ID: 1182186759

View in Genome Browser
Species Human (GRCh38)
Location 22:28412175-28412197
Sequence TCTGTTCTTTAGAAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182186755_1182186759 29 Left 1182186755 22:28412123-28412145 CCAAATATATGCCTTGCTAAAGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG 0: 1
1: 0
2: 1
3: 29
4: 366
1182186757_1182186759 18 Left 1182186757 22:28412134-28412156 CCTTGCTAAAGGACACAAAACTG 0: 1
1: 0
2: 2
3: 24
4: 284
Right 1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG 0: 1
1: 0
2: 1
3: 29
4: 366
1182186758_1182186759 -5 Left 1182186758 22:28412157-28412179 CCTTCAGATATCTGAAGATCTGT 0: 1
1: 0
2: 1
3: 37
4: 307
Right 1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG 0: 1
1: 0
2: 1
3: 29
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182186759 Original CRISPR TCTGTTCTTTAGAAGATGAA TGG Intronic
903685395 1:25128012-25128034 TCTGTTCATTAGAGTAAGAAAGG + Intergenic
903744711 1:25578823-25578845 TATATTCTTTAAAAGATAAATGG - Intergenic
908104111 1:60823807-60823829 TCTGTTCTCTAGAATGTCAAAGG + Intergenic
908280671 1:62531522-62531544 ATGGTTCTTTAGAAGATGAGAGG - Intronic
909801912 1:79820583-79820605 TGTGATATTTAGAAGATGGAGGG + Intergenic
910015759 1:82521275-82521297 TCTTTTCTTTAGGATAAGAAGGG + Intergenic
910184587 1:84524171-84524193 TTTGTTCTTGCAAAGATGAAAGG + Intergenic
910405303 1:86882756-86882778 TGTGTTCATTAACAGATGAATGG + Intronic
910597533 1:88995075-88995097 TTAGTTCTTTAGAAGAGGCAAGG - Intergenic
911904832 1:103553865-103553887 TCTCTTGTTTAGAAAAAGAAAGG - Exonic
912781631 1:112554736-112554758 TCTGTTCATTAACAGATGAATGG + Intronic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
914852032 1:151321906-151321928 ACTGTTCTAAAGAAAATGAAAGG + Intronic
915404612 1:155650096-155650118 GGGGTTCTTGAGAAGATGAAGGG + Intergenic
915576466 1:156781901-156781923 TCTGTCCACTAGAAGATGAATGG - Intronic
916181875 1:162092009-162092031 TCTGTTATTTTGCAGATGAGGGG + Intronic
916651174 1:166836049-166836071 TGGTTTCTTTAGAAGAGGAAAGG - Intergenic
916765676 1:167858197-167858219 TCTGTTCTTAAGAAGCTCACAGG + Intronic
918312637 1:183296211-183296233 GATGTTCTTTGGTAGATGAATGG - Intronic
918707905 1:187691276-187691298 CATGTTCTTTAGTAGATGAATGG + Intergenic
918727990 1:187950168-187950190 ACTGCTCTTTAGAAAATGATGGG + Intergenic
919527073 1:198666447-198666469 TATTTTCTTTATAAGATAAATGG - Intronic
919726718 1:200889156-200889178 ACTGACCTTTAGAAGATGAGTGG - Intergenic
920068931 1:203288783-203288805 ATTGTTCTTTTGAAGATAAAAGG - Intergenic
920273520 1:204785934-204785956 TGTGTCCATTAGCAGATGAATGG - Intergenic
920843285 1:209573011-209573033 ACTCTTCTTGAGAAGATAAAAGG + Intergenic
921014897 1:211180312-211180334 TATGTCCTTTAGTAGGTGAATGG - Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921750936 1:218793695-218793717 TGTTTTCTTTGGAAGATGATAGG + Intergenic
922523634 1:226279830-226279852 CCTGTTTTTTAAAAAATGAAAGG - Intronic
922642163 1:227245228-227245250 TCTGTTCTTAAGCAGAAGGAAGG - Intronic
923138633 1:231141057-231141079 GCTGTTTGTTAGAAGATCAAGGG + Intergenic
1064043682 10:11991211-11991233 TCAGTTCTTTAAAAAATGCATGG - Intronic
1064767206 10:18686919-18686941 TCTGTTTTTTAAAAAAGGAAAGG - Intergenic
1064911909 10:20411461-20411483 TCTGTTCCTAAGAAGATAAAGGG - Intergenic
1065184029 10:23155293-23155315 TCTGTTCTGTAGCTGATGGAAGG + Intergenic
1065718598 10:28601654-28601676 AGTGTTCATTAGCAGATGAAAGG + Intronic
1065923753 10:30417344-30417366 TCTTTTCTTCAGAATAAGAAAGG + Intergenic
1066273604 10:33846913-33846935 ATTGTTCTTTTGGAGATGAAGGG - Intergenic
1067056023 10:43051167-43051189 GCTGTTCTTTATGAAATGAATGG + Intergenic
1067200018 10:44160524-44160546 TTTGTTCCTAAGAAGATGGATGG - Intergenic
1067857768 10:49811170-49811192 CATGTTCTTCAGTAGATGAATGG - Intergenic
1068242948 10:54328414-54328436 TCTTTTCTTAGCAAGATGAATGG - Intronic
1069260766 10:66392997-66393019 CATGTTCTTCAGTAGATGAATGG + Intronic
1069755286 10:70771067-70771089 TCAGTTCTCTAGAACATAAAAGG + Intergenic
1070119546 10:73562396-73562418 TGTGTTCTGTAGAAGGTGGAGGG - Intronic
1071081132 10:81812748-81812770 GATGTTCTTTAGTAGGTGAATGG + Intergenic
1071232783 10:83608261-83608283 CATGTTCTTTAGTAGGTGAATGG - Intergenic
1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG + Intergenic
1074247712 10:111711802-111711824 TCTGTTCTTGAGATAAGGAAAGG + Intergenic
1074374821 10:112931483-112931505 GATGCTCTTTAGTAGATGAATGG + Intergenic
1074452113 10:113567778-113567800 TCAGTTCTTTATAAAATCAAGGG - Intronic
1076361141 10:129889645-129889667 TCTGGTCATTAGAAAGTGAACGG - Intronic
1076503507 10:130956029-130956051 TCTGTTCCTTAGAAAATGTTTGG - Intergenic
1079417789 11:20255775-20255797 TCTGTTCTTCAGAAAAATAAGGG + Intergenic
1079583359 11:22094131-22094153 TCTGTAGTTTAGAAGATGGCTGG + Intergenic
1079812465 11:25012427-25012449 TCTATTCTTTAGAACTAGAAAGG + Intronic
1079881536 11:25933653-25933675 TCTGTTCTTTTGACAATAAATGG + Intergenic
1079990021 11:27236595-27236617 TCTGTTTTTTAGCAGAGGCAGGG + Intergenic
1080367589 11:31593565-31593587 TCCATTTTTTAGATGATGAATGG + Intronic
1080420371 11:32104786-32104808 CCTGTTCTTCAGAAGGTGAGTGG + Exonic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081049620 11:38321958-38321980 AGTGTTCTTCAGCAGATGAATGG + Intergenic
1081558902 11:44194163-44194185 TCTGTTCTTTGGGAGAAGAGGGG - Intronic
1082910683 11:58370870-58370892 TATTTTCTTTAGGAGATAAAAGG - Intergenic
1086920794 11:92584101-92584123 TGTGTTTTTGAGAAGATTAAGGG + Intronic
1087660005 11:100976202-100976224 TCTGTCCATTGGAAGATGATGGG - Exonic
1087982646 11:104635059-104635081 TATCTTTTTTAGAACATGAAAGG + Intergenic
1087993357 11:104773551-104773573 TATGGTCTTCAGAAGATAAAAGG - Intergenic
1088553076 11:111034374-111034396 TCTGTGCTGCAGAAAATGAATGG + Intergenic
1090305848 11:125690321-125690343 TCTGATTTTTAGTAGATGTAAGG - Intergenic
1091175616 11:133554808-133554830 TACCTTCCTTAGAAGATGAAAGG - Intergenic
1092269135 12:7008380-7008402 TCTGTGCTTGAGAAGAAGGATGG + Intronic
1092276094 12:7061958-7061980 GCTTTTCTTGAGAAGATGAAGGG - Intronic
1092699414 12:11210802-11210824 GATGTTCTTTAGTAGGTGAATGG + Intergenic
1092929910 12:13306019-13306041 TCAGTGTTTTGGAAGATGAATGG - Intergenic
1092936742 12:13371136-13371158 AATGTTCATTAGCAGATGAATGG - Exonic
1094170600 12:27487462-27487484 TTTGTCCTTTAGTGGATGAATGG - Intronic
1094463405 12:30723300-30723322 TTTGTTCTTTAGATGCTGCAAGG + Exonic
1095628880 12:44350754-44350776 TGTGTCCATTAGCAGATGAATGG - Intronic
1096245457 12:49982675-49982697 TTTCTTCTTTTGAAAATGAAAGG - Intronic
1097326291 12:58280972-58280994 TGTGTTCATCAAAAGATGAATGG - Intergenic
1097479401 12:60102295-60102317 TCTGTTGGGTAAAAGATGAAGGG + Intergenic
1097984252 12:65766928-65766950 TCTGTTTTTTCAAAGAAGAAAGG - Intergenic
1098078326 12:66757467-66757489 TTTGTTCATCAGCAGATGAATGG - Intronic
1098215969 12:68220043-68220065 TCTATTTTTTAGTAGATGCAAGG - Intronic
1098259187 12:68650357-68650379 TCTTTTCTTTAGAAGTATAATGG + Intronic
1099679579 12:85807708-85807730 TCTGTTCTATAGAAGGTCAAGGG + Intronic
1100117811 12:91329540-91329562 TCTGCTTTTTAGAAAATGACTGG + Intergenic
1100896928 12:99193268-99193290 AATGTTCTTTAGAAGAAAAAGGG - Intronic
1101437549 12:104677051-104677073 TCTATTCTTCAGATGAGGAAAGG - Intronic
1101555139 12:105801796-105801818 TTTTTTCTTTAGAAAAGGAAAGG + Intergenic
1106254256 13:28008427-28008449 TCTTTGCTTAAGAAGAAGAAGGG - Intronic
1107083275 13:36397777-36397799 TCTTTTTTTTTGGAGATGAATGG - Intergenic
1107751231 13:43569626-43569648 TCTTTTCCTTAGAATATAAAGGG + Intronic
1107942837 13:45390012-45390034 CCTGTTCTTCAGAAGTTGAGTGG - Intergenic
1107978842 13:45715192-45715214 GATGTTCTTTAGTAGATGAAAGG - Intergenic
1108058760 13:46511805-46511827 TATCTTCTTTAGAATATTAATGG + Intergenic
1109066118 13:57694512-57694534 TCTTTACTTCAGAAGATAAAAGG + Intronic
1110677439 13:78266037-78266059 TCTGTACTTTGGGAAATGAATGG + Intergenic
1111305209 13:86402725-86402747 TCTGTTCATATGAAAATGAAAGG + Intergenic
1111403995 13:87778149-87778171 TCTGTTCTTTATCAGAAGAATGG - Intergenic
1111660282 13:91201367-91201389 TATTTTCTTTACAAGATGAAAGG - Intergenic
1112695233 13:101940409-101940431 CCTGTTCTTTCCAAGGTGAATGG + Intronic
1113271340 13:108678329-108678351 TCTGTTCTGTGGATCATGAAAGG - Intronic
1116668410 14:47809028-47809050 GATGTTCATTAGCAGATGAACGG - Intergenic
1119320726 14:73728667-73728689 TCTGTTCTATAGAGAATGCAAGG - Intronic
1119477990 14:74942201-74942223 TCTGATCTTCAGAAGAAGAGGGG + Exonic
1120520159 14:85518013-85518035 TTTTTTCTTTAGTATATGAATGG - Intergenic
1121945148 14:98113248-98113270 TCTGTTCCTTAGCAGGTGAAGGG - Intergenic
1121962098 14:98270338-98270360 CCTGTGCTCTAGAACATGAATGG - Intergenic
1122469677 14:101957777-101957799 TATGTTCCTTAAAAGATAAATGG - Intergenic
1123149199 14:106165244-106165266 TCTGTTCTTTTGCAGATACAGGG + Intergenic
1124192477 15:27592379-27592401 TCTTTTCTTTGGAAGTTTAAGGG - Intergenic
1125134206 15:36322789-36322811 ACTGTTCTTTAGAAGAGACATGG + Intergenic
1125453853 15:39837164-39837186 TCTGGTCTTTAAAAGATGACTGG - Intronic
1125994478 15:44144742-44144764 TTTGTTTTTGAGAAAATGAATGG - Intronic
1126607156 15:50489653-50489675 TCTGTTTTTTAAAATATGAAGGG + Intronic
1126802743 15:52315187-52315209 TATATTCTTTAGAAGTTGAATGG + Intronic
1128734609 15:70046062-70046084 TCTGTTTTTTAAAAAATGGAGGG - Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130699694 15:86165969-86165991 TGGCTTCTTAAGAAGATGAAAGG - Intronic
1131203666 15:90423080-90423102 TCTGTGATTTAGTAGAAGAAGGG + Intronic
1131698958 15:94911415-94911437 TTTTCTCTTTTGAAGATGAAGGG - Intergenic
1131892436 15:96986215-96986237 TATGTCCTTTAGTGGATGAATGG - Intergenic
1131917787 15:97289673-97289695 GATGTTCTTTAGTAGGTGAATGG - Intergenic
1132924778 16:2423437-2423459 TTTGATCTTCAGAAGATGCAGGG - Intergenic
1133987941 16:10682631-10682653 GCTGTCCTTTAGAAGAAGGATGG + Intronic
1135284788 16:21184136-21184158 TATTTTCTTTAGAAACTGAATGG + Intergenic
1135500900 16:22994950-22994972 TCTGTTCCTTGGATGATGCAAGG - Intergenic
1136681021 16:31962320-31962342 TCTGTTCTTTTGCAGATACAGGG - Intergenic
1136781338 16:32903833-32903855 TCTGTTCTTTTGCAGATACAGGG - Intergenic
1136888459 16:33950007-33950029 TCTGTTCTTTTGCAGATACAGGG + Intergenic
1138176836 16:54907871-54907893 GATGTTCTTTGGCAGATGAATGG + Intergenic
1138176903 16:54908685-54908707 CATGTTCTTTAGTAGGTGAATGG + Intergenic
1139825729 16:69755764-69755786 TGTCTTCTTTAGGACATGAAGGG + Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1141394877 16:83695807-83695829 CCTGTTCTATAGATGAGGAAGGG + Intronic
1142328319 16:89433110-89433132 TCTGTTCTAAAGAAGCTGAATGG - Intronic
1203083995 16_KI270728v1_random:1167815-1167837 TCTGTTCTTTTGCAGATACAGGG - Intergenic
1143354955 17:6320526-6320548 TCTCTGCTTTAGAAGGTCAAAGG - Intergenic
1143388161 17:6544218-6544240 TCTGTGCCTCAGAAGAAGAAAGG + Intronic
1144236247 17:13263059-13263081 TCTTTTCTTTAGTAGATGCGGGG + Intergenic
1144375842 17:14640270-14640292 TCTGTTAAGTAGAAGATGATCGG + Intergenic
1149935241 17:60798576-60798598 CATGTTCTTCAGCAGATGAATGG - Intronic
1150517074 17:65825081-65825103 TCTGTCCATTGGCAGATGAATGG + Intronic
1152108524 17:78344085-78344107 TCTGGTCTTCAGTAGCTGAAGGG - Intergenic
1154042345 18:10868784-10868806 TCTTTTCTTCATCAGATGAATGG + Intronic
1154103171 18:11495912-11495934 TCTGTTCTTTACAAACTAAATGG - Intergenic
1156441794 18:37197543-37197565 TGTGTACTTTGGAAGATGAGAGG + Intronic
1156678821 18:39565034-39565056 TCTGTCCTTGAGAAGCAGAAGGG + Intergenic
1158644525 18:59232761-59232783 ACTGTTCTTTAGAGTAGGAATGG - Intergenic
1158734920 18:60068709-60068731 TCTGTACTTTACAGGATGGATGG + Intergenic
1159542245 18:69792997-69793019 TCTATTTCTTAGAAGATGACTGG - Intronic
1164815656 19:31200321-31200343 TATGTTCTTGAGTAGGTGAATGG + Intergenic
925559795 2:5178875-5178897 TCTGCTCATTAGAAGCTGATGGG + Intergenic
927045169 2:19270986-19271008 TCTTTTCTCTATAAGAAGAAAGG + Intergenic
927397694 2:22673167-22673189 ACTTTTATTTAGATGATGAATGG + Intergenic
927771540 2:25866536-25866558 TCTGTTTTCTAGCAGATAAAAGG - Intronic
927822954 2:26285022-26285044 CCTGTTCTTAAGAATATGAAGGG + Intronic
928742803 2:34375443-34375465 TATGTCCTTTAATAGATGAATGG - Intergenic
928788425 2:34919446-34919468 GCTGTCCTTTAGTAGTTGAATGG - Intergenic
928835560 2:35540374-35540396 TCTGTACTTTTGAAGAGGAGGGG - Intergenic
928900947 2:36316910-36316932 TCTGATCTTTGGAAGAAGACTGG + Intergenic
930449564 2:51518134-51518156 AGTGTTCCTTAGAAGAAGAAGGG - Intergenic
930507336 2:52300328-52300350 TCTGTTTTTTATTACATGAAAGG + Intergenic
931879093 2:66547945-66547967 TCTGTTCTTCAGAAGGGTAAGGG - Exonic
933074090 2:77900840-77900862 TCTGTCCTTCAACAGATGAAAGG - Intergenic
933607406 2:84397978-84398000 GATTTTCTTTTGAAGATGAAAGG - Intergenic
933635656 2:84706123-84706145 TTTCTTCTTGGGAAGATGAAGGG - Intronic
934164495 2:89281892-89281914 CCTGCTCTTTAGAAGAAGACAGG - Intergenic
934202779 2:89900632-89900654 CCTGCTCTTTAGAAGAAGACAGG + Intergenic
936278222 2:111118491-111118513 TCTGTCCTTTAGAAGAGAATAGG + Intergenic
936989579 2:118348339-118348361 TGTGCTCTTTAGAAGAGGACTGG - Intergenic
938440601 2:131328771-131328793 TCTGTCCATGGGAAGATGAAAGG + Intronic
939533805 2:143399287-143399309 TTTTTTCTTTAGAAGAAGAGGGG + Intronic
939774832 2:146371605-146371627 TCTGTTCTGTAATAGATGAGTGG + Intergenic
939796490 2:146651688-146651710 GATGTCCTTTAGAAGATGAATGG + Intergenic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
940371600 2:152907944-152907966 GATGTTCTTCAGTAGATGAATGG - Intergenic
941521538 2:166550433-166550455 TGTGTTCATCAGCAGATGAATGG - Intergenic
941700775 2:168602181-168602203 TCTCTCTTTTAGAAGATGTAAGG + Intronic
941711592 2:168719870-168719892 TTTTTTTTTTAAAAGATGAAAGG + Intronic
942776418 2:179587814-179587836 TCTGTTCATAAGAAGATCAAGGG + Intronic
944221490 2:197308983-197309005 TTTGTCATTTAGAAAATGAAGGG + Intronic
946104501 2:217357392-217357414 TCAGTTCTCTAGAAGAAGAAAGG + Intronic
947101186 2:226622753-226622775 TCTGTTGTTTAAAAAATAAATGG - Intergenic
947613947 2:231542469-231542491 TCTGTCCATTGGCAGATGAATGG + Intergenic
948240197 2:236425052-236425074 AGTGTTCTTCAGTAGATGAACGG - Intronic
948497098 2:238357902-238357924 TTTGGGCTTCAGAAGATGAAAGG + Intronic
1169768187 20:9171960-9171982 TCTGTTCTTGACAAGTTGACAGG - Intronic
1170433502 20:16298774-16298796 TCTGGTTTTCAGAAGATGCAGGG + Intronic
1170626323 20:18032917-18032939 TATGTTCATTAGGAGATAAAAGG - Intronic
1171303807 20:24087283-24087305 AATGTTCTTTAGTAGGTGAATGG - Intergenic
1173772963 20:45679784-45679806 TCTTTTCTTTCAAAAATGAAGGG - Intergenic
1176896594 21:14385574-14385596 TCTGTTCTTTATAACATTACTGG - Intergenic
1178884482 21:36474707-36474729 GCTGTTGTTTTGAAGATGAGAGG + Intronic
1179059068 21:37963021-37963043 GCAATTCTTTAGAAAATGAATGG + Intronic
1182186759 22:28412175-28412197 TCTGTTCTTTAGAAGATGAATGG + Intronic
1182533190 22:30978381-30978403 TCTCTGCTTAAGAAGTTGAATGG - Intergenic
1184019760 22:41813181-41813203 TCTGTTCTCTAGAGGATGCCAGG + Intronic
949724154 3:7024171-7024193 TCTGTTGTAAATAAGATGAAAGG - Intronic
949780628 3:7683050-7683072 TCTGTTTCTTAGAATATGAATGG + Intronic
949897032 3:8775587-8775609 GCTGTTCTTTTGCAGAAGAAAGG + Intronic
950686586 3:14622645-14622667 TTTGTTCTTAAGAAGAGAAAGGG - Intergenic
951100421 3:18682016-18682038 TCTGTTCTTCATAATAAGAAAGG + Intergenic
951285782 3:20811589-20811611 TTTTTTTTGTAGAAGATGAATGG - Intergenic
951350650 3:21602834-21602856 TTTGTACTTTAGAAAATGCAGGG - Intronic
951479963 3:23149820-23149842 GATGTCCTTCAGAAGATGAATGG + Intergenic
951594668 3:24305051-24305073 TCTGTTCTTTAAGAGTTAAATGG - Intronic
951827874 3:26888493-26888515 TATATTCTTAAGAAGATAAAAGG + Intergenic
954792701 3:53144785-53144807 TCTTTTCTGGAGAAGAAGAAAGG - Intergenic
956471568 3:69572573-69572595 ACTGTTCTTTAGAAATTCAATGG - Intergenic
957220775 3:77379823-77379845 GCTGTCATTTAGAAGATGAGTGG - Intronic
958208977 3:90443533-90443555 TCTTTTTTTTAGAATATGCAAGG - Intergenic
958522576 3:95210115-95210137 TCTATTCTTTTAAATATGAATGG + Intergenic
958762213 3:98322839-98322861 TTTGTTCTTTACACGAAGAAAGG - Intergenic
959810840 3:110617453-110617475 TCTTTTCTTTTGAATATTAATGG - Intergenic
959877527 3:111402611-111402633 TCAGTTTTTTAGAAGAAAAATGG - Intronic
960783045 3:121341701-121341723 CCTGTTGTTTACAACATGAATGG + Intronic
961994928 3:131232531-131232553 TTTGTTCTTCCTAAGATGAAAGG + Intronic
962360185 3:134734225-134734247 AATGTTCTTTAGCAGGTGAATGG + Intronic
963408543 3:144900684-144900706 ACTGTCCATAAGAAGATGAAAGG - Intergenic
964573931 3:158143313-158143335 TCTTTTCTTTAAAAGTGGAAAGG - Intronic
964941374 3:162160073-162160095 GATGTCCTTTAGTAGATGAACGG - Intergenic
965257715 3:166437430-166437452 TCTGTGCTTTAGAAGAATACTGG - Intergenic
965986591 3:174761123-174761145 TATTTTCTTTAGAAGTAGAAGGG - Intronic
966545977 3:181148882-181148904 TATGTCCTTTAGTAGGTGAATGG + Intergenic
966555940 3:181260278-181260300 TCTGTGGTTTATAAGTTGAAAGG + Intergenic
966775427 3:183539245-183539267 GCTGTGTCTTAGAAGATGAAAGG - Intronic
966830646 3:184005247-184005269 TGTGTACTTTAAAAGATGGATGG - Intronic
967967932 3:194976827-194976849 TCTGGTTTTTAAAAGATGCAGGG - Intergenic
968032814 3:195517110-195517132 TCTGTTCTTTAGACTATTTAGGG - Intronic
968709033 4:2099175-2099197 CCTGTTCTTAAGAAGACAAAGGG + Intronic
969019604 4:4130968-4130990 TTTCTTCTTTAGAAGAAGTAGGG + Intergenic
969410225 4:7023320-7023342 TCTGCTTTTTAGCAGATGTAGGG + Intronic
970201572 4:13613569-13613591 TATCTTCTTCAAAAGATGAAAGG + Exonic
970435428 4:16029652-16029674 TCTTTTCTTTAGGGGGTGAAGGG - Intronic
970881975 4:20943231-20943253 TCTGTTCTTCTGAAGATGTGTGG + Intronic
971125649 4:23751138-23751160 TATTCTCATTAGAAGATGAAAGG + Intergenic
971244854 4:24918243-24918265 TCTGTACTGTAGAAGAATAATGG + Intronic
971426058 4:26516561-26516583 TCAGTTCTTTGGAAGAATAAAGG - Intergenic
971671776 4:29567779-29567801 TCTTTTCTTTACAAGATACATGG - Intergenic
971873562 4:32275008-32275030 TCTATAATTTAGAAGACGAAAGG + Intergenic
971899318 4:32638096-32638118 TCAGTTCTATAGAATATCAATGG - Intergenic
972307623 4:37847148-37847170 TCTGCTCTGTAGAAGATCTAAGG + Intronic
972860269 4:43160020-43160042 TCTTAACTTTAGAAGAAGAAAGG - Intergenic
972912726 4:43838215-43838237 GATGTTCTTTAACAGATGAATGG - Intergenic
975834927 4:78412921-78412943 TCTGCTCAATAGAAGATGAGAGG + Intronic
976498454 4:85758039-85758061 TATGTGCTTTGGAAGAAGAAGGG + Intronic
977280065 4:95029035-95029057 TCTGTTCTCAAGAACTTGAAAGG - Intronic
977630335 4:99235527-99235549 TCTGTTGGTTAGAAGAGTAAAGG - Intergenic
978129013 4:105171498-105171520 TTTGTTCTTTAAAAAATGACAGG + Intronic
978230535 4:106392296-106392318 TCTGTCCTTTAGAAGAGAATTGG - Intergenic
978256427 4:106697892-106697914 TCTGGTCTCTAGGAGAAGAAAGG - Intergenic
978952281 4:114575340-114575362 TCTGTTGCTTAGAAGAGCAATGG + Intergenic
978973802 4:114843909-114843931 ACTGTTCTTTTGATAATGAAGGG + Intronic
979081327 4:116347537-116347559 TATTTTCATGAGAAGATGAAGGG + Intergenic
979793368 4:124814458-124814480 TCTGTTTTTTTGTAGATAAAGGG + Intergenic
979901019 4:126218787-126218809 TCTGTGATTTTGATGATGAAAGG + Intergenic
979928137 4:126593760-126593782 GATGTCCTTTAGTAGATGAATGG + Intergenic
980144954 4:128971178-128971200 TATGTTCTTTAGATAATCAAAGG - Intronic
980177256 4:129361806-129361828 TTTCTTCTTTAGTTGATGAAGGG + Intergenic
980534615 4:134100963-134100985 TATTTTCCTTAGAAGATAAAAGG - Intergenic
980660580 4:135853591-135853613 TGTGTAATGTAGAAGATGAAAGG + Intergenic
980660951 4:135856777-135856799 TGTGTAATGTAGAAGATGAAAGG - Intergenic
980923228 4:139108591-139108613 TTTTTTTTTTAGAATATGAATGG - Intronic
981020502 4:140022683-140022705 TCTCTTCTTTATAAGATTCAAGG + Intronic
981397081 4:144264307-144264329 TATGTTCATTAACAGATGAATGG + Intergenic
983074817 4:163313294-163313316 GATGTTCTTCAGAAGGTGAATGG - Intergenic
983332877 4:166353900-166353922 TCTGGTGTTTAGTAGAAGAAGGG + Intergenic
983699672 4:170576861-170576883 TTTTTACTTTTGAAGATGAAAGG - Intergenic
983767667 4:171505830-171505852 TGTTTTCTTTAGAAGATGAGAGG + Intergenic
984177985 4:176443080-176443102 TCTTTTTTTTAGAAAAAGAAAGG - Intergenic
984912122 4:184683694-184683716 TATGTTCTTCAGTAGAGGAATGG - Intronic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
987510578 5:18832299-18832321 TCTGTCCTTTAGAATCTGCATGG + Intergenic
987903185 5:24040018-24040040 CCTGTTATTTAGCAGGTGAAAGG - Intronic
988189848 5:27915544-27915566 TCTATTCATCAAAAGATGAAGGG - Intergenic
989165998 5:38434050-38434072 TCTGTGCTTTGGAAGATCATTGG - Intronic
990217931 5:53554496-53554518 TCTGTCCTTTAGAAGAAAATAGG - Intergenic
990869220 5:60413430-60413452 TCTCATCTTCAGAAAATGAAAGG - Intronic
992370083 5:76134782-76134804 TCTGCTCTTTGGAAGAACAAGGG + Intronic
992730706 5:79665319-79665341 ACCGTTCTTTAAATGATGAAAGG - Intronic
993780168 5:92056532-92056554 AATGTTCTTCAGAAGGTGAAAGG - Intergenic
994439690 5:99786761-99786783 GATGTTCTTTAGTAGGTGAATGG - Intergenic
995340204 5:111049766-111049788 TCTGTTCTTTAAACAATTAAGGG + Intergenic
995420567 5:111962382-111962404 TCTCTCCTTTTGTAGATGAATGG - Intronic
995606625 5:113863525-113863547 TATTTTCTTTTGAGGATGAAAGG + Intergenic
995819444 5:116212330-116212352 TCTATTCTTCAAAAGATAAAAGG - Intronic
996353463 5:122571624-122571646 TCTGTTGTTTTGTAGATGACAGG + Intergenic
997192375 5:131949087-131949109 TCTGAGTTTTAAAAGATGAATGG + Intronic
997326944 5:133029404-133029426 ACTCTTCTTTACAAAATGAATGG - Intergenic
997423828 5:133789292-133789314 TCTCTTCCTTTGAAGATCAATGG + Intergenic
997837775 5:137210225-137210247 CCTGTTCTATAGAAGAGGGAGGG - Intronic
1000150935 5:158500275-158500297 TCTTTTCTTTACCAGCTGAACGG + Intergenic
1001607125 5:172969302-172969324 TCAGTTCCTTAAAAGCTGAATGG + Intronic
1001714163 5:173801369-173801391 CCTGTTCATCAGCAGATGAATGG + Intergenic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1003002930 6:2353103-2353125 TTTATTCTCTAGAAGATGATTGG + Intergenic
1003131031 6:3395408-3395430 GCTGATCTTTACAAGATGGATGG - Intronic
1003568970 6:7243608-7243630 TCAGTTGTTTAGAATGTGAAGGG + Intronic
1003864700 6:10352234-10352256 TTTGTTTTCTAGAAGAGGAAAGG + Intergenic
1003892268 6:10574123-10574145 TCCATTCTGTAGAAGAAGAAAGG + Intronic
1004343821 6:14830355-14830377 TATGTTCTTTAGGGGAAGAAAGG - Intergenic
1004858825 6:19780095-19780117 TCTGTTCTTTTAAAAATGTACGG + Intergenic
1010126082 6:72433269-72433291 TCTGTTATTTAGAAAATTATTGG + Intergenic
1010515713 6:76770681-76770703 TCTTATCTGTAGAAGAGGAAAGG - Intergenic
1010973224 6:82284696-82284718 TCTGTTTTTCAGAAAATGAACGG + Intergenic
1011154303 6:84312849-84312871 TCTGTTCCTGAAAAGATGGAAGG + Intergenic
1011416014 6:87121012-87121034 TCTGTTCTTCAGAAGTTGGGTGG - Intergenic
1011805373 6:91066653-91066675 TCTCTGCTTTAGCAGATTAAAGG - Intergenic
1012959484 6:105607676-105607698 TATTTTCTTGAGAAAATGAATGG + Intergenic
1014541866 6:122686046-122686068 AGTGTTCATCAGAAGATGAATGG - Intronic
1015503459 6:133956965-133956987 TCTTTTCTTTAGAAGACAGATGG + Intronic
1016282167 6:142430743-142430765 TGTGTTCTCTGGTAGATGAAAGG + Intronic
1019553301 7:1614760-1614782 GTTGTTCTTTAGAAAATCAAAGG - Intergenic
1019850904 7:3556167-3556189 AGTGTTCTTCAGCAGATGAATGG + Intronic
1019881632 7:3866405-3866427 TCTGTGCTTTGAACGATGAAAGG + Intronic
1020411086 7:7892367-7892389 ACAGTTCTGTAGAATATGAATGG + Intronic
1021966162 7:25921219-25921241 TATGTTCATTAGCAGACGAACGG + Intergenic
1023382924 7:39625957-39625979 TGTATTCTTTAGTAGATGAGTGG + Intronic
1024719988 7:52125427-52125449 TCTGTTCTTTAGAAGGATAGAGG + Intergenic
1026617477 7:71918643-71918665 TTTGTGCCTGAGAAGATGAAGGG - Intronic
1027540918 7:79464204-79464226 TATGTTCATTACAGGATGAAGGG + Intergenic
1027570656 7:79861892-79861914 TCTGTTTTTTAGAATATGATTGG + Intergenic
1027869171 7:83684955-83684977 TCTGTTTCCCAGAAGATGAAGGG + Intergenic
1027915572 7:84315993-84316015 TTTGTTATTTAGAAAAAGAATGG + Intronic
1027986923 7:85304807-85304829 CCTGTTTCTTAGAAGATGGAAGG + Intergenic
1028635456 7:92984356-92984378 TGTGTTCTTGAGCAGAAGAAGGG + Intergenic
1030812691 7:113993903-113993925 TCTGTCCATTAACAGATGAATGG + Intronic
1032495873 7:132361874-132361896 TCTTTTCTTTGAAAGATCAAAGG - Intronic
1032617667 7:133492560-133492582 TCTGAACTTGAGAAGAGGAATGG - Intronic
1032744977 7:134777425-134777447 CCTGGTTTTTAGAAGATAAATGG - Intronic
1037266333 8:17065501-17065523 TCTGCTCTTTAAAAGATGAATGG + Intronic
1040577168 8:48662929-48662951 GATGTTCTTTAGCAGGTGAATGG - Intergenic
1041101254 8:54398303-54398325 AGTGTTTTTTAGAAGAGGAATGG - Intergenic
1041324452 8:56650220-56650242 TCTGGTCATAAGAAGATGATGGG - Intergenic
1041403493 8:57469984-57470006 GATGTTCTTCAGCAGATGAATGG - Intergenic
1041426289 8:57724309-57724331 TCTTTTCCTTATAAGTTGAATGG - Intergenic
1041866027 8:62574280-62574302 TCTGTCCATTAACAGATGAAAGG - Intronic
1042172005 8:66000578-66000600 TCTGTTCTTCTGAGGATGGAGGG + Intergenic
1042523875 8:69744103-69744125 TCTGCTCTTTACAACCTGAAAGG + Intronic
1043557137 8:81444402-81444424 TTTGTTCTTTGGAATATGAATGG - Intronic
1043938121 8:86166514-86166536 TCTGCTCTTAATAGGATGAATGG - Intergenic
1044090772 8:87997258-87997280 GTTGTCCTTTAGAAAATGAAGGG - Intergenic
1044423865 8:92028912-92028934 TCAGTTCTTTAGATGATAAAAGG - Intronic
1044789389 8:95832197-95832219 GGTGTTCTTCAGTAGATGAATGG + Intergenic
1045204644 8:100025470-100025492 TCTGTTTTCTAAAAGATGAATGG - Intronic
1045403896 8:101846064-101846086 AGTGTTCTTCAGCAGATGAATGG - Intronic
1046125019 8:109895217-109895239 TCTGTTTTATAGATGATGAATGG + Intergenic
1047912612 8:129546736-129546758 TCTGTTATTCACAAGATAAAGGG - Intergenic
1048045456 8:130768451-130768473 TCAGTTCTTCAGACAATGAAGGG + Intergenic
1048879994 8:138864200-138864222 GCTGTACTTTAGAAGGAGAATGG - Intronic
1049873092 8:144996597-144996619 TTTGTCCTTTAGTAGGTGAATGG - Intergenic
1050245706 9:3687821-3687843 TCTGTCATTCAGAAGGTGAAAGG - Intergenic
1050940052 9:11447404-11447426 TCTGTTCTTTACAGTCTGAATGG + Intergenic
1051569512 9:18540054-18540076 GCTGAGCTTTAAAAGATGAAAGG + Intronic
1054995834 9:71388002-71388024 TCTGGTTCTAAGAAGATGAAGGG + Intronic
1055274980 9:74605031-74605053 TCTTTTCTTTCTAGGATGAAGGG - Intronic
1055998181 9:82184737-82184759 CCTGTTGTTTTGAAGATGAGAGG + Intergenic
1056530640 9:87484142-87484164 GATGTCCTTTAGTAGATGAATGG + Intergenic
1057024130 9:91723199-91723221 TCTGTTGGTTTGAGGATGAAGGG - Exonic
1057024768 9:91726352-91726374 TGTGTGCTTTAGAAAATAAATGG - Intronic
1058472986 9:105300074-105300096 TCTGATATTTAGAAGTAGAAAGG + Intronic
1058855422 9:109057354-109057376 TCTGTTCTTTAGATTAAGATGGG - Intronic
1058925230 9:109656554-109656576 GCTTTTGTTTAGATGATGAAAGG + Intronic
1059030087 9:110683369-110683391 TGTGTTCATTAACAGATGAATGG - Intronic
1061460338 9:130732802-130732824 TCTGTTCTTCAGAGGAGCAAAGG + Intronic
1203581186 Un_KI270746v1:6851-6873 TATGTCCATTAGAAGAAGAAAGG + Intergenic
1186587786 X:10894783-10894805 TCTGTTCCTTCAAAGTTGAAAGG - Intergenic
1186871262 X:13776176-13776198 TCTGTCATTTAGAAGCTGGAGGG + Intronic
1187074809 X:15923685-15923707 ACTGTCCATTAGTAGATGAATGG - Intergenic
1187186316 X:16990036-16990058 GATGTTCTTTAGTGGATGAATGG + Intronic
1187405191 X:18997341-18997363 TCTTCTCATTAGAATATGAATGG - Intronic
1188641098 X:32505753-32505775 GATGTTCTTCAGTAGATGAATGG + Intronic
1189420093 X:40849294-40849316 GCTGTTCTTCAACAGATGAATGG - Intergenic
1189447358 X:41093231-41093253 TCTGTACATTAGCTGATGAAAGG + Intronic
1190383918 X:49865943-49865965 AATGTTCTTTAATAGATGAATGG - Intergenic
1190466627 X:50731020-50731042 TCTCTTCTTTAAAAGATATAAGG + Intronic
1192458924 X:71300799-71300821 TGTCTTCTTTAGGACATGAAGGG - Exonic
1193107989 X:77700638-77700660 GATGTCCTTTAGAAGATGAATGG + Intronic
1195449693 X:104997495-104997517 TCTGATCTTTTGAAGATCACAGG + Intronic
1195921913 X:109992237-109992259 TTTGTCTTTTAGAATATGAAAGG - Intergenic
1196313337 X:114195320-114195342 GATGTTCTTTAGTAGGTGAATGG + Intergenic
1196392386 X:115221830-115221852 ACTGTTATGTAGAAGATGAGGGG + Intronic
1197188636 X:123619431-123619453 ACTGTCCTGTAGAAAATGAATGG + Exonic
1197241136 X:124124440-124124462 GATGTTCTTCAGAAGGTGAATGG + Intronic
1197828056 X:130612061-130612083 TCTGTTGTTTATAAGATGCCCGG - Intergenic
1197924418 X:131631736-131631758 ACTATTCTTTAGAAGACGAGAGG - Intergenic
1198264979 X:135000564-135000586 ACTGTACTTTAGAATATTAAAGG - Intergenic
1198844109 X:140891100-140891122 TCTTTTCTGTAGGAGATGAAAGG - Intergenic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199087032 X:143639499-143639521 TCTGGAATTTAGAACATGAAAGG + Intergenic
1200465047 Y:3506145-3506167 TATGTCCTTTAGTGGATGAATGG + Intergenic
1200780590 Y:7212017-7212039 TCTGTCCTTTAGAAGCTGGGTGG + Intergenic
1202191452 Y:22250174-22250196 TCTGTTGTTTAGCACAAGAAGGG + Intergenic