ID: 1182185259

View in Genome Browser
Species Human (GRCh38)
Location 22:28395072-28395094
Sequence TGAGTTTCAATTTAAAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 490}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182185253_1182185259 21 Left 1182185253 22:28395028-28395050 CCTCCATACTTTTATCTTTAATT 0: 1
1: 0
2: 7
3: 52
4: 830
Right 1182185259 22:28395072-28395094 TGAGTTTCAATTTAAAAATCTGG 0: 1
1: 0
2: 3
3: 55
4: 490
1182185257_1182185259 -9 Left 1182185257 22:28395058-28395080 CCCAGACAGGAACATGAGTTTCA 0: 1
1: 0
2: 2
3: 12
4: 222
Right 1182185259 22:28395072-28395094 TGAGTTTCAATTTAAAAATCTGG 0: 1
1: 0
2: 3
3: 55
4: 490
1182185254_1182185259 18 Left 1182185254 22:28395031-28395053 CCATACTTTTATCTTTAATTTCA 0: 1
1: 0
2: 7
3: 92
4: 1023
Right 1182185259 22:28395072-28395094 TGAGTTTCAATTTAAAAATCTGG 0: 1
1: 0
2: 3
3: 55
4: 490
1182185256_1182185259 -8 Left 1182185256 22:28395057-28395079 CCCCAGACAGGAACATGAGTTTC 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1182185259 22:28395072-28395094 TGAGTTTCAATTTAAAAATCTGG 0: 1
1: 0
2: 3
3: 55
4: 490
1182185258_1182185259 -10 Left 1182185258 22:28395059-28395081 CCAGACAGGAACATGAGTTTCAA 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1182185259 22:28395072-28395094 TGAGTTTCAATTTAAAAATCTGG 0: 1
1: 0
2: 3
3: 55
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182185259 Original CRISPR TGAGTTTCAATTTAAAAATC TGG Intronic
901882969 1:12204729-12204751 GGCGTTTACATTTAAAAATCTGG - Intronic
901953426 1:12767112-12767134 TGAGGTTCCATCTAAAAATTTGG + Intergenic
903027291 1:20438432-20438454 TGAGATACCATTTAAAAATTGGG + Intergenic
903755109 1:25655216-25655238 TGAGTTTCAACTACAAAATGTGG + Intronic
904706845 1:32397380-32397402 TGAGGTTCCATTTACAAATGTGG - Intergenic
905158869 1:36013668-36013690 GGAGTTTCAATTTAAAGTTCGGG + Exonic
905292924 1:36935284-36935306 TTAATTTCAATTTAAACATCTGG + Intronic
905332559 1:37216381-37216403 GGAACTTCAATTTAAAAATAAGG + Intergenic
905937991 1:41839952-41839974 TGAGATACAATTTAAAACCCAGG + Intronic
905938518 1:41843987-41844009 TCACTGTGAATTTAAAAATCAGG - Intronic
908071987 1:60471022-60471044 TGAGTTGCCATTTAACAAACTGG - Intergenic
908129803 1:61063906-61063928 CCAGTCTCAATTTAAAAATAGGG - Intronic
909193022 1:72578402-72578424 TTAGTTTCAATTAGAAAATCAGG - Intergenic
909593168 1:77375092-77375114 TTAGTTTCACTTTATAAATGAGG + Intronic
909625843 1:77715181-77715203 TTAGGTTTAATTTAAAAATTAGG - Intronic
909832484 1:80210173-80210195 TAATTTTCAATGTAAAACTCTGG + Intergenic
910566751 1:88652280-88652302 TTAGTTTCAATTTACAAATCAGG - Intergenic
910699260 1:90054881-90054903 TAATTTTCAATTTAGAAAGCTGG + Intergenic
910963631 1:92786167-92786189 TAAATTTAAATTTAAAAATAGGG - Intronic
911202420 1:95058968-95058990 TGACTTTCAATTCACAAATAAGG + Intronic
911803536 1:102175653-102175675 TAAGTGTAAATTTAAAGATCTGG - Intergenic
912493442 1:110075917-110075939 TAAGTTTGAATCTGAAAATCTGG + Intergenic
914989230 1:152484124-152484146 TGAATTTATATTTTAAAATCTGG + Intergenic
915718957 1:157969817-157969839 TGAGCCTCAATTTAATAATCTGG - Intergenic
916145652 1:161736674-161736696 ATAGTTTCAATTTCTAAATCAGG - Intergenic
916155022 1:161836383-161836405 TTAGATTTCATTTAAAAATCTGG - Intronic
916772824 1:167929452-167929474 TGAGTTTCACTTTAAAAATAAGG - Intronic
916982749 1:170155907-170155929 TGTCTTTCAATATAAAAATTTGG - Intronic
917165574 1:172108728-172108750 TGAGGTTCAATTATAAAACCAGG - Intronic
917257952 1:173136553-173136575 TGAGCTTCACTTTAAAACTTTGG + Intergenic
917935930 1:179867037-179867059 TGAGTTAAAATATAAAGATCTGG + Intronic
918438485 1:184541787-184541809 TGTGTTTTCATTTAATAATCTGG + Intronic
918487942 1:185048956-185048978 TGCCTTTAAATTTAAGAATCTGG + Intronic
918781065 1:188701640-188701662 TGAGATTAAATCTAAACATCTGG - Intergenic
918938983 1:190965125-190965147 TGAATTTCATTTTAAAACTTAGG + Intergenic
919073852 1:192790359-192790381 AGAGTTTCATATTAAAAATCAGG + Intergenic
920001160 1:202799948-202799970 TTAGGTTCAATTTAAAAATTAGG - Intronic
920516264 1:206586571-206586593 TGAGTTTCAAAATAAAAACATGG + Intronic
920629807 1:207640881-207640903 TGAATTTCAATTTAAAATCATGG + Intergenic
921513307 1:216059242-216059264 TGAGTTTAAGTTCCAAAATCAGG + Intronic
921672680 1:217944050-217944072 TTAGTTTCAATTAAATAATTGGG - Intergenic
922359334 1:224807115-224807137 TAACTTACAATTTAGAAATCTGG - Intergenic
922979404 1:229812925-229812947 TAAGTTTTTATTTAAAAATAAGG + Intergenic
923508778 1:234630901-234630923 TGGATTTCTTTTTAAAAATCTGG + Intergenic
923940878 1:238825125-238825147 AGAGTTGCTAATTAAAAATCAGG - Intergenic
924241148 1:242041869-242041891 TGGGCTTCAATGTATAAATCTGG + Intergenic
924733775 1:246736389-246736411 TGAATTCCCTTTTAAAAATCAGG + Intronic
924864422 1:247961898-247961920 TGAGTCAAAAGTTAAAAATCGGG - Intronic
1063495074 10:6499679-6499701 TGAGGTTTCATTTAAAAAGCAGG + Intronic
1063735210 10:8746122-8746144 CAATTTTCAATCTAAAAATCTGG - Intergenic
1063931768 10:11035713-11035735 TGGGTATAAATGTAAAAATCAGG - Intronic
1064018267 10:11789539-11789561 TTAGTGTCAATAAAAAAATCTGG + Intergenic
1064497412 10:15927297-15927319 TGCGTTTGAATGTAATAATCTGG + Intergenic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1064626249 10:17264516-17264538 TGATATTCAATTTAAAATTATGG - Intergenic
1064687347 10:17876699-17876721 TAATTTTTAATTTAAAAATCTGG + Intronic
1065631562 10:27686035-27686057 TGAGTTTTACTTTAAAACTTTGG + Intronic
1065671656 10:28125908-28125930 TGACTTTCCTTTTAAGAATCTGG + Intronic
1067977878 10:51046470-51046492 TTAGTATCAATATGAAAATCAGG + Intronic
1068039963 10:51811363-51811385 TTTGATCCAATTTAAAAATCTGG + Intronic
1068619016 10:59157042-59157064 TGAGTTTCAAGCTGAAATTCAGG + Intergenic
1068878974 10:62028579-62028601 TGATTGTCAATTTAGAAATGAGG - Intronic
1068951044 10:62777719-62777741 TCAGTGACATTTTAAAAATCAGG + Intergenic
1069292686 10:66802038-66802060 TGAGGTTCATTTAAAAAATATGG - Intronic
1069303197 10:66934556-66934578 TGATTTGCAATTGAAAAAACAGG + Intronic
1070358647 10:75664969-75664991 TGAGTCTCAATTTCCACATCTGG - Intronic
1070388081 10:75944938-75944960 TGAGTCTTAATTACAAAATCTGG + Intronic
1070480375 10:76876698-76876720 TGAGTTTTTGTTTAAAAACCAGG - Intronic
1070845265 10:79517394-79517416 TGGGTTTTATTTAAAAAATCAGG - Intergenic
1070928531 10:80242915-80242937 TGGGTTTTATTTAAAAAATCAGG + Intergenic
1071801233 10:89063777-89063799 TGAATTTAAATTTACAAACCAGG - Intergenic
1072047732 10:91673429-91673451 TGAGCTTCAACTTAGAAAACTGG - Intergenic
1072281100 10:93866151-93866173 CCAGTTTCACTTGAAAAATCTGG + Intergenic
1072633108 10:97160441-97160463 TGGGTGTCATTTTAAAAATCAGG + Intronic
1073367312 10:102953955-102953977 TTAGTTCCAATTTATAAGTCAGG + Intronic
1073573849 10:104604500-104604522 TGAGTTTCACTATAAGAATTCGG - Intergenic
1073896787 10:108170220-108170242 TGAGTTTAAATTTATGAATAAGG - Intergenic
1074201045 10:111235495-111235517 GGAGTTTCCATTTACAAATGTGG - Intergenic
1074647835 10:115483576-115483598 TGAGTTACAATTTGTAAATTAGG - Intronic
1075241871 10:120786541-120786563 GGACTTTCAGTTTTAAAATCAGG - Intergenic
1075408342 10:122209609-122209631 AGAGTTTCACTTTTAAAATAAGG - Intronic
1075769560 10:124921885-124921907 TAAGTTTGAATTTTAAAATGGGG + Intergenic
1075905846 10:126081351-126081373 TCAGTTTAAACTGAAAAATCTGG - Intronic
1075959525 10:126556542-126556564 TGAATTTCATTTTCAGAATCAGG - Intronic
1076442551 10:130490206-130490228 TTTCTTTCAATTTGAAAATCAGG + Intergenic
1076714261 10:132355336-132355358 TGAATTTCACTTTTAAAAACAGG - Intronic
1077990469 11:7405672-7405694 TGAGTGAAAATTTAAAAATCTGG + Intronic
1079644970 11:22851803-22851825 TGAGCTTTAATTAAAAACTCTGG + Intronic
1079767515 11:24413903-24413925 TGATCTTCAAATTAAAAATGTGG + Intergenic
1080081908 11:28230736-28230758 TCAGTTTTACTTTAAATATCAGG - Intronic
1080347293 11:31339219-31339241 TAAGTTTCAACTTAGAAATTTGG - Intronic
1080487181 11:32721327-32721349 TGATATTCATTTTAAATATCAGG + Intronic
1081189864 11:40090489-40090511 TGAGCTTCAATTTAAAGATGAGG + Intergenic
1082555136 11:54555329-54555351 TGATTTTTCATTTAAAAATTGGG - Intergenic
1083969014 11:66061163-66061185 TGAGATGGAATTTAAAAATGAGG + Intronic
1084584919 11:70053342-70053364 TGTGTTTCAATTCCAACATCAGG + Intergenic
1084618900 11:70255009-70255031 TCAGTTTCATTTTTAAAATGAGG + Intergenic
1085286087 11:75362363-75362385 TGAGAATAAATTTTAAAATCAGG - Intergenic
1085357316 11:75850282-75850304 TCAATTTCAATTGGAAAATCAGG + Intronic
1085995868 11:81913312-81913334 TGATTTTCAAATTACAAATCTGG + Intergenic
1086383398 11:86283345-86283367 AGAGTTGCAATTTTAAAATAAGG - Intergenic
1087249765 11:95884738-95884760 TTAGTATCATTTAAAAAATCTGG - Intronic
1087324458 11:96704143-96704165 TGAATTTCATTTGAAAAATGAGG - Intergenic
1087386353 11:97473557-97473579 TGAGTTTGACTTTTAAAATTTGG - Intergenic
1087477367 11:98653074-98653096 GGAGTGACCATTTAAAAATCAGG + Intergenic
1087491466 11:98832623-98832645 TGAGTATCAATAAAAATATCAGG - Intergenic
1087751820 11:102014554-102014576 TGGGTTTCAGTTTAAAAATAGGG - Intergenic
1088530134 11:110799489-110799511 TAATTTTTAATTTATAAATCAGG + Intergenic
1090248072 11:125231026-125231048 GGAGTTTTATTTTAAAGATCTGG + Intronic
1091140620 11:133231379-133231401 TGACTTTCAATTCAAAAAGAGGG + Intronic
1092121220 12:6045305-6045327 AGAGTTTCCATATAAAAATAAGG - Intronic
1094352845 12:29545785-29545807 TCACTTTCAATTTGAAACTCAGG - Intronic
1095313650 12:40731091-40731113 AAAGTTTAAATTTAAAAATTGGG + Intronic
1095644413 12:44526395-44526417 TGATTCTCACTTTATAAATCAGG + Intronic
1095675773 12:44916427-44916449 TGATTTCCATTTTAAAAATGTGG - Intronic
1095838598 12:46666773-46666795 TAAGCTACAATTTAAAAATGTGG + Intergenic
1096037109 12:48482210-48482232 TTACTTTGAATTTCAAAATCAGG - Intergenic
1096248303 12:50009394-50009416 TTATTTAAAATTTAAAAATCAGG + Intronic
1096325718 12:50659287-50659309 AGAGTTTAAATTTAAAAAAGAGG + Intronic
1097329161 12:58314520-58314542 TGAGCTTCCATTTAATAATTGGG - Intergenic
1097566454 12:61275583-61275605 TGAGGTTCAATTTTCTAATCTGG + Intergenic
1097951589 12:65435168-65435190 TGGGCTTCAAATTACAAATCAGG - Intronic
1098410729 12:70180720-70180742 TGAGTTTGAATTTAAAATATGGG - Intergenic
1098566527 12:71943465-71943487 TGATTTAATATTTAAAAATCAGG - Intronic
1098687799 12:73447163-73447185 GGTGTTTTAATTTAAATATCAGG - Intergenic
1098813242 12:75123164-75123186 TAAGTTTCAGCTTCAAAATCAGG + Intronic
1098828432 12:75329719-75329741 TAAGTTTCAATTCAGATATCTGG - Intronic
1099080345 12:78171071-78171093 TGAATTTCAATTTAAATTTTAGG + Intronic
1099852449 12:88118884-88118906 TGGGTTACAGTTTAAATATCTGG - Intronic
1100875030 12:98952739-98952761 TGAGTTTGGATTTAGATATCTGG - Intronic
1100952957 12:99873032-99873054 TGTGTTTCAATTTCCATATCTGG + Intronic
1101015199 12:100493301-100493323 TGCATTTCAATTGAAAAATTTGG + Intronic
1102052093 12:109870049-109870071 TGAGCCTCATTTTAAAAATGAGG - Intronic
1102182899 12:110925703-110925725 TAATTTTTAGTTTAAAAATCAGG - Intergenic
1105581841 13:21705522-21705544 TTAATTTTAATTTAAAAATTTGG + Intergenic
1105759538 13:23501260-23501282 TGAGTTACTATATAAAAATTAGG + Intergenic
1106527050 13:30550138-30550160 TGAGTTTCAATTTAATGTTAAGG - Intronic
1106541471 13:30694558-30694580 TGAGTTTTAATTTTAAAACTTGG + Intergenic
1107610251 13:42105965-42105987 TAAGTTCCAAGGTAAAAATCAGG - Intronic
1107785474 13:43952353-43952375 TAAGTTTCAATATACAAATCTGG + Intergenic
1108018632 13:46101932-46101954 TTATTTTGAATTTAAAAAGCTGG + Intronic
1108713002 13:53052745-53052767 TGAGATACAAGTTAAAAACCAGG + Intergenic
1108757369 13:53520196-53520218 TGACTTTCAATTTAAAATCCAGG - Intergenic
1108846427 13:54683518-54683540 TCAGTTTGAATCTAAATATCTGG + Intergenic
1109782443 13:67129431-67129453 TGTGTTTCAAACTAATAATCTGG + Intronic
1109975479 13:69826738-69826760 TATTTTTCAATTTAAAAATAAGG - Intronic
1110091715 13:71457966-71457988 TGTGTTTGAATTTCATAATCTGG - Intronic
1110146481 13:72197661-72197683 TGAATTTTAATGTAAAAATTAGG + Intergenic
1110250913 13:73379545-73379567 TGAGTTTCCCTTCAAAATTCAGG - Intergenic
1110927466 13:81173048-81173070 TGAGGTTCAATGTAAGAATCAGG + Intergenic
1110927940 13:81179624-81179646 TGAGGTTAAAATAAAAAATCAGG + Intergenic
1112649776 13:101382482-101382504 TAAATTTAAATTTAAAAATTGGG + Intronic
1113008315 13:105733926-105733948 TGGTTTTCAATTTTAAAAGCCGG - Intergenic
1113016931 13:105838276-105838298 TCAATTTCATTTTAAAAAGCGGG + Intergenic
1113135800 13:107087558-107087580 GTAGTTTCTATTTAAACATCAGG - Intergenic
1114365615 14:22024507-22024529 TGATCTTCAAATTAAAAAGCTGG - Intergenic
1114850311 14:26375461-26375483 TAAATTTAAATTTAAAAATAGGG + Intergenic
1115659961 14:35483954-35483976 TAAGTTTCTTTTTAAAACTCTGG + Intergenic
1115671308 14:35615296-35615318 TGATTTGAAATTTAAAACTCTGG + Intronic
1115858252 14:37654970-37654992 TTAGTATCAATTTAGAAATAAGG - Intronic
1116216574 14:42024678-42024700 TGGGTTTCAACATATAAATCTGG + Intergenic
1116595160 14:46832484-46832506 TGAGATTCAAATGAAATATCTGG + Intergenic
1117575993 14:57098530-57098552 TGTGTTTCAAGTTAATAATAAGG + Intergenic
1118426575 14:65670889-65670911 TGAGTTAAAAATAAAAAATCGGG - Intronic
1118525565 14:66637294-66637316 TAACTTGAAATTTAAAAATCCGG - Intronic
1118790887 14:69091730-69091752 TGTGTTTCAGTTTGACAATCAGG - Exonic
1119605354 14:76011337-76011359 TGATTTCCAGTTTACAAATCAGG - Intronic
1120076186 14:80161064-80161086 TGAATTCCAATTTATAAATGAGG - Intergenic
1121943851 14:98099827-98099849 TGAGTTTCAATTTACTAATAAGG - Intergenic
1122471957 14:101974618-101974640 TGATTTTTAATTTAGAAATTTGG + Intronic
1123802828 15:23839309-23839331 TCTGTTTCAATTTAAAAGTGGGG - Intergenic
1124050597 15:26194017-26194039 TCATTTGCAATTTTAAAATCAGG - Intergenic
1124354198 15:28983286-28983308 TGAATTTCATTTTCAAAATCAGG - Intronic
1125989450 15:44092031-44092053 TGCTTTTTAAATTAAAAATCGGG - Intronic
1126119221 15:45236454-45236476 TGGGTTTAAATTTATTAATCTGG + Intergenic
1126354207 15:47777727-47777749 TGACAGTCAATTCAAAAATCAGG + Intergenic
1126652392 15:50937878-50937900 TGAGTTTGGATTTGTAAATCCGG + Intronic
1126910164 15:53409213-53409235 TTTGTTTTAATTTAAAAGTCAGG - Intergenic
1126950770 15:53878399-53878421 TGACTCTCTATTTCAAAATCTGG - Intergenic
1127342644 15:58064373-58064395 TGAGTTTTAGGTTACAAATCAGG - Intronic
1127780981 15:62315311-62315333 TTAGTTTTTATTTAAAAATCTGG - Intergenic
1127905161 15:63371007-63371029 TGAATTGCAATATAAAAAGCAGG - Intronic
1128093245 15:64933256-64933278 GGACTTTCCATTTTAAAATCAGG - Intronic
1128100515 15:64995219-64995241 TGAGTAGCTATTTAAAATTCTGG + Intergenic
1128470197 15:67945323-67945345 TCAGTTTCAACTCAAAAATAGGG - Intergenic
1129137554 15:73568304-73568326 TGCCTTAAAATTTAAAAATCAGG + Intronic
1130067523 15:80616863-80616885 TGACTTTAATTTTAAAAATATGG + Intergenic
1130415260 15:83687886-83687908 TGATTTTTAGTTTAAAAAACTGG - Intronic
1131609099 15:93941990-93942012 TCAGCTTCCATTTATAAATCTGG - Intergenic
1133483335 16:6193698-6193720 TGAGAATCAAGGTAAAAATCAGG - Intronic
1138561645 16:57804106-57804128 TTATTATTAATTTAAAAATCTGG - Intronic
1138669227 16:58599540-58599562 TTCCTTTTAATTTAAAAATCTGG - Intronic
1139287245 16:65826601-65826623 TTAATTTCTATTTAAAAATTAGG + Intergenic
1139384125 16:66553182-66553204 TGATTTTTAATTTAAAAAAAGGG - Intronic
1141758153 16:86008569-86008591 TGAGTTTCAATCTACCAATCTGG + Intergenic
1144260252 17:13511767-13511789 TTAATTACAATTTAAAAATTAGG + Intronic
1146102015 17:29991884-29991906 TGATTTACAACTTAAAAAACAGG - Intronic
1146144115 17:30395954-30395976 TGAACTTGAATTTAAAAATTAGG + Intronic
1146510054 17:33439193-33439215 TGACTTTCAATTTAGACACCTGG + Intronic
1147348148 17:39818302-39818324 AAAGTTTTAATTTATAAATCTGG + Intronic
1147655210 17:42086089-42086111 TAAATTTAAATTTAAAAAACCGG + Intergenic
1148367265 17:47065009-47065031 TTAGTTTAAATTTTAAGATCTGG - Intergenic
1149275703 17:55032937-55032959 TGAGTTCATATTTAAGAATCGGG - Intronic
1150021449 17:61618319-61618341 TGAGATTCATTTTGAAATTCTGG + Intergenic
1151861804 17:76769513-76769535 TGAGTTTCAATATGTGAATCTGG + Intronic
1152456508 17:80419968-80419990 ACATTTTCAAATTAAAAATCTGG - Intronic
1153817431 18:8802819-8802841 TCAGTTTCAACTCAAAAATCTGG - Intronic
1153906290 18:9664563-9664585 AGAGTTTCAATTTAGAAACATGG - Intergenic
1154140370 18:11818273-11818295 TGAATATCAAGTTAAAAGTCTGG - Intronic
1154944106 18:21144456-21144478 AGTGCTTCAGTTTAAAAATCTGG - Intergenic
1154998701 18:21665861-21665883 TGAGCTACAATTTAAAATTTTGG - Intronic
1155215564 18:23640590-23640612 TCAGTTTAAATTTTAGAATCAGG - Intronic
1155407326 18:25503343-25503365 TATGTATCAATTTAAACATCGGG + Intergenic
1156331183 18:36125022-36125044 TGAGCTTTAATTTCAAAATGGGG + Intronic
1156361490 18:36388226-36388248 TCTGGTTCAATTTAAGAATCAGG - Intronic
1157346990 18:46847278-46847300 TGAATTTCATTTTTAAAATCTGG + Intronic
1157740227 18:50086193-50086215 TAAGTTTATTTTTAAAAATCTGG - Intronic
1157889016 18:51396782-51396804 TGAGTATCTTTTGAAAAATCAGG + Intergenic
1158586134 18:58737030-58737052 TGAGTTTCAATTAAGTAATCTGG - Intronic
1158814796 18:61082840-61082862 TGCATATCAACTTAAAAATCTGG - Intergenic
1159314052 18:66748207-66748229 TGAATTTCAATTTAATACTTGGG - Intergenic
1159598194 18:70403620-70403642 TAACTTTCAATTTGAAAAGCAGG - Intergenic
1159645924 18:70917785-70917807 TAGGTTTAGATTTAAAAATCTGG + Intergenic
1159910948 18:74146106-74146128 TGTGCTTCATTTTAAATATCTGG + Intronic
1161496120 19:4586809-4586831 CTAATTTCAATTTATAAATCAGG - Intergenic
1161715098 19:5871617-5871639 GGAATTACAATTTAAAAATAAGG + Intronic
1164796830 19:31040339-31040361 TGAGACAAAATTTAAAAATCTGG + Intergenic
1165081415 19:33309078-33309100 TGAGTCAAAATTTAAAAATCAGG + Intergenic
1165532305 19:36414203-36414225 TAATTTTCAATTTAAAAATTTGG + Intronic
1166041898 19:40208502-40208524 TGAGTTTAAATTTTAAAAACAGG - Intronic
1166623350 19:44325517-44325539 TGAGCATCAATTTATAAAACTGG + Intergenic
1168435527 19:56314345-56314367 TGGGTTTCCAATCAAAAATCGGG + Intronic
925699505 2:6620476-6620498 TGATATTAAATTTAAAAATTTGG + Intergenic
926521091 2:13914886-13914908 TTAGTTTAAATTTATAAATTTGG - Intergenic
926550774 2:14298574-14298596 TGAGGGTCAATTTAAAGATTTGG + Intergenic
927943701 2:27121983-27122005 TGAGTTTTAATTTATAAAGGTGG + Intergenic
928260366 2:29761223-29761245 TGAGGTTCCATTTATAAATTTGG + Intronic
928367021 2:30710618-30710640 TGATTTTCATTTGGAAAATCAGG + Intergenic
928966890 2:36985322-36985344 TCAGTTTTAATTTTAAAAACAGG + Intronic
929130286 2:38561169-38561191 TTAGTTTTAATTTATAAATGAGG - Intergenic
929183430 2:39068131-39068153 TGGGTTTGTATTTAAAAATGTGG + Intronic
930413870 2:51064319-51064341 GGAATCACAATTTAAAAATCTGG - Intergenic
930903627 2:56538852-56538874 AAAGTTTCACTTTAAACATCAGG + Intergenic
931002164 2:57797220-57797242 TGAAATAAAATTTAAAAATCTGG + Intergenic
933220966 2:79687580-79687602 TGATTTTCATTTGAAATATCCGG - Intronic
933440542 2:82307803-82307825 TTGGGTTAAATTTAAAAATCTGG + Intergenic
936389687 2:112059962-112059984 TGTTTTTCATTTTAGAAATCAGG + Exonic
936398188 2:112145698-112145720 TGAGTTACTTTTTAAAAATGAGG + Intronic
936614198 2:114032222-114032244 TGAGTTACAATATAAAAATATGG + Intergenic
937000486 2:118461682-118461704 TGAGTGTTTTTTTAAAAATCAGG - Intergenic
937231022 2:120398318-120398340 TACTTTGCAATTTAAAAATCAGG - Intergenic
938524686 2:132118211-132118233 TGTGTTTGATTTTAAAATTCTGG - Intergenic
938784220 2:134610443-134610465 TGAGTTTCAATTTAGTGGTCTGG + Intronic
938787399 2:134644483-134644505 TGCGATTCAATTTAAAAAGGTGG + Intronic
939044275 2:137231602-137231624 AGAGCTTCAAATTAATAATCAGG + Intronic
939064006 2:137460229-137460251 TGAGTCTCCATTTCATAATCTGG + Intronic
939491263 2:142879819-142879841 TGAGTATCATTTTTAAAATAAGG + Intronic
939711431 2:145525266-145525288 TGAGTATCAACTTAAATATGAGG - Intergenic
939827164 2:147028582-147028604 TGAGTTTAGTTTTACAAATCAGG - Intergenic
940187917 2:151007319-151007341 TGCATTTCCATATAAAAATCTGG + Intronic
940671664 2:156677094-156677116 TCAATTTCAATTTAAATAGCTGG + Intergenic
941289443 2:163657389-163657411 TGAATTCCAATGAAAAAATCTGG + Intronic
941646138 2:168043367-168043389 TTATTTTCAATTTAAAAATTAGG - Intronic
942301868 2:174570819-174570841 TGAGATTCAATTTTAAAAGTGGG + Intronic
942356492 2:175118163-175118185 TGTGTCTAAATTTAAAAAGCAGG + Intronic
942378586 2:175362821-175362843 TGAGCTTCAAATTTTAAATCTGG + Intergenic
942809762 2:179984214-179984236 TGAGGTTGCATTTAAACATCTGG - Intronic
943558117 2:189429724-189429746 TTAGTTGCAATTTATCAATCAGG + Intergenic
943969739 2:194388477-194388499 TGTATTTCAATTTAAAGAGCAGG + Intergenic
944533511 2:200687076-200687098 TGAGATTCAATATCAGAATCTGG - Intergenic
945178847 2:207070915-207070937 TTAGTTGTAATTTAAAAATAAGG + Intergenic
945305871 2:208258147-208258169 TGATTTTCCACTGAAAAATCTGG + Intronic
945356110 2:208841558-208841580 TGTGTTTAATTTTAAAAATTTGG + Intronic
945402318 2:209399241-209399263 TAAGTTTCTATATAAAAATATGG - Intergenic
946865116 2:224035720-224035742 TGAGTTAATATTTAGAAATCTGG - Intronic
947933057 2:233980109-233980131 TGAGTGGACATTTAAAAATCTGG + Intronic
1169074646 20:2753090-2753112 TGAGTTTCAGTGTCCAAATCAGG + Intronic
1169725356 20:8723401-8723423 TGAGTTTCTTTTAAAAATTCTGG - Intronic
1169959196 20:11139823-11139845 TGTGTTTCAAGTTAAAAAACAGG - Intergenic
1170655783 20:18286936-18286958 GGAGTTTCCATCTAGAAATCTGG - Intergenic
1170692718 20:18629607-18629629 TATGTTCCACTTTAAAAATCTGG - Intronic
1171371076 20:24662305-24662327 TACTCTTCAATTTAAAAATCGGG + Intronic
1172831810 20:37842353-37842375 GGAGTTGCATTTTAAATATCTGG + Exonic
1173588771 20:44207831-44207853 TCTGTTTAAATATAAAAATCAGG - Intronic
1175562972 20:59947559-59947581 CCAGCTTCAATTTAAAAAGCTGG - Exonic
1177315278 21:19452459-19452481 TGAGTTGCAAACTAAAAGTCTGG - Intergenic
1177743285 21:25179506-25179528 TGACTTTCAAACTAAAAATGTGG + Intergenic
1177973005 21:27813635-27813657 TGAGTTTAAATATAAAAACCTGG + Intergenic
1178684079 21:34697677-34697699 GGATTTTCAGTTTTAAAATCAGG + Intronic
1180524444 22:16242024-16242046 AGAGAGTCTATTTAAAAATCTGG - Intergenic
1181575864 22:23794241-23794263 AGTGTTTCAATACAAAAATCAGG - Intronic
1182185259 22:28395072-28395094 TGAGTTTCAATTTAAAAATCTGG + Intronic
1182773284 22:32811490-32811512 TGAGTTTCAATTCAAAATCGTGG + Intronic
1183141562 22:35945998-35946020 TGATTTTTAATTTAAAAAAAAGG - Intronic
1183806165 22:40212952-40212974 TGAAATTCAATTTAAAAATTAGG - Intronic
1184315033 22:43680637-43680659 TAATTTTCAGTATAAAAATCTGG + Intronic
949260024 3:2095399-2095421 TGAGTTTATATTTTAAAATCAGG + Intergenic
949267800 3:2180152-2180174 TGAGTTTCAATTTCCTAATCTGG + Intronic
949954930 3:9259820-9259842 TGAGTTTAAATCTAAATAGCTGG + Intronic
950243870 3:11397140-11397162 TGCATATAAATTTAAAAATCTGG - Intronic
951341104 3:21488302-21488324 TTAGATTCAATTTAAAACCCTGG - Intronic
951721810 3:25707599-25707621 TGTTTGTCCATTTAAAAATCAGG + Intergenic
951781166 3:26364297-26364319 TCAGTTTCAGTGGAAAAATCAGG - Intergenic
951926242 3:27911731-27911753 TGAATGTGAAGTTAAAAATCTGG + Intergenic
952055879 3:29445077-29445099 TCAGTTACCACTTAAAAATCTGG - Intronic
952606365 3:35151805-35151827 TCAGTTTTAGTTTAAATATCTGG - Intergenic
952909847 3:38174274-38174296 TGACTTTCGTTTTAAAACTCAGG + Intronic
953528944 3:43721307-43721329 AGGGTTTCATTTTAAAAATTGGG - Intronic
953633913 3:44645541-44645563 TAAGTTTCAAATTCAAAAGCTGG - Intronic
953649432 3:44787508-44787530 GGAGTCTCAATTTAAACAGCTGG - Intronic
953740741 3:45536697-45536719 TGCTTTTCAATTTAAAAATTAGG - Intronic
954386767 3:50248245-50248267 TGTGTTTCAAAAAAAAAATCTGG + Intronic
955167976 3:56533937-56533959 TCATTTTCAAATTAAAAATGTGG - Intergenic
955451741 3:59075893-59075915 TCAGTTTCTCTTTAAAAATGGGG - Intergenic
955820288 3:62889373-62889395 TGAGTTTCAAATCAAAATTTTGG - Intergenic
955878525 3:63519834-63519856 TGAGATTTATTTTAAAAATTAGG + Intronic
956145272 3:66185612-66185634 TGAAGTTCAGGTTAAAAATCAGG - Intronic
956932934 3:74066325-74066347 TGATTTTAATTTTAAAATTCAGG + Intergenic
957003651 3:74917507-74917529 TAAATTTTAATTTAAAAATAAGG + Intergenic
957072451 3:75577661-75577683 TGATTTTCAAATTTAAAATTTGG - Intergenic
957941779 3:87015178-87015200 TGAGTTTAAATATATAAATCTGG - Intergenic
958127892 3:89381359-89381381 TGGGTTTCAATGTATAAATGTGG - Intronic
958530523 3:95324326-95324348 TGAATATCATTTTAAAAATAGGG + Intergenic
958900001 3:99874759-99874781 TGTGTTTCAATGATAAAATCTGG + Intronic
959427949 3:106216583-106216605 GGAGTTTCTATTAAAATATCAGG + Intergenic
960104277 3:113777196-113777218 TGATATACAATTTAAAAAACAGG - Intronic
960831474 3:121853985-121854007 TAAGTTTAATTTTTAAAATCTGG - Intronic
960894178 3:122484218-122484240 TGAGTTTCCAGCTTAAAATCTGG - Intronic
963024681 3:140907798-140907820 TGAGCTTCAATTTCCATATCTGG - Intergenic
963324590 3:143848265-143848287 TGAGTATCAGTTTCAACATCAGG - Exonic
963645907 3:147914163-147914185 GGACATTTAATTTAAAAATCTGG + Intergenic
964357599 3:155864877-155864899 TTACTTTCAGTTTAGAAATCTGG + Intergenic
964631781 3:158818216-158818238 TATGTGTCAATTTAAAAATTAGG - Intronic
965576784 3:170225430-170225452 GGATTTTCTATTTTAAAATCAGG - Intronic
966553528 3:181231834-181231856 TGATTTTCAATTAAAAAATATGG - Intergenic
967487407 3:190049328-190049350 TGAGCTACAATTTAAGCATCTGG - Intronic
967670662 3:192231298-192231320 TAAGCTAAAATTTAAAAATCAGG + Intronic
967683211 3:192389505-192389527 TTAGTTTCTGTTTTAAAATCTGG - Intronic
968013728 3:195306373-195306395 TGAGTTTTATTTTTAAAATCTGG - Intronic
968857339 4:3136669-3136691 TGAGTTTCTTGTTCAAAATCAGG + Intronic
970388283 4:15579151-15579173 TGAGTTACTTTTTAAAAGTCTGG + Intronic
970482541 4:16491676-16491698 TGATATTCACTTAAAAAATCAGG + Intergenic
970600694 4:17639141-17639163 GGACTTTCAATTTGAAAACCAGG + Intronic
971834176 4:31740666-31740688 TGAGTGAAAATTTACAAATCAGG - Intergenic
971951812 4:33360160-33360182 TGAGTGTCAATTTGAAAGTGGGG - Intergenic
972244396 4:37229397-37229419 AGAATTTCAATTAAAAAGTCAGG - Intergenic
972728601 4:41770158-41770180 TAATATTAAATTTAAAAATCAGG + Intergenic
972912517 4:43835366-43835388 AGAGTTTTAATTTGCAAATCAGG + Intergenic
973615216 4:52671342-52671364 GGAGTTTCAATTTATAAATAGGG + Intergenic
973974738 4:56251456-56251478 TCACTTTCAATATAAAATTCTGG - Intronic
974314854 4:60266280-60266302 TGAGTTTACATTTAAAATACTGG + Intergenic
975001654 4:69231195-69231217 TTAGTTTTAAGTTAGAAATCAGG + Intergenic
975146960 4:70978858-70978880 TGTGTTTCATTTTAGAAATGTGG + Intronic
976568368 4:86578860-86578882 AGATTTTCTGTTTAAAAATCTGG + Intronic
976601217 4:86939236-86939258 TCATTTTCCATTTTAAAATCAGG + Intronic
977666085 4:99649203-99649225 TGAATTTCACTTTGATAATCAGG - Intronic
977869527 4:102074001-102074023 TGAGTTTCATTATAATAACCTGG - Exonic
978299807 4:107255068-107255090 TAATTTTGAATTTAAAAATGTGG + Intronic
978366546 4:107989312-107989334 TGAGTTACAATGCAAAAATCAGG - Intergenic
979287660 4:118944301-118944323 TGAGTTTCAATTTTAGCACCAGG - Intronic
979656390 4:123199264-123199286 TTATTTTATATTTAAAAATCAGG - Intronic
979875573 4:125886609-125886631 TGATTTTTAAATTAAAAATGAGG + Intergenic
980349989 4:131671624-131671646 AGAATTTCAATTTGAATATCCGG - Intergenic
980657073 4:135803044-135803066 TAAGTTTCATTTTAAAGATTAGG - Intergenic
980675640 4:136075847-136075869 TAAGATGCAATCTAAAAATCTGG + Intergenic
980727028 4:136776241-136776263 TGGATTTCAATTTAAAAAATTGG - Intergenic
981145785 4:141322486-141322508 GAAGTTTCAAGTTAAAAAGCAGG - Intergenic
982527454 4:156497259-156497281 TGGTTTTGAATTTGAAAATCTGG - Intergenic
982913628 4:161177300-161177322 TGTGTTTGAAATTTAAAATCAGG - Intergenic
982989096 4:162247559-162247581 AGTGTTTCATTTTATAAATCTGG - Intergenic
985335560 4:188889701-188889723 AGAGTTCAAATTTAAAAGTCAGG - Intergenic
985428354 4:189853632-189853654 AGGGTTTCCATTGAAAAATCTGG + Intergenic
986354542 5:6910680-6910702 TGAATTTGTATTTTAAAATCTGG - Intergenic
986575598 5:9209487-9209509 TTAATTTAAATTTTAAAATCTGG + Intronic
987394032 5:17404163-17404185 GCATTCTCAATTTAAAAATCTGG - Intergenic
987573548 5:19697472-19697494 AGAATTTCATTTTAAAACTCAGG + Intronic
988620786 5:32821516-32821538 TGAGTTTCAATTTAAGTAACAGG + Intergenic
988861324 5:35283083-35283105 TGAGTTTAAAATTAAAAGTCTGG - Intergenic
989241069 5:39203362-39203384 AGAGTTTCAATTATAAAATATGG - Intronic
989548827 5:42708479-42708501 TTATTTTCAGTTTAAAAATAAGG + Intronic
990622259 5:57572598-57572620 TGTGTTTCTTTTTAAAAATATGG + Intergenic
990669179 5:58108171-58108193 CGAGTTTCATTTAAAAAATCTGG - Intergenic
990970839 5:61504014-61504036 TGAGCTTCAATTATAATATCAGG - Intronic
991059121 5:62352934-62352956 TCAGTTTGAGTTTAAAATTCTGG + Intronic
991416542 5:66398589-66398611 TGACTTTCATTTAAAAAATCAGG - Intergenic
992177194 5:74161572-74161594 TGAGTTGCTGTTTTAAAATCAGG + Intergenic
992499576 5:77328696-77328718 GGAGTTTCAATTTTAAAAAATGG + Intronic
992795590 5:80252815-80252837 TGGGTTTCAATTTGGAAATCTGG - Intronic
992811181 5:80390197-80390219 TCTGTTGCTATTTAAAAATCAGG - Intergenic
992988187 5:82255189-82255211 TTAGTTTCAAATTAAAGATGAGG - Exonic
993059430 5:83021224-83021246 TGGGATTCAATTTCAAAATGAGG + Intergenic
993063279 5:83067099-83067121 TGCCTTCCAATATAAAAATCTGG - Intronic
993399858 5:87435474-87435496 TGAGATGCAATTTAGAAATGAGG - Intergenic
993680739 5:90874553-90874575 AGATTTTCAATTTAAAAAACTGG + Intronic
993787241 5:92158060-92158082 TGAGTATCCATTTTATAATCAGG - Intergenic
993823705 5:92654343-92654365 TGATTTTCACTTTAACAATGAGG - Intergenic
994001391 5:94784841-94784863 TGAGTGTCTCTGTAAAAATCAGG - Intronic
994382617 5:99089130-99089152 TGGGTGTCAGCTTAAAAATCTGG + Intergenic
994810668 5:104514891-104514913 TGAATGTTAATTTAAAGATCTGG - Intergenic
995367990 5:111385462-111385484 TTAGTCTCAATTTTAAAAGCTGG + Intronic
995783808 5:115806875-115806897 GGAGTTTCAAGATATAAATCAGG - Intronic
996218719 5:120901751-120901773 AAAGTCTCATTTTAAAAATCTGG - Intergenic
996489228 5:124072944-124072966 TTAGTTTTAATTTACAATTCAGG + Intergenic
996489290 5:124073783-124073805 TCAACTTCTATTTAAAAATCAGG + Intergenic
998658667 5:144210651-144210673 TGAGTATCTAGTTCAAAATCAGG - Intronic
998676437 5:144413847-144413869 TGAGCATCGATTTAAGAATCTGG + Intronic
998771435 5:145550217-145550239 TGGTTTTCAATATAAAACTCTGG + Intronic
1000451420 5:161392607-161392629 TGTGTTTCACTTTCCAAATCTGG + Intronic
1000701448 5:164456475-164456497 TAGGTTTCAATTTAAAATTGTGG - Intergenic
1000712204 5:164594930-164594952 TGAATTTCAAAGGAAAAATCTGG - Intergenic
1001355222 5:171015190-171015212 TGAGTTTCATTTGTAAAATTTGG + Intronic
1002404954 5:179023516-179023538 TGAGTATGAATTTTTAAATCTGG - Intergenic
1002439445 5:179256797-179256819 TGAGTGTACACTTAAAAATCAGG - Intronic
1002709848 5:181188770-181188792 TTAGTTGAAATTTAAAAAGCTGG + Intergenic
1003038382 6:2664889-2664911 TCTGTTGCTATTTAAAAATCAGG - Exonic
1003588470 6:7415921-7415943 TGAGGTTTAATTTATAAATTAGG - Intronic
1006234622 6:32617834-32617856 TGAGCTTCAAAATATAAATCTGG + Intergenic
1007953582 6:45895989-45896011 AGATTTTTAATTTAAAAATGTGG - Intergenic
1008485674 6:52032657-52032679 TTAGCTTCAATTTACAGATCAGG - Intronic
1008653858 6:53591096-53591118 TATGTATCAATTTAAAAATCTGG - Intronic
1008723829 6:54392420-54392442 TGAATTTCATTTTAAAAAACTGG - Intergenic
1008914969 6:56777569-56777591 TGAGTTTCAAATTAGAAAGTGGG - Intronic
1009337395 6:62508731-62508753 TAAGTTGCAAGTCAAAAATCAGG + Intergenic
1009481836 6:64168936-64168958 AGAGTCTCAAGGTAAAAATCAGG + Intronic
1009557072 6:65184561-65184583 TGATTTTTAAATTTAAAATCAGG - Intronic
1009568043 6:65339512-65339534 TGAAGTTTAATTTATAAATCAGG - Intronic
1010122603 6:72395008-72395030 TGACTTAAAATTTAAAACTCTGG + Intronic
1010788880 6:80040253-80040275 TGAGTTTGAATTTGAACATATGG - Exonic
1010808847 6:80273913-80273935 TAATTTTCAATTTAAAAATTAGG - Intronic
1010924600 6:81728813-81728835 TGAATTTCACTTTAAAATTTTGG - Intronic
1011101284 6:83725574-83725596 TGATTTGCAATTTTAAAATTAGG - Intergenic
1011361458 6:86529201-86529223 TGAGTTTTAAATTAAAATTTTGG - Intergenic
1011521805 6:88215510-88215532 TGAGTTCCAATTTGACAATCAGG - Intergenic
1011727445 6:90224929-90224951 TGAGTTAGAATTTAAAAGGCTGG + Intronic
1012122768 6:95387834-95387856 TGTGGTTAAATTTAAAAATCTGG + Intergenic
1012179070 6:96128201-96128223 TGTCTTTAAATTTAAAAATCTGG + Intronic
1013219525 6:108065629-108065651 TAAGGTTCAGTTTCAAAATCAGG + Intronic
1013404806 6:109833061-109833083 TCAGTTTCAATTTCTAAATGCGG - Intergenic
1014602359 6:123429635-123429657 TTAATCTCAATTTAAAAATATGG - Intronic
1014645858 6:123971769-123971791 TGAGTTTCCATTTGAAAGTTTGG + Intronic
1014751475 6:125261758-125261780 TAACTTACAATTTAAAAATAAGG - Intronic
1014898386 6:126931986-126932008 TGTGTTTCAATGTAAACATTTGG + Intergenic
1014912325 6:127109787-127109809 TAAGTTTCAATATATAAATTTGG + Intergenic
1014993257 6:128108628-128108650 AGAGTTTACATTTAAAAATCTGG + Intronic
1015081586 6:129232572-129232594 TGGATTTCAAATTAAAATTCTGG + Intronic
1015142559 6:129951677-129951699 TAAGTTTTAATTTATAAATTAGG + Intergenic
1015296705 6:131602840-131602862 TCAGTTTCTATTTAAAAAGCTGG + Intronic
1015325919 6:131923315-131923337 TGATTTTTAATATACAAATCTGG + Intergenic
1015690716 6:135919237-135919259 TCAGTTTCAATGGAAAAATAAGG + Intronic
1016123146 6:140368492-140368514 TGAGTTTCAATTTACTCATGTGG - Intergenic
1016158758 6:140849057-140849079 TGAGTTTGAATTTAAAAATTTGG - Intergenic
1016180308 6:141138236-141138258 AGATTTTCAATTTAAAAAATTGG + Intergenic
1016573994 6:145547200-145547222 ACAGTTTCAAATTCAAAATCTGG + Intronic
1016625680 6:146165116-146165138 TGTGTTTCAACTAAAAAAGCAGG - Intronic
1018225413 6:161623624-161623646 TGACTTTCAGATTAAAAAGCAGG - Intronic
1018728072 6:166628314-166628336 TGAGTTTGTATTTAAAAACAGGG + Intronic
1019113775 6:169740010-169740032 TAAGTATAAATATAAAAATCTGG + Intergenic
1020361436 7:7330814-7330836 TGAGGATCATTTTAAAAAGCAGG - Intergenic
1020590087 7:10124550-10124572 TAAACTTCAATTTAAAAATTAGG + Intergenic
1020667456 7:11066128-11066150 TTATTTTACATTTAAAAATCTGG + Intronic
1021303188 7:18998119-18998141 TGAGTTTCCTTTTTAAAATGGGG - Intronic
1021315094 7:19138654-19138676 TGATTTCCACTTTACAAATCAGG + Intergenic
1021567604 7:22030433-22030455 TGATTTTACATTTAAAAATTGGG - Intergenic
1021911472 7:25389641-25389663 TGATCTTCAATTTAGAAGTCAGG + Intergenic
1022052136 7:26686740-26686762 TCAGTGTCAGTTTAAAAGTCAGG + Intronic
1023379209 7:39589126-39589148 TTAGTTTCAATTTAAAACAAAGG + Intronic
1023535222 7:41201577-41201599 TGACTTGTAATTAAAAAATCCGG + Intergenic
1024403691 7:48952965-48952987 TGAGTTTTAAGTATAAAATCAGG + Intergenic
1026242570 7:68589742-68589764 TGAGTTTCAACATGTAAATCTGG + Intergenic
1027025504 7:74848980-74849002 TGAATTTTAATTTATAAATTAGG + Intronic
1027062260 7:75095139-75095161 TGAATTTTAATTTATAAATTAGG - Intronic
1028068307 7:86415812-86415834 TCAGTTTCAATTATACAATCAGG - Intergenic
1028122235 7:87069203-87069225 GGAGTTTCAATTTAAAATGCAGG - Intergenic
1028151066 7:87372545-87372567 TGAATCACTATTTAAAAATCAGG + Intronic
1030031171 7:105370914-105370936 TAAGTTTAAAATTAATAATCCGG - Intronic
1030423056 7:109333280-109333302 AGAATTTAAATTTAAAACTCTGG - Intergenic
1031279855 7:119784625-119784647 TGAGATACAATTTAAATCTCTGG + Intergenic
1031329632 7:120448928-120448950 TTAGGTTCAATTTAAATATAGGG - Intronic
1031688173 7:124758425-124758447 TAAGTTTCCACTTAAAAGTCCGG + Intronic
1031797801 7:126198676-126198698 ATAATTTCTATTTAAAAATCAGG - Intergenic
1032298438 7:130664471-130664493 TGAGTTTCAAGTAAAAAAGTAGG - Intronic
1035563062 8:622280-622302 TGAGTTTCAACATATAAATGGGG - Intronic
1036473735 8:9074424-9074446 TAAATTTAAATTTAAAAATATGG - Intronic
1036961229 8:13246745-13246767 TGAGTTCCTATTTAACTATCTGG + Intronic
1037360177 8:18064895-18064917 TTAGTCACACTTTAAAAATCTGG - Intronic
1038028997 8:23620413-23620435 AGAGTTTCATTTTTAAAAGCTGG + Intergenic
1040098068 8:43467495-43467517 TGAAGTTCAATTTAAAAAAAAGG + Intergenic
1040876965 8:52163764-52163786 TGACTTTCAAGTTAAACTTCTGG + Intronic
1041271044 8:56109815-56109837 TGAGTCTCTTTTTAAAAACCCGG + Intergenic
1041342769 8:56863554-56863576 TTAGTTTCATTTTACAAATAGGG + Intergenic
1042146283 8:65733453-65733475 TGAAGTTTAATTTAAAAATTGGG + Intronic
1043060136 8:75489750-75489772 TGACTTACAAATGAAAAATCTGG + Intronic
1043061196 8:75506038-75506060 TGATTTGCATTTTAAAAATCTGG + Intronic
1043122693 8:76348493-76348515 AGAGTAACAATTTAAAAATAAGG - Intergenic
1043629196 8:82307692-82307714 TGTATTTCAATATAAAAATATGG + Intergenic
1043764055 8:84106491-84106513 TTATTTTTATTTTAAAAATCTGG - Intergenic
1044044005 8:87406871-87406893 TGACATTCATTTTAAAAGTCTGG - Intronic
1044087465 8:87958097-87958119 TGATTTTCTGTTTAAAATTCAGG - Intergenic
1044898632 8:96920530-96920552 TGAGCTTTAATATAAAAATGTGG - Intronic
1045953213 8:107875548-107875570 TATGTTTTAAATTAAAAATCTGG + Intergenic
1047066333 8:121288129-121288151 AGACTTTCAATTTTAAAACCAGG + Intergenic
1048106564 8:131417401-131417423 GGAGTTTGAATTTATAAAGCAGG - Intergenic
1048686900 8:136914546-136914568 TAAGGTTTCATTTAAAAATCTGG - Intergenic
1051577682 9:18635652-18635674 TCATTTTCGATTTTAAAATCTGG - Intronic
1052404476 9:28042193-28042215 TTGCTTTCAATTTAAAACTCTGG + Intronic
1052535000 9:29734740-29734762 TGCCTTTAAATGTAAAAATCAGG + Intergenic
1054996276 9:71394278-71394300 TAATTTTAAATTTAAAAAACAGG + Intronic
1055551652 9:77437089-77437111 TAAGTTTCACTGTCAAAATCAGG + Intronic
1056991571 9:91416797-91416819 TGACTTAAACTTTAAAAATCTGG - Intronic
1057582172 9:96296731-96296753 TATGTTGCCATTTAAAAATCAGG + Intronic
1058769803 9:108219514-108219536 TAAATTTAAATTTAAAAATGAGG + Intergenic
1058846145 9:108961379-108961401 TGAGGTTCATGATAAAAATCAGG + Intronic
1059399192 9:114058266-114058288 TGAGTTTCCACATAAAAATCTGG - Intergenic
1059860582 9:118456451-118456473 TGTGTTTCAAGTTCAAAGTCTGG + Intergenic
1059926878 9:119218558-119218580 GGTGTTAGAATTTAAAAATCAGG + Intronic
1060182481 9:121544177-121544199 AAACTTTCAGTTTAAAAATCAGG + Intergenic
1060257890 9:122048466-122048488 TGTGTTTAAAAATAAAAATCTGG - Intronic
1060543003 9:124443987-124444009 TAATTTTCAAATTAAAAATTGGG + Intergenic
1060543805 9:124448933-124448955 TAATTTTCAAATTAAAAATTGGG - Intergenic
1185850475 X:3481177-3481199 TTAATTTTAATTTAAAAATAAGG - Intergenic
1186966205 X:14788677-14788699 TGACTTTCAATTTAAACACATGG + Intergenic
1187547607 X:20267929-20267951 AGAGATTAGATTTAAAAATCAGG + Intergenic
1187858816 X:23662897-23662919 TTTGTCTCAATTTAAAAATTGGG + Intergenic
1188246636 X:27842624-27842646 TAAAAATCAATTTAAAAATCTGG - Intergenic
1188402250 X:29760037-29760059 TGAGTTTCAGCTTACAAACCTGG + Intronic
1189202648 X:39210779-39210801 TGGGTTTTAATTTACAAACCTGG + Intergenic
1189717093 X:43878118-43878140 TGAGTCTCATTTTAAAGATGAGG + Intronic
1192437082 X:71149492-71149514 TGAGGGTAAATTTAAAATTCAGG - Intronic
1192616535 X:72629073-72629095 TCACTTTCTTTTTAAAAATCTGG + Intronic
1192938433 X:75886151-75886173 TGAGTTGAGACTTAAAAATCTGG + Intergenic
1193022318 X:76803467-76803489 TGAGTTTCAATTCCAAATGCTGG + Intergenic
1193988083 X:88271216-88271238 TTTGTATCAATTAAAAAATCAGG - Intergenic
1194382622 X:93213975-93213997 TGTTATTCCATTTAAAAATCAGG - Intergenic
1194511857 X:94806405-94806427 TGAATTTCATTTTAATAATGAGG - Intergenic
1194514392 X:94833327-94833349 TGATCTTCAATTTTATAATCTGG + Intergenic
1194582615 X:95695259-95695281 TGAGTTTCAATGTTCTAATCAGG + Intergenic
1195635753 X:107114010-107114032 TGAGTTTGATTTTAAACATGTGG - Intronic
1195791293 X:108590536-108590558 TCAGTTTCATTTTCAAAAACTGG - Intronic
1196540573 X:116902042-116902064 TGTGTTACAAATTAAAAGTCAGG - Intergenic
1196682807 X:118485996-118486018 TGACTATCAATTTACAAAACAGG + Intergenic
1196742586 X:119038416-119038438 TGACTATCAATTTACAAAACAGG + Intergenic
1196900374 X:120376837-120376859 TGAAATTCAGTTTTAAAATCTGG - Intronic
1197073030 X:122323154-122323176 TGATTTCAAATTTAAAAATATGG - Intergenic
1197952176 X:131909253-131909275 TGAATTTGAATTTAATGATCTGG - Intergenic
1198146253 X:133860288-133860310 TGAGCCTCAGTTTCAAAATCTGG - Intronic
1199496614 X:148459285-148459307 TGATTTTCAGTTTGTAAATCAGG - Intergenic
1199884124 X:152002226-152002248 TTATTTTCAATCTCAAAATCAGG + Intergenic
1200811832 Y:7494029-7494051 TTAATTTTAATTTAAAAATAAGG + Intergenic
1201492794 Y:14560913-14560935 TGAGTTTCTGTTTGAAAATTTGG + Intronic