
993501978 5:88675169-88675191 CTGGCCTCTCTTTTTACATGGGG + Intergenic
995300777 5:110578743-110578765 CTGGACTCTCTTTTCTATCGTGG + Intronic
995858292 5:116616060-116616082 CTGGAATCTCCTGTTTCAGGGGG + Intergenic
997976963 5:138446364-138446386 CTGGACCCCCCTTTTTAATGTGG - Exonic
998352730 5:141511897-141511919 GTGGAGTCTCTTGTTTGAGGAGG - Exonic
999165846 5:149548848-149548870 CTGGAGCCTCTTCTTTAAGACGG - Intronic
999727261 5:154446738-154446760 CTGGACCCTCTTGCTGAAGGAGG - Exonic
999985225 5:156997556-156997578 CTGAACTCTCTTATTCTAGGAGG - Intergenic
1001765063 5:174239263-174239285 TTGGAATCTCTTTTTTTATGGGG - Intronic
1002367524 5:178724828-178724850 CTGGACTCTTGTTTTCAGGGTGG + Intronic
1002385972 5:178867633-178867655 CTGGACTCTTGTTTTCAGGGTGG - Intronic
1004529314 6:16438932-16438954 CTGGAATCTCTTGTGTAAGATGG + Intronic
1004895648 6:20145202-20145224 CTGGGGTCTCTTTTGTAAGAGGG - Intronic
1005224561 6:23626615-23626637 CTGGAGTCTCTTTTTTAGAGGGG - Intergenic
1005253588 6:23975406-23975428 CAGGACTCTTTTTTTTATGGGGG + Intergenic
1010055953 6:71563821-71563843 CAGGACTCTTTTTTTTGAGACGG - Intergenic
1010695102 6:78962949-78962971 GTGGAATCTCTTTTTGAATGTGG - Intronic
1010739396 6:79482308-79482330 CTAGACTTTCTTTTTGCAGGGGG + Intergenic
1013784749 6:113767207-113767229 CTGGAGTCCATTGTTTAAGGAGG - Intergenic
1014188457 6:118463002-118463024 CTTAACTCCCTTTTTTATGGGGG + Exonic
1015776998 6:136823884-136823906 ATGGACTCTTTTTTTTGAGACGG - Intronic
1016019193 6:139217996-139218018 CTGGTCTCTCCTTTTAGAGGAGG + Intergenic
1017447865 6:154524508-154524530 CTGGACCTTGCTTTTTAAGGTGG - Intergenic
1018281457 6:162190350-162190372 CTGGACTCTGTTTTCTAAAGTGG - Intronic
1019491763 7:1317432-1317454 CCGGACTCTTTTTTTTTGGGGGG - Intergenic
1021180583 7:17500879-17500901 CTGGCCTCTCTTGTTCCAGGTGG - Intergenic
1022858055 7:34336201-34336223 CTGGACTCTTCTTTTTTGGGAGG - Intergenic
1027465787 7:78513385-78513407 CTGGCCTTTCTTTTTGAAGAGGG - Intronic
1027530874 7:79330515-79330537 AGTGACTCTCTCTTTTAAGGAGG - Intronic
1030186540 7:106767801-106767823 ATGGAGTCTTTTTTTTAAGATGG + Intergenic
1030924669 7:115437447-115437469 CTTGACTCTTTTTTTTGAGACGG + Intergenic
1031667119 7:124498197-124498219 CTGAACTCTTGTTTTTAAAGAGG - Intergenic
1033413881 7:141145443-141145465 CTGGAAACTCTATTTTAAGAGGG + Intronic
1036944298 8:13080233-13080255 CTGGATTTTTTTTTTTAAAGGGG - Intergenic
1037657097 8:20894033-20894055 CTAGAATATCTTCTTTAAGGTGG - Intergenic
1037745732 8:21642678-21642700 CATGGCTCTCTTTTTCAAGGAGG - Intergenic
1038959514 8:32503728-32503750 CTGAACTCTTTCTTCTAAGGAGG - Intronic
1044268365 8:90209978-90210000 ATGAACTTTCTTTTTTATGGTGG - Intergenic
1044876005 8:96667021-96667043 CTAGTCTCTCTTTTTTAATACGG + Intronic
1046307125 8:112383733-112383755 TTGAACTCTCTTTTCCAAGGGGG - Intronic
1046950805 8:120018126-120018148 CTGGCCTCTCTTGGTTCAGGGGG - Intronic
1047114222 8:121822676-121822698 CTTCACTTGCTTTTTTAAGGAGG - Intergenic
1048069883 8:131010178-131010200 ATGGACTTTCTTATTTTAGGAGG + Intronic
1049130905 8:140839677-140839699 CTGGATTCTCTCTTTTTTGGGGG - Intronic
1050065279 9:1753022-1753044 CTGGACTCTCTCTTTTTGGTTGG - Intergenic
1051832106 9:21291199-21291221 CTGGGGTCCCTTTTATAAGGGGG - Intergenic
1051836058 9:21339100-21339122 ATGGGCTCTCTTTATTAATGTGG + Intergenic
1051889558 9:21928230-21928252 CTAGACTGTCCTTTTCAAGGTGG - Intronic
1052647317 9:31253722-31253744 CTTGCCTCTCTTCTATAAGGAGG + Intergenic
1055943658 9:81673638-81673660 CTGTTTTCTCTTTTTCAAGGTGG + Intronic
1058373886 9:104301545-104301567 CTTGAATCTCTTTTTTATGGGGG - Intergenic
1058378095 9:104348250-104348272 CTGGGCTCTATTCTTAAAGGGGG + Intergenic
1058713883 9:107705729-107705751 CTGGCCTCTCTTTTGTGAGAAGG + Intergenic
1060145357 9:121248175-121248197 CTTGACTCTTTTTTTTTAGCAGG + Intronic
1061117165 9:128621244-128621266 CTGGACTCACCTTCTTAATGAGG - Exonic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1061660418 9:132126454-132126476 CTTGAGTTTCTTTTTTAACGTGG + Intergenic
1062138794 9:134944185-134944207 CTGGACTCTCTTTCTTCATGTGG - Intergenic
1185711822 X:2310259-2310281 CTGGCCTCTCTTCATTCAGGAGG + Intronic
1186173370 X:6900696-6900718 CTGTACTTTCTTTTTTAGAGAGG + Intergenic
1187209536 X:17215451-17215473 CTGGGCTCTCTGTTTTGAGTAGG - Intergenic
1189165362 X:38855762-38855784 CTGGGCTCTCTGTTTTTTGGGGG - Intergenic
1191777410 X:64830762-64830784 CTGAGGTCTCTTTTTCAAGGGGG + Intergenic
1198315062 X:135456808-135456830 CTGGAATCTTCTTTTTAATGTGG + Intergenic
1199854404 X:151748457-151748479 CTGTGCTCTCTTTTTTTTGGGGG - Intergenic