ID: 1182188421

View in Genome Browser
Species Human (GRCh38)
Location 22:28432502-28432524
Sequence CCAGTAAATAACTGTAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 227}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182188421 Original CRISPR CCAGTAAATAACTGTAAATG TGG (reversed) Intronic
905531664 1:38684642-38684664 CCAGAAAAAAACAGTAAAGGGGG + Intergenic
908404582 1:63801952-63801974 CAAGTAAAGCACTGTAAATGGGG + Intronic
908816204 1:68037674-68037696 CAAGTAAATAATTTTAAATCAGG - Intergenic
909065175 1:70927549-70927571 CCAGGAAATATTTCTAAATGTGG - Intronic
909621427 1:77671859-77671881 CCAGTAGATACCTGAATATGAGG + Intronic
912169910 1:107086917-107086939 CAAGTAGAAAACTGTATATGTGG - Intergenic
912647524 1:111408350-111408372 CCAGTTAATAAATGTAAAAGTGG - Intergenic
913296842 1:117329830-117329852 TCAGTAAATATATGTAAATATGG + Intergenic
919196375 1:194291942-194291964 CAAGTAAATAACTATAGATTAGG - Intergenic
920120720 1:203655022-203655044 GGAGGAAATAACTGTAGATGTGG + Intronic
920539620 1:206768465-206768487 TCAGTAAATAAATAGAAATGGGG + Exonic
921530003 1:216270353-216270375 ACAGAAAATAAATATAAATGAGG + Intronic
922080743 1:222293478-222293500 CCAGTAGAGAAGTGGAAATGTGG - Intergenic
922149591 1:222986869-222986891 CCACAATATAACTGTAAATGTGG - Intronic
1064485438 10:15783882-15783904 CCAGTTAATTACTGGAAATAGGG - Intronic
1065585622 10:27214710-27214732 CCAGTGAATTACAGTCAATGTGG + Intronic
1066151758 10:32629261-32629283 CCAGTCAAAAACTGTAAAAAGGG - Intronic
1067097286 10:43310257-43310279 CAAGTAAATAAATGTAAGTGTGG - Intergenic
1067697826 10:48548354-48548376 CTAGTGAGTAACCGTAAATGGGG - Intronic
1071746488 10:88425564-88425586 CCAATAAATCATTGTTAATGAGG - Intronic
1072968915 10:99999751-99999773 CCAGTAAATACGTGAAACTGTGG - Intronic
1076013942 10:127012918-127012940 CCAGGAAACAACTGTGACTGAGG + Intronic
1076206440 10:128608145-128608167 ACAGGAAATAAATGAAAATGTGG - Intergenic
1078075497 11:8156298-8156320 CCAGTAACTGACTGAAAAGGTGG - Intronic
1078955695 11:16192067-16192089 CCTGTAAATTGCTGTGAATGGGG - Intronic
1080015079 11:27496287-27496309 CAAGAAAATAAATGGAAATGGGG + Exonic
1080436338 11:32248348-32248370 CCATTAAAAAAATGTAGATGTGG - Intergenic
1080471818 11:32553112-32553134 GCAATAAATAACTGGAACTGAGG - Intergenic
1081836671 11:46161033-46161055 AAAGTAAATAAAAGTAAATGGGG + Intergenic
1087296444 11:96380975-96380997 ACAGTTAATAACTGTAACAGAGG + Intronic
1087705498 11:101486321-101486343 CCAAAAAATAACTATAAAGGAGG + Intronic
1089181156 11:116583684-116583706 GCAGTAAATGAATGTAAGTGAGG + Intergenic
1090539203 11:127681920-127681942 CAAATAAATAACTTTAAATATGG + Intergenic
1091359399 11:134963421-134963443 CCAGTGAATAGCTGAAATTGTGG - Intergenic
1092693496 12:11143050-11143072 CTAGTATAACACTGTAAATGTGG + Intronic
1093199734 12:16172225-16172247 ACAGTGCATAAATGTAAATGTGG + Intergenic
1094776704 12:33737912-33737934 CCATTAAAAAACTGAAATTGTGG + Intergenic
1095851165 12:46808353-46808375 CCATTATATAACTGAAAAGGTGG - Intronic
1096906331 12:54939897-54939919 AGAGGAAATAACTGTAGATGTGG + Intergenic
1097308597 12:58095122-58095144 AAAGTAAATAACTCCAAATGAGG + Intergenic
1097536492 12:60877004-60877026 TGAGGAAATAACTGTAAATGTGG + Intergenic
1099174299 12:79402875-79402897 CCAGTATGTAACTGTTAATCTGG - Intronic
1099335712 12:81354553-81354575 GGAGGAAATAACTGCAAATGTGG - Intronic
1099406241 12:82266776-82266798 CTAGTAAAGAAGTTTAAATGTGG - Intronic
1101588047 12:106102018-106102040 CCACTAAATAACTGTGGAGGAGG - Intronic
1101662953 12:106782850-106782872 CCAGTAAATATTTGTCAGTGTGG + Intronic
1105886233 13:24644531-24644553 CCAAGAAATAACTGTAAAAATGG + Intergenic
1106740187 13:32632502-32632524 CCAGAAAATAACTGTTGAAGAGG + Intronic
1107646475 13:42499273-42499295 CCAGAAAATATATGTCAATGTGG - Intergenic
1109077094 13:57849810-57849832 GAAGTAAGTAACTGTAGATGTGG - Intergenic
1110109543 13:71727622-71727644 CCAATAAAGAGCTGAAAATGAGG + Intronic
1110192379 13:72745322-72745344 CTAGTAAATAAGTGGAAAAGAGG + Intronic
1110278024 13:73661320-73661342 CCCATCAATAACTGCAAATGTGG - Intergenic
1111208044 13:85038234-85038256 CCAGTTAATCAATGTAAATATGG - Intergenic
1111294760 13:86264220-86264242 CCAGTATGTAACAGTAAAAGGGG - Intergenic
1111865338 13:93761189-93761211 TCAGTAAATAACTATGAATTAGG + Intronic
1114970795 14:28026309-28026331 GCATTAAATAAATGTAAGTGAGG - Intergenic
1116202365 14:41814446-41814468 CCAGTAAATCTTTGTAAATAGGG - Intronic
1116379933 14:44253637-44253659 CAAGTGAATAAATATAAATGTGG + Intergenic
1117494719 14:56291376-56291398 CCAGTAGAGAACAGCAAATGAGG - Intronic
1117529785 14:56648931-56648953 CCAGTAAATAAATCTCAAAGGGG + Exonic
1117784277 14:59266355-59266377 ACAGAATATAACTGTAGATGTGG - Intronic
1119900464 14:78255135-78255157 CAGGTAAATGACTGTCAATGGGG - Intronic
1120133772 14:80839363-80839385 TCATTTAATAACTGTACATGTGG + Intronic
1122011598 14:98753730-98753752 CCAGTTCCTAGCTGTAAATGAGG - Intergenic
1122889238 14:104724854-104724876 CCAGGTGATCACTGTAAATGAGG - Intronic
1124077481 15:26460146-26460168 CCATAAAATCTCTGTAAATGAGG + Intergenic
1124869780 15:33529247-33529269 CCGGTAACTAAATATAAATGCGG - Intronic
1125355494 15:38813348-38813370 CCAGTAAATACTTGTTAATGAGG - Intergenic
1125797825 15:42416603-42416625 CTAGTAAATCTCTGTAAATGTGG - Exonic
1126307488 15:47277008-47277030 GGAGGAAATAACTGTAGATGTGG + Intronic
1126797978 15:52275684-52275706 CCAGTCCATAATTGTAAGTGGGG - Exonic
1127949234 15:63788297-63788319 ACAGTAAATAACTGTTAAATTGG - Intronic
1128151180 15:65364407-65364429 CTAGTTAGTAACAGTAAATGTGG - Intronic
1132673406 16:1111792-1111814 CTAGGAAATGACTGCAAATGAGG + Intergenic
1135123987 16:19791519-19791541 CCAGTATGTAACAGTAAAAGGGG + Intronic
1135654290 16:24234158-24234180 CCAAAAAATAACTGTAAAAACGG - Intergenic
1139159280 16:64484189-64484211 ACAGTAAATAACTGTAAGGGAGG - Intergenic
1145848742 17:28069641-28069663 CCAATAAATACATGAAAATGTGG - Intronic
1146503762 17:33386767-33386789 GCAGTAAATGACACTAAATGAGG - Intronic
1146544758 17:33728504-33728526 CCGATAAATAACTGTAAGGGAGG - Intronic
1146726117 17:35157500-35157522 CCAGGAAATAATTATAAATGTGG - Intronic
1148285477 17:46386861-46386883 CCAGTAATTAAATATAAAAGTGG + Intergenic
1148307640 17:46604461-46604483 CCAGTAATTAAATATAAAAGTGG + Intronic
1149518299 17:57297944-57297966 GCAGGAAATAACTGCAGATGTGG - Intronic
1150190791 17:63236119-63236141 CAAGGAAATAAATTTAAATGAGG + Intronic
1154495698 18:14958607-14958629 CCAGTGAATAGCTGAAATTGTGG + Intergenic
1155858484 18:30866158-30866180 CAAGGAAATGACTCTAAATGTGG + Intergenic
1155932982 18:31725771-31725793 CCAGTTAATTACTTTGAATGTGG - Intergenic
1156061966 18:33089090-33089112 CCAGAAAATTACTGAAAAAGTGG + Intronic
1157101566 18:44734726-44734748 CCAGGAAATGACTGTTACTGCGG - Intronic
1157140150 18:45097576-45097598 CCAATAAACAAATGGAAATGTGG + Intergenic
1159766461 18:72495707-72495729 CCAGTAATTAACTATTAATATGG + Intergenic
1162185043 19:8898239-8898261 CCAGTGAAGAGCTGGAAATGAGG + Intronic
1162338091 19:10073911-10073933 CCAGAACATAGCTGTAACTGTGG - Intergenic
1164585310 19:29466751-29466773 TTAGTAATTAAATGTAAATGAGG + Intergenic
1164791247 19:30984155-30984177 CCAGTATATAAATTTAAATTTGG + Intergenic
1167206199 19:48104266-48104288 CCAGTAAATTATTGAACATGAGG + Intronic
925508011 2:4590944-4590966 TGAGAAAATAACTGCAAATGTGG + Intergenic
926420528 2:12692338-12692360 GTAGTAAATACCTATAAATGTGG - Intergenic
927003089 2:18819569-18819591 CAAGGAAATAACTGTTATTGCGG - Intergenic
927590588 2:24353782-24353804 TAAGGAAATAACAGTAAATGTGG + Intronic
928825626 2:35417617-35417639 CCAGTAAATGACAGTACATGAGG + Intergenic
929542257 2:42831375-42831397 CCAGTGAGTACCTGTAAGTGTGG - Intergenic
929751337 2:44716783-44716805 ACATTAAATAAATGTAAATGAGG - Intronic
931823806 2:65978758-65978780 ACAACAAATAACTGAAAATGGGG - Intergenic
932060022 2:68487239-68487261 ACAGTAAAGAACTGGAAATAAGG - Intronic
932311801 2:70748734-70748756 CAAGTATATTACTTTAAATGTGG + Intronic
933470755 2:82720436-82720458 CTAGTGAATAACTGAAATTGAGG + Intergenic
933583423 2:84152970-84152992 CCAGCAAATAAATGTGAAAGTGG - Intergenic
936726428 2:115323383-115323405 GCAGGAAATAACTGCAGATGTGG - Intronic
936875001 2:117178258-117178280 CTTATAAATAAATGTAAATGGGG - Intergenic
937648889 2:124298101-124298123 CCAGTAAATAATTGGATATGTGG - Intronic
938491400 2:131763093-131763115 CCAGTACACAGCTGTAAATCAGG - Intronic
938496162 2:131799233-131799255 CCAGTACACAGCTGTAAATCAGG + Intronic
938837815 2:135125463-135125485 TAAATAAATAAATGTAAATGAGG + Intronic
939128619 2:138206751-138206773 ACAGTAAATATGTGAAAATGGGG - Intergenic
939260692 2:139805007-139805029 CCAATAAATCACTGTACATCTGG - Intergenic
939719313 2:145628283-145628305 ACAGTACAGAACTGTAAATTTGG + Intergenic
941218218 2:162739920-162739942 TCATTAAAGCACTGTAAATGGGG + Intronic
942325288 2:174771367-174771389 TCAGTAAATAACTGCTGATGAGG + Intergenic
942515647 2:176750109-176750131 CTACAAAATAACTGTAATTGTGG - Intergenic
943123335 2:183765378-183765400 GCAGGAAGTAACTGCAAATGTGG - Intergenic
943150483 2:184106427-184106449 ACAGTAAATAGCTGAAAATCTGG + Intergenic
943888737 2:193257548-193257570 CCAGTAAATAGCTGTAACTGGGG + Intergenic
946760684 2:222990240-222990262 GCTGTAAATACCTGAAAATGTGG - Intergenic
1169964461 20:11199334-11199356 CCAATAAAGAACTGTCCATGTGG + Intergenic
1170159916 20:13300396-13300418 CCAATAAATAAATATAAAAGGGG + Exonic
1172533248 20:35649123-35649145 CCAGTAAAACAATTTAAATGTGG + Exonic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174356375 20:50000904-50000926 CCAGAAAATCACTGTGACTGTGG - Intergenic
1175007136 20:55696615-55696637 CCAGCAAACAACTATAAATCTGG + Intergenic
1182188421 22:28432502-28432524 CCAGTAAATAACTGTAAATGTGG - Intronic
1182483890 22:30627751-30627773 CCACTAAAATACTGAAAATGAGG + Intergenic
949675550 3:6448938-6448960 CCAGTAACAAACACTAAATGAGG - Intergenic
950154545 3:10711747-10711769 CCATTAAAAGACTCTAAATGTGG + Intergenic
950515572 3:13462834-13462856 CCAGCAAGTAACTGGTAATGTGG + Intergenic
951955685 3:28250714-28250736 CCAGTAGATAGTTGAAAATGTGG + Intronic
952475645 3:33707423-33707445 TAATCAAATAACTGTAAATGGGG + Intronic
952674055 3:36005625-36005647 CCAGGATATAATTATAAATGTGG + Intergenic
953887950 3:46728442-46728464 CCAGAAAAAAAGGGTAAATGAGG + Intronic
954535121 3:51354227-51354249 CCACCAAATAATTTTAAATGGGG - Intronic
956883858 3:73538608-73538630 CCAGGAAACTACTCTAAATGAGG - Intronic
957932715 3:86902908-86902930 CCAGTGAATATCTGAAAATGGGG + Intergenic
957951089 3:87127789-87127811 GCAATAAATAACTGGAAATGAGG - Intergenic
958145098 3:89613764-89613786 CCAGCAAACAACAATAAATGTGG - Intergenic
964913354 3:161809456-161809478 CTAGTAAATTACTGAACATGAGG - Intergenic
966416855 3:179698055-179698077 CCTGTAAATGTCTGTGAATGGGG - Intronic
966740238 3:183225908-183225930 CCAGTAAATAACTTAAACTTTGG - Intronic
967945776 3:194802558-194802580 CAAGCAAATAACAGTACATGTGG - Intergenic
968090976 3:195897995-195898017 CCTGTAAATGTCTGGAAATGCGG - Intronic
968250732 3:197210106-197210128 CCAGTAAATTACTGAACCTGAGG + Intronic
970152870 4:13108106-13108128 ACAATAAATACCTGAAAATGTGG - Intergenic
970884507 4:20972115-20972137 AGAAGAAATAACTGTAAATGTGG - Intronic
972364272 4:38359621-38359643 CCTGTAGAATACTGTAAATGTGG + Intergenic
973055035 4:45646249-45646271 GGAGGAAATAACTGAAAATGTGG - Intergenic
975870310 4:78773271-78773293 CCAGTAAATGCCTGAAAGTGAGG - Intergenic
976433059 4:84986000-84986022 CAAGGAAATAACTGCAGATGTGG + Intergenic
976609689 4:87017393-87017415 ACAATAAAGAACTGTATATGGGG - Intronic
977919956 4:102632057-102632079 TCAGTAAATATCTGTTAAGGAGG + Exonic
978196152 4:105974397-105974419 CCAGTAAACAGTTGGAAATGTGG - Intronic
978486291 4:109257833-109257855 CCAGAAAAGAACTGTGAAGGAGG + Intronic
979011119 4:115370287-115370309 GCAGTAGGTAACTGTACATGGGG + Intergenic
980719570 4:136677029-136677051 GAAGGAAATAACTGTAGATGTGG - Intergenic
981489266 4:145322397-145322419 CGAATAAATATCTGTATATGGGG - Intergenic
982525516 4:156472974-156472996 TCATAAAATAAGTGTAAATGTGG + Intergenic
982855545 4:160377736-160377758 CTAGTAAATAACTGTCAAATAGG - Intergenic
982975048 4:162045773-162045795 TCAGTTAATAACTGGAAAAGTGG - Intronic
985918513 5:2947483-2947505 CCAGAAATTAACTGTACCTGGGG + Intergenic
986464726 5:8009912-8009934 GCAGTAAATATCTTTAAATTGGG + Intergenic
987650095 5:20730087-20730109 CAACTAAATAGTTGTAAATGAGG + Intergenic
989754068 5:44930921-44930943 CCAGGGAATAAATGTAAAGGAGG - Intergenic
990430227 5:55727564-55727586 CCAGTTAAGAACAGGAAATGAGG - Intronic
990819132 5:59817616-59817638 TCAGTAAATAAGTTTAAATGTGG + Intronic
991115056 5:62945630-62945652 CAAAGAAATAACTCTAAATGGGG - Intergenic
991119531 5:62994998-62995020 GCAGTAGATACCTGAAAATGTGG - Intergenic
991557870 5:67915680-67915702 CCCATAAATGACTATAAATGTGG - Intergenic
992985625 5:82226068-82226090 CCAGTAAAGAAATGTGAATTTGG - Intronic
993687132 5:90951611-90951633 AAAGTAAATAACTTTTAATGGGG + Intronic
996886465 5:128361063-128361085 CCAGTATCTCACTGAAAATGAGG + Intronic
996909772 5:128642059-128642081 CCAGGAAGTAACTGTGAGTGAGG - Intronic
998919753 5:147055034-147055056 CCAGAAAAAAACAGGAAATGGGG + Intronic
999005432 5:147971446-147971468 GAAGTAATTAACTGTAACTGTGG - Intergenic
999044660 5:148453898-148453920 CCAGGAAGTAGCTGTAAAGGTGG + Intronic
999601192 5:153267137-153267159 CAACTAAATAATTGTATATGTGG - Intergenic
999620059 5:153463722-153463744 TCAATAAATAACTGTAAAAATGG - Intergenic
1001429059 5:171645293-171645315 CCAGGAAGGAAATGTAAATGAGG - Intergenic
1001724057 5:173881909-173881931 CCACTAAATCTTTGTAAATGGGG - Intergenic
1001826245 5:174747360-174747382 CGAGTAAAAGACTCTAAATGGGG + Intergenic
1003714762 6:8634006-8634028 CCAGTAAATACCTGTACAACAGG - Intergenic
1004133361 6:12942658-12942680 CAAATAAATAAATGTAAATAAGG + Intronic
1004718826 6:18246828-18246850 GGAGTAAATAACTGTGAATTTGG - Intronic
1005213618 6:23498755-23498777 CCTGTAAAATACTGTAAATGTGG - Intergenic
1005652732 6:27899296-27899318 CCAGTAAATTACATAAAATGAGG - Intergenic
1006078377 6:31548993-31549015 CCAGTGAATAACTGTAACTCTGG - Intronic
1006959426 6:37913493-37913515 GAAGGAAATAACTGTAGATGTGG - Intronic
1008916990 6:56798897-56798919 CCAGGAAGTAACTGCAGATGTGG + Intronic
1009730742 6:67602374-67602396 GCAGTAATTAAGTTTAAATGAGG + Intergenic
1009960885 6:70519183-70519205 GGAGAAAATAACTGCAAATGTGG + Intronic
1012236510 6:96822861-96822883 ACAGTACATGACTGTAAATGAGG - Intronic
1012626087 6:101404517-101404539 CCAGGCAATAAATGTAATTGGGG - Intronic
1012844464 6:104372274-104372296 CCAGGAAAGCACTGTGAATGAGG + Intergenic
1014016721 6:116539458-116539480 ACAGTAAATAATAGTATATGTGG - Intronic
1016579605 6:145615522-145615544 GCTGTAAATACCTGAAAATGAGG + Intronic
1018818416 6:167353537-167353559 GCAGAAAGTAACTGTAGATGAGG + Intronic
1021207318 7:17798762-17798784 AAAGTAAATTAATGTAAATGAGG + Intronic
1025987669 7:66468941-66468963 CCAATAAATATCTGTAAAGGTGG - Intergenic
1026119466 7:67524285-67524307 TCAAGAAATAACTGTAAAAGTGG - Intergenic
1027511966 7:79094376-79094398 GAAATAAATAACTGCAAATGGGG - Intronic
1027691266 7:81348669-81348691 TCAGTGAAAAACTGTCAATGGGG - Intergenic
1027845971 7:83375495-83375517 CCAGTATAGAACTGTATATCTGG - Intronic
1028437130 7:90816805-90816827 CCAGTAAATCACTGAATCTGAGG + Intronic
1029019886 7:97353549-97353571 CCATTAAATAACTGCAAGTCAGG - Intergenic
1031755899 7:125642049-125642071 ACAATAAATAACTGTTAATCAGG + Intergenic
1031774208 7:125886058-125886080 CCTGTAGATAGATGTAAATGTGG + Intergenic
1031838692 7:126710647-126710669 GGAGGAAGTAACTGTAAATGTGG - Intronic
1032533049 7:132637712-132637734 CAAGCAAATAACTGAAAATGAGG + Intronic
1032817913 7:135496057-135496079 CAAGAAAATAACTGTAAAAATGG - Intronic
1036570366 8:9975070-9975092 CCTCCAAATAACTGGAAATGGGG - Intergenic
1037856767 8:22377069-22377091 CCAATAAATAAATGTACAAGAGG - Intronic
1039076597 8:33695515-33695537 CCATTAAAGAATTTTAAATGAGG + Intergenic
1041874706 8:62674713-62674735 CCAGCAAATCTCTGTAAATGGGG + Intronic
1042794902 8:72651294-72651316 CTAGTAAATAATTTTCAATGAGG + Intronic
1044461351 8:92448045-92448067 GCAGAAAATAACTGCAGATGTGG + Intergenic
1044563562 8:93638330-93638352 CCAGTAAATAGCCATAAATAGGG - Intergenic
1044640056 8:94370036-94370058 GGAGGAAGTAACTGTAAATGTGG + Intergenic
1044647031 8:94454689-94454711 CAAGTAAACAACTGTATAAGTGG - Intronic
1045600150 8:103705699-103705721 CAAGTAAAAAACTGTAAAAATGG - Intronic
1045919795 8:107515905-107515927 CCAGAAAATAAGTCTAACTGTGG + Intergenic
1050264158 9:3872327-3872349 ACAGTAGATACCTGAAAATGTGG - Intronic
1053510428 9:38683239-38683261 CCAGTAAATTACTAAAACTGAGG + Intergenic
1054942768 9:70761546-70761568 CAAGAAAATGACTGAAAATGTGG + Intronic
1055469120 9:76594024-76594046 TCAGGAAATAACTGTAAAAATGG - Intergenic
1057329679 9:94101769-94101791 CCAGTTAATGACTGTAACTGAGG + Intronic
1059080756 9:111246750-111246772 GCAGCTAATAACTGTAAAAGGGG + Intergenic
1059626367 9:116071237-116071259 GCAGTTAATTACTGTTAATGAGG + Intergenic
1059660285 9:116393365-116393387 CCAGCAACTGACTGTAAAAGTGG + Intronic
1061857649 9:133451085-133451107 CCATTAAAGAATTGTAAATGAGG - Intronic
1062231158 9:135482000-135482022 CCAGTCAGAAGCTGTAAATGTGG + Intronic
1189635699 X:43006246-43006268 CCAAAAAATAACTGTACATCTGG - Intergenic
1192860497 X:75064049-75064071 GCAGTAATAAAGTGTAAATGTGG + Intronic
1193328689 X:80212207-80212229 CAAGTAAAAAACTGAAACTGTGG - Intergenic
1193641529 X:84014767-84014789 CCAGAAAATTGCTCTAAATGAGG + Intergenic
1193780955 X:85700412-85700434 CCAGTAAATGACTGAAACTGTGG + Intergenic
1193862215 X:86683465-86683487 ACAGTAAAACACTGAAAATGAGG - Intronic
1194560974 X:95419870-95419892 CCAATAAATACTTGTATATGGGG - Intergenic
1194755770 X:97737551-97737573 CCAGTGAAAAAATGAAAATGTGG + Intergenic
1194833414 X:98653676-98653698 ACAGCAAATAACTGTGATTGTGG + Intergenic
1196384546 X:115135046-115135068 GGAGGAAATAACTGTAGATGTGG + Intronic
1196547846 X:116985169-116985191 GGAGGAATTAACTGTAAATGTGG - Intergenic
1196717794 X:118827019-118827041 ATAGTAAAAAACTGTAAAGGGGG + Intergenic
1197234794 X:124048728-124048750 CCACTAAAGAACTGTAAAGAAGG - Intronic
1197341971 X:125286080-125286102 AGAATAAATACCTGTAAATGTGG + Intergenic
1199795101 X:151187363-151187385 CCACTAATTAACTGTAAAGGAGG - Intergenic