ID: 1182191744

View in Genome Browser
Species Human (GRCh38)
Location 22:28468240-28468262
Sequence TGCAGCTGATCTACAAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182191742_1182191744 -9 Left 1182191742 22:28468226-28468248 CCCTGCAGCACGTCTGCAGCTGA 0: 1
1: 0
2: 3
3: 9
4: 135
Right 1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG No data
1182191740_1182191744 17 Left 1182191740 22:28468200-28468222 CCTCTCTGAGAAAAAGCTGAATG 0: 1
1: 0
2: 0
3: 16
4: 255
Right 1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG No data
1182191743_1182191744 -10 Left 1182191743 22:28468227-28468249 CCTGCAGCACGTCTGCAGCTGAT 0: 1
1: 0
2: 2
3: 23
4: 122
Right 1182191744 22:28468240-28468262 TGCAGCTGATCTACAAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182191744 Original CRISPR TGCAGCTGATCTACAAATGC TGG Intronic
No off target data available for this crispr