ID: 1182192511

View in Genome Browser
Species Human (GRCh38)
Location 22:28477442-28477464
Sequence ATTGAGAAGGCCAATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 671}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182192511_1182192514 25 Left 1182192511 22:28477442-28477464 CCAGCCACATTGGCCTTCTCAAT 0: 1
1: 0
2: 6
3: 64
4: 671
Right 1182192514 22:28477490-28477512 TTTAAAAAAAATAAAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182192511 Original CRISPR ATTGAGAAGGCCAATGTGGC TGG (reversed) Intronic
900798507 1:4723854-4723876 ATGGAAATGGACAATGTGGCAGG + Intronic
902097508 1:13958796-13958818 AGAGAGGAGACCAATGTGGCTGG + Intergenic
902351350 1:15857767-15857789 ACTGAGAAGGCTAAGGTGGGAGG - Intronic
903118835 1:21200524-21200546 CTTCAGAAGGCCAAGGTGGGTGG + Intergenic
903308715 1:22435107-22435129 ATTCAGGAGGCCAAAGTGGGAGG - Intergenic
903510588 1:23871887-23871909 ATTTAGGAGGCCAAGGTGGGCGG + Exonic
904180711 1:28664740-28664762 TTTAGGAAGGCCAGTGTGGCTGG + Intergenic
905107205 1:35571348-35571370 CTTGGGAAGGCCAGAGTGGCGGG - Intergenic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
905715851 1:40149258-40149280 AATGGCAAGACCAATGTGGCTGG + Intergenic
906077722 1:43064307-43064329 ATTCAGAAGGCTAACGTGACAGG - Intergenic
906131672 1:43462626-43462648 AGTAAGAAGGCCAACCTGGCCGG - Intergenic
906255140 1:44343003-44343025 ATTTAGAAGGCAACTGGGGCTGG - Intronic
906467730 1:46098807-46098829 ACTTGGAAGGCCAATGTGGGAGG - Intronic
906656517 1:47552295-47552317 CTTGAGCAGGCCCTTGTGGCTGG - Intergenic
906937504 1:50226932-50226954 AATGAGGAGGCCAATGTGGCTGG + Intergenic
906966213 1:50459215-50459237 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
907077182 1:51589690-51589712 AACAAGAAAGCCAATGTGGCTGG + Intronic
907316390 1:53575367-53575389 ATGGAGGAGGCCAAAGAGGCAGG - Intronic
907579132 1:55556126-55556148 AATGAGAAAGCAAATGGGGCAGG - Intergenic
908105963 1:60842624-60842646 ACTGAGTAGACCAATGTGACTGG + Intergenic
908191031 1:61703997-61704019 GTTGAGGAGGCCAAGGTGGGTGG - Intronic
908297048 1:62723186-62723208 ATTTGGAAGGCCAAGGTGGGAGG + Intergenic
908518218 1:64915104-64915126 ATTGTGAAGGTAAATGAGGCAGG + Intronic
909679065 1:78271009-78271031 AGCAAGAAGGCCAATGTGGTTGG - Intergenic
909862441 1:80625274-80625296 ATTTGGGAGGCCAATGTGGGAGG - Intergenic
910006782 1:82406982-82407004 ATTTGGAAGGCCAAAGTGGAAGG + Intergenic
910241098 1:85086982-85087004 AATGAGGAAGCCAGTGTGGCTGG - Intronic
910646110 1:89517186-89517208 AGGGACAAGGCCAATGAGGCTGG + Intergenic
911131589 1:94393852-94393874 AGTCATAAGGCCCATGTGGCAGG + Intergenic
911191958 1:94957235-94957257 ATTTAGGAGGCCAAGGTGGGAGG - Intergenic
911556593 1:99352598-99352620 ATTCAAAAAGCCAAAGTGGCTGG - Intergenic
911701847 1:100962554-100962576 ATAAAAAAGGCCATTGTGGCTGG + Intronic
911702112 1:100965985-100966007 ATTTACAAGGCCAATGTGAGAGG + Intronic
912469154 1:109894768-109894790 GTAAAGAAGGCGAATGTGGCTGG + Intergenic
912670832 1:111622375-111622397 ATGTAGGAGGCCAGTGTGGCTGG - Intronic
912808802 1:112777863-112777885 TTTGGGAAGGCCAAGGTGGGTGG + Intergenic
913414979 1:118595251-118595273 AATGAAGAGGCCAGTGTGGCAGG - Intergenic
913578729 1:120204580-120204602 ATTTGGGAGGCCAATGTGGGAGG - Intergenic
913629444 1:120693789-120693811 ATTTGGGAGGCCAATGTGGGAGG + Intergenic
914560658 1:148816021-148816043 ATTTGGGAGGCCAATGTGGGAGG - Intronic
914612176 1:149314194-149314216 ATTTGGGAGGCCAATGTGGGAGG + Intergenic
915330054 1:155105816-155105838 ATGAAGAAGCCCAGTGTGGCTGG + Intergenic
916511323 1:165474577-165474599 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
916623159 1:166523975-166523997 AGAAAGAAGGCCAGTGTGGCTGG + Intergenic
916761119 1:167818832-167818854 ATTTAAAAAGCCAAAGTGGCCGG - Intronic
916796602 1:168173302-168173324 AGCAAGAAGGCCAGTGTGGCTGG - Intergenic
917180388 1:172290450-172290472 AATAAAAAGGCCAATGTGGCTGG + Intronic
917603775 1:176604022-176604044 AGTCAGAAGGCCAGTGTGGCTGG - Intronic
918456911 1:184730336-184730358 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
919635604 1:200000369-200000391 ATTTGCAAGGCCAAGGTGGCTGG - Intergenic
919939724 1:202277964-202277986 AGTGACCAGGCCAGTGTGGCTGG + Intronic
920612695 1:207456867-207456889 AAAGAGAAGGCCAGTGTGGCTGG - Intronic
921678253 1:218001511-218001533 AAAGAGAAGGCCAGTGTGGCTGG - Intergenic
921791528 1:219295925-219295947 AATGAGTAGGTCAATGTGGCTGG - Intergenic
921992270 1:221380162-221380184 AATAAGAAAGCCAATGTAGCTGG - Intergenic
922123161 1:222695193-222695215 TTTAAGAAGACCATTGTGGCCGG + Intronic
922303928 1:224327916-224327938 TTTGAGAAGGTCTGTGTGGCTGG + Intronic
922940676 1:229462664-229462686 ATTCAGGAGGCTAAGGTGGCAGG - Intronic
1063201689 10:3790523-3790545 AGTGACAAGCCAAATGTGGCTGG + Intergenic
1063395136 10:5679494-5679516 ATTGAGAAGTCAAGAGTGGCAGG + Intergenic
1063619050 10:7628082-7628104 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1063787824 10:9405890-9405912 ATTGGCAAGGGCAATGTTGCAGG + Intergenic
1064021840 10:11815207-11815229 ATGGAGTAGGCCACTCTGGCAGG - Intergenic
1064488261 10:15820291-15820313 AGTGAGAGGACCAGTGTGGCTGG + Intronic
1065563281 10:26984709-26984731 AATGGGAAGGCCCATGTGTCAGG - Intergenic
1065591394 10:27265767-27265789 ATTCAGGAGGCCAAGGTGGAAGG - Intergenic
1065627316 10:27644766-27644788 ACTCAGAAGGCCAAAGTGGGAGG - Intergenic
1066429857 10:35341189-35341211 AGGAAGGAGGCCAATGTGGCTGG - Intronic
1066468158 10:35671296-35671318 ATTCAGGAGGCCAAGGTGGGAGG - Intergenic
1067456556 10:46423307-46423329 GTGAAGAAGGCCAGTGTGGCTGG - Intergenic
1067630645 10:47961332-47961354 GTGAAGAAGGCCAGTGTGGCTGG + Intergenic
1068631479 10:59303100-59303122 AGAGAGAAGGCCAGGGTGGCTGG - Intronic
1069974559 10:72202221-72202243 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1070030567 10:72673018-72673040 CTTTGGAAGGCCAATGTGGGAGG - Intergenic
1070165942 10:73898160-73898182 CTTGAGGAGGCCAAGGTGGGAGG - Intergenic
1071097406 10:81993843-81993865 ATTGAGAAAGCCCATGAAGCTGG + Intronic
1071530984 10:86390125-86390147 AGACAGAAGGCCAGTGTGGCTGG + Intergenic
1072063445 10:91840094-91840116 ATTTGGAAGGCCAAGGTGGGAGG + Intronic
1072790452 10:98313943-98313965 TTTGAAAATGCCAATGTGGATGG - Intergenic
1072926840 10:99623218-99623240 AGAAAGAAGGCCAGTGTGGCTGG + Intergenic
1073171322 10:101511222-101511244 AGACAGAAGGCCAATGTGGCTGG - Intronic
1073192768 10:101663546-101663568 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
1073563281 10:104515269-104515291 TTTAAGAAGCCAAATGTGGCTGG + Intergenic
1074124161 10:110515047-110515069 TGTCAGAAAGCCAATGTGGCTGG - Intergenic
1074591160 10:114814500-114814522 CTTAGGAAGGCCAGTGTGGCTGG - Intergenic
1074622671 10:115142371-115142393 AGTAAAAAGGCCATTGTGGCTGG + Intronic
1074728118 10:116336314-116336336 AATAATAAGGCCACTGTGGCTGG + Intronic
1074948718 10:118306600-118306622 ATCATGAAAGCCAATGTGGCAGG + Exonic
1075649432 10:124117979-124118001 TTTGAGTAGGCGCATGTGGCTGG + Intergenic
1077749733 11:4953668-4953690 ATTCAGTAGGTCAATGTGGCTGG + Intronic
1078078240 11:8180916-8180938 AATGGGGAGCCCAATGTGGCTGG - Intergenic
1078147573 11:8732100-8732122 ATTGAGGAAGCCAATGGGGTGGG + Intronic
1078183873 11:9034735-9034757 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1078921733 11:15837068-15837090 AGCCAGAAAGCCAATGTGGCTGG + Intergenic
1079251954 11:18793022-18793044 ATTAAAAAGGCCAATGTGACTGG - Intergenic
1079413435 11:20210675-20210697 AGAGAGAAGGCCAGTGTGCCTGG + Intergenic
1079455059 11:20629241-20629263 GTTGAGAAGGACAAAGGGGCAGG - Intronic
1079846938 11:25484415-25484437 ATCAAGAAGGCCAATGTTACTGG - Intergenic
1080289149 11:30651611-30651633 TTTGGGACGGCCAATGTGGGAGG + Intergenic
1080305244 11:30828147-30828169 ATCAGGAAGGCCAGTGTGGCTGG - Intergenic
1080576440 11:33603823-33603845 AAAAAGAAGGCCACTGTGGCTGG + Intronic
1080708132 11:34718769-34718791 TAAAAGAAGGCCAATGTGGCTGG + Intergenic
1080924327 11:36740253-36740275 ATCAAGGAGGCCAGTGTGGCTGG + Intergenic
1081466150 11:43319654-43319676 CTTCAGAAGGCCAAGGTGGGAGG - Intronic
1081510756 11:43770482-43770504 CTTGAGAAGGCCAAAGTGGGAGG + Intronic
1081795706 11:45817937-45817959 AGAGAGAAGGCCAGGGTGGCAGG + Intergenic
1081933750 11:46890306-46890328 ATCGAGAGGGCCAATCTGGATGG - Exonic
1081934109 11:46893045-46893067 ATTGAGGTGGCCAATCTGGATGG - Exonic
1083215510 11:61216429-61216451 CTTGGGAAGGCCAAGGCGGCAGG + Intergenic
1083218394 11:61235258-61235280 CTTGGGAAGGCCAAGGCGGCAGG + Intergenic
1083411749 11:62498513-62498535 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1083545093 11:63543407-63543429 ATTCAGAAGGCTGATGTGGGAGG - Intronic
1083855900 11:65392970-65392992 TTTAAGAAGGCCAAGGTGGCAGG + Intronic
1083942901 11:65907460-65907482 AATTAGATGGCCATTGTGGCAGG - Intergenic
1084041346 11:66544496-66544518 AGCAAGAAGGCCAGTGTGGCTGG - Intronic
1084160923 11:67349670-67349692 ACTGAGGAGGCCAGTGAGGCTGG - Intronic
1085139518 11:74128157-74128179 ATTAAGATAGCCAATATGGCTGG - Intronic
1085248736 11:75127044-75127066 ATTGAAAAGGAAAATTTGGCTGG + Intronic
1085261683 11:75209212-75209234 AGTGACAAGAGCAATGTGGCTGG + Intergenic
1085937570 11:81168129-81168151 ATTGCGAAGGCCCATGTGGCAGG + Intergenic
1086026604 11:82300766-82300788 ATTGAGTATTCAAATGTGGCTGG + Intergenic
1086140462 11:83493091-83493113 AGCAACAAGGCCAATGTGGCAGG - Intronic
1086423934 11:86665475-86665497 ACTGAGGAGGCCAATGGGGTTGG + Intronic
1088175184 11:107045417-107045439 ATTTGGGAGGCCAATGTGGGAGG + Intergenic
1088378660 11:109169433-109169455 ATTGAGAAAGCCAGTATGGCTGG - Intergenic
1088412661 11:109552453-109552475 AATAAGGAGGCCAATGTGGCTGG + Intergenic
1089059318 11:115613332-115613354 AGTGAGAAGGCCCACGAGGCTGG - Intergenic
1089142209 11:116294600-116294622 CATGAGAAGCCCAAAGTGGCTGG - Intergenic
1089464561 11:118676362-118676384 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
1089478440 11:118785446-118785468 TTTGGGGAGGCCAATGTGGGAGG - Intronic
1089966914 11:122660842-122660864 CTTGGGAAGGACACTGTGGCAGG + Intronic
1090143232 11:124289004-124289026 ATTCAGAAGGCTAAGGTGGAAGG - Intergenic
1091481732 12:839479-839501 AGAGAGAAGGCCAAAGTGGATGG + Intronic
1092872709 12:12820457-12820479 GCTGAGAAGTACAATGTGGCTGG - Intronic
1092986863 12:13854266-13854288 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1093567671 12:20627579-20627601 ACTGAGAAGGCCTCTCTGGCTGG - Intronic
1094807057 12:34105205-34105227 ATTGAGAAGGTAGATGTGGGAGG - Intergenic
1095310778 12:40693737-40693759 CTTGAGAAGGCCAAGGCAGCCGG - Intronic
1095360003 12:41326090-41326112 ATTCAGGAGGCCAAGGTGGGAGG - Intronic
1095450059 12:42320970-42320992 AGAAAGAAGGCCAATGTGACTGG - Intronic
1095994426 12:48068115-48068137 TTTGGGAAGGCCAAGGTGGATGG - Intronic
1096872934 12:54605576-54605598 CTTTAGGAGGCCAAAGTGGCAGG - Intergenic
1097832866 12:64244031-64244053 AGAGAGAAGACCAATGTGGTGGG + Intergenic
1098745936 12:74236646-74236668 TATGAGAAGCCCAAAGTGGCTGG - Intergenic
1099573273 12:84352681-84352703 ATTTGGAAGGCCAAGGTGGGTGG - Intergenic
1099896811 12:88658569-88658591 CTTAGGAAGGCCAATGTGGGAGG + Intergenic
1100225895 12:92555360-92555382 GGTGGGAAGGCCAGTGTGGCTGG - Intergenic
1100268593 12:93002104-93002126 ATTCAGGAGGCCAAGGTGGGAGG + Intergenic
1100361453 12:93883572-93883594 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1100497408 12:95138644-95138666 ATAAAGAAGGCCAGTGTGGTGGG - Intronic
1100554522 12:95679874-95679896 AGCAAGAAGGCCAGTGTGGCTGG - Intronic
1100726274 12:97412233-97412255 AGTCAGTTGGCCAATGTGGCTGG - Intergenic
1101344501 12:103873690-103873712 AAAAAGAAGGCCAATGTGGCTGG + Intergenic
1101650629 12:106674122-106674144 AATGAGGAGGCCCATGTGGCTGG - Intronic
1102114883 12:110395421-110395443 ACTCAGAAGGCCAAGGTGGGAGG - Intronic
1102123156 12:110458897-110458919 ACTGAAAAGGCCAGTGTGGCTGG - Intronic
1102287500 12:111670731-111670753 CTTTAGAAGGCCAAGGTGGGCGG - Intronic
1102368982 12:112365515-112365537 ATTGAGCAGTTGAATGTGGCTGG - Intronic
1102435844 12:112922548-112922570 ATTGATAAGGGCAATAGGGCAGG - Intronic
1102458551 12:113086363-113086385 CCTGAGAAGGCCAGTGTGGTTGG + Intronic
1102601630 12:114035842-114035864 ATTTAAAAGACCCATGTGGCTGG - Intergenic
1102819332 12:115894660-115894682 AGTGAGAAGGCCAGTGTGGTTGG + Intergenic
1103162795 12:118744088-118744110 CATGAGGAGGCCAGTGTGGCAGG + Intergenic
1103460736 12:121102820-121102842 ATTAAAATGGCCAACGTGGCTGG + Intergenic
1103492147 12:121329909-121329931 ATTGAAAAGGCTTATCTGGCTGG - Intronic
1104427104 12:128686951-128686973 ATTTAGGAGGCCAAGGTGGGTGG + Intronic
1104521027 12:129475276-129475298 ACAAAGAAGGCCACTGTGGCCGG + Intronic
1104527834 12:129540731-129540753 CTTTAGGAGGCCAAGGTGGCAGG - Intronic
1105059432 12:133134980-133135002 ATGGAGAAAGGAAATGTGGCTGG - Intronic
1106324424 13:28674545-28674567 TTTAAGAAGGCCCATATGGCTGG + Intronic
1106514227 13:30439261-30439283 ATTTGGAAGGCCAAGGTGGGCGG + Intergenic
1107461205 13:40605523-40605545 ATTGAGAAGTACAGTGTGGTTGG - Intronic
1107508281 13:41057508-41057530 ATTCAGGAGGCCAAGGTGGGAGG - Intronic
1108528237 13:51303925-51303947 ATTTAGGAGGCCAAGGTGGGAGG + Intergenic
1109011305 13:56948826-56948848 ATTTAGAAGGCCAATCTGGGAGG - Intergenic
1109289427 13:60455822-60455844 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1110730363 13:78873552-78873574 ACTTAGAAGTCCAAAGTGGCAGG + Intergenic
1111486624 13:88910148-88910170 ATTTAGGAGGCCAAGGTGGGTGG + Intergenic
1111940845 13:94604816-94604838 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1112202089 13:97286689-97286711 AATAAACAGGCCAATGTGGCTGG - Intronic
1113112978 13:106844455-106844477 ACTGAGGAGGCCAAGGTGGGAGG + Intergenic
1113200269 13:107859657-107859679 ATTTAGAAGGCCGAGGTGGGTGG + Intronic
1113332757 13:109346358-109346380 ATTGAGAAGTCCTATCAGGCAGG - Intergenic
1113602059 13:111576836-111576858 ATTCAGGAGGCCAAGGTGGGAGG - Intergenic
1114226446 14:20742976-20742998 CTTGAGAAGGTCAAAGTGGGAGG - Intronic
1114272525 14:21110918-21110940 TATGAGAAGGCCATTCTGGCAGG - Intergenic
1114457721 14:22867526-22867548 ATTTGGGAGGCCAATGTGGGTGG + Intergenic
1114506219 14:23216581-23216603 AATAATAAGGCCAATCTGGCTGG + Intronic
1114572623 14:23684211-23684233 AGCGAGAAGGCCAGTGTGGCTGG + Intergenic
1114846889 14:26333204-26333226 AGTGAGAAGGCCAGGGTGGCTGG - Intergenic
1115254221 14:31381437-31381459 ACTCAGAAGGCCAAGGTGGGAGG + Intronic
1115817182 14:37176137-37176159 TTTTAGAAGGCCAAGGTGGGAGG - Intergenic
1115919172 14:38353944-38353966 AGCAAGAAGGCCAGTGTGGCTGG - Intergenic
1117230835 14:53717188-53717210 ATTCAGGAGGCCAAGGTGGGTGG + Intergenic
1117370217 14:55071375-55071397 ACTCAGGAGGCCAAGGTGGCAGG + Intergenic
1117473192 14:56067462-56067484 AATGAGAAGGCAAGGGTGGCAGG + Intergenic
1117786803 14:59294194-59294216 GTTGTGAAGGCCAATGAGCCTGG + Intronic
1118571065 14:67196027-67196049 ATTTAGGAGGCCAAGGTGGGTGG - Intronic
1119160389 14:72447378-72447400 AATGAGGAGGGCATTGTGGCTGG - Intronic
1119200790 14:72751080-72751102 ACTGAGGAGGCCAAGGTGGAAGG + Intronic
1119271294 14:73307544-73307566 ACTGAGGAGGCTAGTGTGGCTGG + Intronic
1119313749 14:73673650-73673672 ACTTAGAAGGCCAAGGTGGGAGG + Intronic
1119831079 14:77703224-77703246 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1119852233 14:77874446-77874468 ATGGAGAAGGCCTTTGGGGCAGG + Intronic
1120457374 14:84749308-84749330 AGCAAGAAGACCAATGTGGCTGG - Intergenic
1120761387 14:88288726-88288748 AATGAGAAGACCAGTGTGGCTGG - Intronic
1121347390 14:93146170-93146192 ATTGAGAAGGCTAAGGGGCCAGG + Intergenic
1121805943 14:96822913-96822935 AGTAAGAATGCCAGTGTGGCTGG - Intronic
1124067640 15:26360933-26360955 ATTAAGATGGAAAATGTGGCTGG + Intergenic
1124772301 15:32550591-32550613 CTTTAGAAGGCCAAGGTGGTTGG + Intergenic
1125267310 15:37897983-37898005 AGAGAGGAGGCCAATGTGGCTGG - Intergenic
1125757685 15:42075030-42075052 ACTGAGGAGGCTAATGTGGGAGG - Intronic
1126642466 15:50841773-50841795 AATTAGCAGGGCAATGTGGCAGG + Intergenic
1127235879 15:57051429-57051451 TTTGAGAATGCCAATGTGACTGG - Intronic
1127470485 15:59285590-59285612 CTTGAGGAGGCCAAGGTGGGTGG - Intronic
1127528505 15:59818027-59818049 AATGGGAAGGGCAATGAGGCAGG + Intergenic
1127566301 15:60192227-60192249 AGTGAGAAGACCGAGGTGGCTGG + Intergenic
1127997104 15:64159643-64159665 CTTTGGAAGGCCAAGGTGGCTGG - Intronic
1128251687 15:66168181-66168203 GCTGAGAAGGCCACGGTGGCTGG - Intronic
1128363970 15:66983654-66983676 AGAGAGAAAGCCATTGTGGCTGG - Intergenic
1128614412 15:69098260-69098282 ACTGTGAAGGCCAGTGTGGTTGG + Intergenic
1128660209 15:69494602-69494624 ATAGAAAAGGCCCATATGGCTGG - Intergenic
1128831301 15:70771870-70771892 ATACTGAAGGCCAGTGTGGCTGG + Intergenic
1129346288 15:74921942-74921964 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1129408086 15:75332709-75332731 CTTCGGAAGGCCAAAGTGGCGGG - Intergenic
1129863998 15:78888356-78888378 ATTCAGGAGGCCGATGTGGGAGG + Intronic
1130475412 15:84261983-84262005 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1130482829 15:84376037-84376059 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1131205717 15:90444525-90444547 ATTTGGGAGGCCAAGGTGGCAGG - Intronic
1132118905 15:99159595-99159617 TTAGAAAAGGCCAGTGTGGCAGG + Intronic
1132361033 15:101215489-101215511 TCTGAGGAGGCCAATGTGGGTGG + Intronic
1134455030 16:14389002-14389024 ATTTAGGAGGCCAAGGTGGGAGG - Intergenic
1134659127 16:15970572-15970594 ATGAGGAAGGCCACTGTGGCTGG + Intronic
1135086406 16:19478113-19478135 AATGAGAAGGCCAGGGAGGCTGG - Intronic
1135164249 16:20124718-20124740 GCAGAGAAGGCCAATGTGGTGGG - Intergenic
1135521012 16:23178268-23178290 ATTTAGGAGGCCAAAGTGGGTGG + Intergenic
1135763479 16:25156591-25156613 GCTGGGAAGGCCAGTGTGGCTGG + Intronic
1136040700 16:27576530-27576552 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1136051921 16:27657224-27657246 ATTGAGAAGGAAAAAGTGGGAGG + Intronic
1136136426 16:28259240-28259262 AGTGAGAAGGCACAGGTGGCGGG + Intergenic
1136629454 16:31481018-31481040 AGAAAGAAGGCCACTGTGGCTGG + Intergenic
1137343594 16:47634599-47634621 AGAGAGGAGGCCTATGTGGCAGG + Intronic
1137406266 16:48192037-48192059 ACTTAGGAGGCCAATGTGGGAGG + Intronic
1137652451 16:50132170-50132192 ATTAAGGAGCCCAAAGTGGCTGG + Intergenic
1137756952 16:50910044-50910066 ATAGGGCAGGCCAGTGTGGCTGG - Intergenic
1138044369 16:53705388-53705410 TTTAAGAAGGCCAAAGTGACTGG - Intronic
1138564407 16:57822403-57822425 TTTTAAAATGCCAATGTGGCTGG + Intronic
1138725580 16:59135203-59135225 ATTTGGAAGGCCAAGGTGGGGGG + Intergenic
1139049354 16:63104308-63104330 TTTGAGGAGGCCAAGGTGGGAGG - Intergenic
1139135891 16:64204471-64204493 ATTATGAAGGAAAATGTGGCAGG - Intergenic
1139532818 16:67551423-67551445 CTTTAGAAGGCCAAGGTGGGAGG - Intergenic
1139575436 16:67839005-67839027 CTTTAGGAGGCCAAGGTGGCCGG + Intronic
1139827199 16:69766577-69766599 AGTCAGGAGGCCAGTGTGGCTGG - Intronic
1140466157 16:75184692-75184714 CTTTGGAAGGCCAATGTGGGTGG - Intergenic
1140490285 16:75329602-75329624 ATTAGGAAAGCCAATGAGGCAGG - Intronic
1140727857 16:77830134-77830156 AGTGAGAAGGTCAGGGTGGCTGG - Intronic
1140882224 16:79209259-79209281 ATTCAGAATGCCATTGTTGCAGG - Intronic
1141557642 16:84846495-84846517 CTTGAGGAGGCCAACGTGGGTGG - Intronic
1141589977 16:85061910-85061932 ACCGGGAAGGCCAATGAGGCCGG - Intronic
1141884995 16:86885336-86885358 AGAGACAAGGCCAGTGTGGCTGG - Intergenic
1142467914 17:146583-146605 AGAGAGAAAGCCAATGGGGCCGG - Intergenic
1142572873 17:886531-886553 CTTTGGAAGGCCAATGTGGGTGG + Intronic
1142871668 17:2825175-2825197 ATTTAGGAGGCCAAGGTGGGAGG - Intronic
1142952956 17:3498588-3498610 CTTGGGGAGGCCAATGTGGGTGG - Intronic
1143077521 17:4357067-4357089 ATTGAAAATGCCGATGGGGCAGG - Intronic
1143113598 17:4568068-4568090 CTTTAGAAGGCCAAGGTGGGCGG - Intergenic
1143402206 17:6653648-6653670 AGAAAGAAGGCCAGTGTGGCTGG + Intergenic
1143459265 17:7090393-7090415 ATTGAGAAGGCTAAGGTGGGAGG + Intergenic
1143570007 17:7751334-7751356 TTTTAGAAGGCCAAGGTGGGTGG - Intronic
1144006119 17:11101355-11101377 AGCCAGAAGGCCAGTGTGGCTGG + Intergenic
1144396814 17:14852305-14852327 ACAGAGAAGGCCAGGGTGGCTGG + Intergenic
1144538939 17:16120038-16120060 ATTGAGAAAGGGAATATGGCAGG - Intronic
1144939976 17:18932186-18932208 ACAGAGAAGGCCAGCGTGGCTGG - Intergenic
1146359107 17:32159692-32159714 CTAGAGGAGGCCAAAGTGGCAGG - Intronic
1146447367 17:32943099-32943121 ATCCAGAAAGCCAATGTGCCAGG - Exonic
1146486616 17:33248270-33248292 AGTGAGAAGGCCAGTGTAGGTGG + Intronic
1146803062 17:35842970-35842992 CTTTGGAAGGCCAAGGTGGCTGG - Intronic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1148086976 17:44999974-44999996 ATTTAGGAGGCCAAAGTGGGTGG + Intergenic
1148482174 17:47967174-47967196 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1148893431 17:50824485-50824507 AGAGAGAAGGCCAATAAGGCTGG + Intergenic
1149070645 17:52538098-52538120 ATTTAGAAGACATATGTGGCAGG + Intergenic
1149433015 17:56609561-56609583 ATGGAAAAGGCCAAGGTGGGTGG - Intergenic
1149832940 17:59887734-59887756 ACTTAGAAGGCCAAAGTGGGAGG - Intronic
1150095219 17:62368100-62368122 ACAGAGAAGGTCAGTGTGGCAGG - Intergenic
1150581561 17:66478495-66478517 CTTCAGAAGGCCAAGGTGGGTGG - Intronic
1150809232 17:68343663-68343685 ATTGCGAAGGCCAAGCCGGCCGG - Exonic
1151032766 17:70760335-70760357 TATGAAAAGGCCACTGTGGCTGG - Intergenic
1151459914 17:74248343-74248365 ATTGCTAAGGCCCATGCGGCAGG - Intronic
1151647180 17:75441259-75441281 AGAGAGAAGGCCAGTGTGGCTGG + Intronic
1151716409 17:75833228-75833250 GTAGAGGAGGCCAGTGTGGCTGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152827159 17:82473938-82473960 ATTTAGAAGGCTGATGTGGGAGG + Intronic
1153646275 18:7198925-7198947 ATGGAAAAGCCCAATATGGCTGG - Intergenic
1153725673 18:7952400-7952422 GTTGAAAATGCAAATGTGGCCGG + Intronic
1153809432 18:8738993-8739015 ATTGGGGAGGCCAAAGTGGGAGG + Intronic
1155756308 18:29501231-29501253 ATTTAGGAGGCCAAGGTGGGAGG - Intergenic
1155841721 18:30653397-30653419 ATTGAGAAGGTCAACATGGCTGG + Intergenic
1156368523 18:36451653-36451675 ATTCAGAAGGGCAACCTGGCAGG + Intronic
1156554650 18:38053474-38053496 GTTGAGAAGGCCCTTCTGGCTGG - Intergenic
1156928101 18:42607482-42607504 CTTTAGGAGGCCAATGTGGGTGG - Intergenic
1157167174 18:45368518-45368540 AGTCATAAGCCCAATGTGGCAGG - Intronic
1157315174 18:46580887-46580909 AGAGAGAAGGCCAATATGGCTGG + Intronic
1157646251 18:49275631-49275653 CTTTAGGAGGCCAATGTGGGAGG + Intronic
1157890474 18:51411255-51411277 AGAGAGAAGGCCAATGGGGCTGG + Intergenic
1157914141 18:51648087-51648109 TGACAGAAGGCCAATGTGGCTGG - Intergenic
1158159343 18:54462398-54462420 AAGAAGAAGGCCAGTGTGGCTGG - Intergenic
1160869474 19:1270469-1270491 ATTAAGAAGTCCTAGGTGGCTGG + Intronic
1160988416 19:1850847-1850869 AGCGAGGAGGCCAGTGTGGCTGG + Intergenic
1161068422 19:2249184-2249206 TTTGAGAAGGCCACTCTGCCTGG + Intergenic
1161205555 19:3039395-3039417 AGGGAGAAGGCCTGTGTGGCTGG - Intronic
1161215002 19:3090140-3090162 ATTCAGGAGGCCAAGGTGGGAGG - Intergenic
1161226163 19:3146934-3146956 AGTGAGGAGGCCCTTGTGGCTGG - Intronic
1161239332 19:3213328-3213350 AGTGAGGAGGCCCATGTGGCTGG + Intergenic
1161253085 19:3291711-3291733 AGTGAGGAGGCCCATGTGGCTGG + Intronic
1161267904 19:3373458-3373480 AGCGAGGAGGCCCATGTGGCTGG - Intronic
1161286445 19:3470979-3471001 AGTGAGGAGGCCTGTGTGGCTGG + Intergenic
1161289394 19:3484982-3485004 AGTGAGGAGGCCAGTGTGGCTGG + Intergenic
1161483013 19:4520024-4520046 AGTGAAAAGGCCCGTGTGGCTGG - Intergenic
1161649334 19:5474737-5474759 AGCGAGGAGGCCCATGTGGCTGG + Intergenic
1161650358 19:5480530-5480552 AACGAGGAGGCCCATGTGGCTGG + Intergenic
1161658840 19:5533494-5533516 AGTGAGGAGGCCCATGTGGCTGG + Intergenic
1161700702 19:5793443-5793465 ATTGAGGAGGCCCATGTGGTTGG + Intergenic
1161719740 19:5896202-5896224 AGTGAGGAGGCCCGTGTGGCTGG + Intronic
1162086179 19:8250696-8250718 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1162153128 19:8659491-8659513 GGTGGGAAGGCCAGTGTGGCTGG + Intergenic
1162156378 19:8680907-8680929 ATTGAGGAGGCCCATGTGGCTGG + Intergenic
1162230795 19:9264366-9264388 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1162304434 19:9863207-9863229 AAGGAGGAGGCCCATGTGGCTGG + Intronic
1162400718 19:10444997-10445019 AGTGAGGAGGCCATTGTGGCTGG + Intronic
1162449817 19:10748001-10748023 ATGGAGGAGGCATATGTGGCTGG + Intronic
1163011203 19:14427505-14427527 ATAGTGAAGGCTAATGTTGCTGG + Intergenic
1163011709 19:14430763-14430785 AGTTAGAAGGCTCATGTGGCTGG + Intergenic
1163060545 19:14758052-14758074 CTTTGGAAGGCCAATGTGGGCGG - Intronic
1163083136 19:14957930-14957952 AGAGAGAAGACCAATGTGGCTGG + Intronic
1163300133 19:16440134-16440156 ATTAATAACACCAATGTGGCTGG + Intronic
1163482259 19:17563990-17564012 CTTCAGGAGGCCAATGTGGGAGG + Intronic
1163605115 19:18270414-18270436 ATTTGGAAGGCCAAGGTGGGTGG + Intronic
1164508937 19:28882067-28882089 CTTTGGAAGGCCAAGGTGGCCGG + Intergenic
1165332785 19:35150671-35150693 AGTGGGGAGGCCACTGTGGCTGG + Intronic
1165389239 19:35528812-35528834 AGGGAGAAGGCCTGTGTGGCTGG - Intergenic
1165411017 19:35661509-35661531 ACTGAAGAGGCCAGTGTGGCAGG - Intergenic
1166190093 19:41170943-41170965 CTTGAGGAGGCCAAGGTGGGTGG + Intergenic
1166309773 19:41956498-41956520 GTTGAGAAGGACAGTGTGCCGGG - Intergenic
1166730263 19:45055358-45055380 AGAGAGAAGGCCCGTGTGGCTGG + Intronic
1166971612 19:46572312-46572334 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1166984380 19:46650739-46650761 TTTCAGGAGGCCAGTGTGGCTGG - Intronic
1167204779 19:48093655-48093677 AATGAGAAGACCAGTGAGGCTGG - Intronic
1167556214 19:50197584-50197606 ATTAAGAAAGCCATTGTGGCTGG + Intronic
1168338011 19:55607354-55607376 GTTGGGAAGGCCAAAGTGGGAGG + Intronic
1168647064 19:58066327-58066349 ATTGTGGAGGCCACTGTAGCTGG + Intronic
1202655750 1_KI270708v1_random:19420-19442 ATTTGGAAGGCCAAGGTGGGTGG + Intergenic
925054119 2:842737-842759 TTTGAGAAGGCCACTGTAGCAGG - Intergenic
926051155 2:9745644-9745666 CTTTGGAAGGCCAAGGTGGCAGG - Intergenic
927295326 2:21446559-21446581 CTCGAGAAGGTCAGTGTGGCTGG - Intergenic
927955636 2:27205526-27205548 GTTTAGAAGGCCTCTGTGGCAGG - Intronic
928321369 2:30285072-30285094 CTTGGGAAGGCCAAGGTGGATGG - Intronic
928903812 2:36350278-36350300 ATTCAGGAGGCTAAGGTGGCAGG - Intergenic
929034218 2:37675064-37675086 AGCCTGAAGGCCAATGTGGCTGG - Intronic
929107705 2:38380182-38380204 ATGGAGGAGGCCAAAGTGGGAGG + Intergenic
929144037 2:38690727-38690749 ATTAAAGAGGCCAAAGTGGCCGG - Intronic
929424951 2:41834940-41834962 TGAAAGAAGGCCAATGTGGCTGG + Intergenic
929459061 2:42088223-42088245 CTTTGGAAGGCCAATGTGGGCGG + Intergenic
930256112 2:49093838-49093860 ATTTGGAAGGCCAAGGTGGATGG - Intronic
930361160 2:50381782-50381804 ATTGATAAGGCCAAGAAGGCTGG - Intronic
930633962 2:53785024-53785046 AGAAAGAAGGCCAGTGTGGCTGG - Intronic
930732130 2:54737890-54737912 AGCTAGAAGGCCAGTGTGGCTGG - Intronic
930812251 2:55554982-55555004 ATTGAAAAGGGTATTGTGGCCGG + Intronic
930942534 2:57029542-57029564 ATTTGGAAGGCTAATGTGGGAGG + Intergenic
931289912 2:60863376-60863398 ATAGAGAAGGCCAGTGTGTCCGG - Intergenic
932375527 2:71232235-71232257 CTTTGGAAGGCCAACGTGGCAGG - Intergenic
932629949 2:73332126-73332148 TTTTAGAAGGCCAAGGTGGGAGG + Intergenic
933425679 2:82109490-82109512 CTTTAGAAGGCCAAGGTGGGGGG - Intergenic
935071826 2:99701079-99701101 ATTTAGAATGCCACAGTGGCCGG + Intronic
935105789 2:100042104-100042126 AGGAAGAAGGCCAGTGTGGCAGG - Intronic
935155231 2:100478705-100478727 ATTTGGGAGGCCAATGTGGGTGG - Intronic
936404987 2:112194928-112194950 AGTGAGAAATCCAATGTGGGTGG + Intergenic
938265181 2:129923260-129923282 CGTGAGAAGGCCAATGAAGCAGG + Intergenic
938492933 2:131775428-131775450 GCTGAGAAGGCCACTGTGCCAGG - Intergenic
938819654 2:134943290-134943312 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
940631514 2:156245247-156245269 ATTAAGAATGAAAATGTGGCCGG - Intergenic
940950411 2:159666610-159666632 ATTTAGGAGGCCAAAGTGGGTGG + Intergenic
941221086 2:162782500-162782522 AATGAGAAGGCCAGTGTGGCTGG + Intronic
942030609 2:171955366-171955388 ATTTAGAAGGCCAAGGCGGGAGG + Intronic
942466613 2:176214746-176214768 CTTTAGAAGGCCAAGGTGGCCGG - Intergenic
942527520 2:176870462-176870484 ATTGAGGAGGCCCAGGTGGAAGG - Intergenic
945860363 2:215114267-215114289 ATTAAGAAAGCAAATTTGGCCGG - Intronic
946171403 2:217898125-217898147 TCTGGCAAGGCCAATGTGGCCGG + Intronic
946203185 2:218083504-218083526 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
947329671 2:229015415-229015437 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
947702521 2:232246395-232246417 AGTGGGAAGGCCCATGTGACTGG + Intronic
947707422 2:232287686-232287708 ATTAAGAAGGAAAATGGGGCTGG - Intronic
947865488 2:233395411-233395433 CTTCAGAAGGCCAAGGTGGGTGG - Intronic
1168764057 20:369837-369859 TCGGAGAAGGTCAATGTGGCTGG - Intronic
1168796409 20:612638-612660 AGTGGGGAGGCCAGTGTGGCTGG - Intergenic
1168811261 20:706251-706273 AGAGAGAAGGCCAAGGTGGCTGG + Intergenic
1169931327 20:10836235-10836257 ATTTGGGAGGCCAAGGTGGCTGG - Intergenic
1170201054 20:13744596-13744618 AATAAGGAGGCCAGTGTGGCTGG - Intronic
1170529913 20:17281004-17281026 AAGGAGAAGGCAAATATGGCGGG - Intronic
1170645343 20:18192413-18192435 CTTGGGAAGGCCAAGGTGGGTGG - Intergenic
1171503800 20:25616941-25616963 CTTTGGAAGGCCAAGGTGGCAGG + Intronic
1171993604 20:31715431-31715453 AGCAAGAAGGTCAATGTGGCTGG - Intronic
1172414420 20:34752683-34752705 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1172460922 20:35118033-35118055 AGACAGAAGGCCAGTGTGGCTGG - Intronic
1172513960 20:35520113-35520135 ATTCAGAAGGCTGATGTGGAAGG + Intergenic
1172573073 20:35985407-35985429 CTTTAGGAGGCCAAAGTGGCAGG - Intronic
1172628738 20:36364165-36364187 ATTCAGGAGGCCAAAGTGGGAGG + Intronic
1172642948 20:36452421-36452443 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1173055369 20:39606970-39606992 ATTGTGGAGGCCACTGTGTCAGG + Intergenic
1173171998 20:40734077-40734099 AATGGGGAGGCCACTGTGGCTGG + Intergenic
1174240210 20:49127767-49127789 TTTGAGAAGGCCAAGGCGGGTGG + Intronic
1174313952 20:49682449-49682471 AGCGAGAAGGCCCGTGTGGCTGG - Intronic
1174392293 20:50225183-50225205 ACTGAGGAGGCCCATGTGGCTGG + Intergenic
1174416968 20:50373863-50373885 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
1174660312 20:52206831-52206853 ACTTAGAAGGCCAAGGTGGGAGG - Intergenic
1174759513 20:53193338-53193360 ATTGCGAACGGCAATGTGTCTGG - Intronic
1174777596 20:53359704-53359726 AGAGAGAAGGCCACTGTGGCTGG + Intronic
1174822077 20:53735201-53735223 CTTTAGAAGGCCAAGGTGGGAGG + Intergenic
1175152738 20:56947766-56947788 ATTCAGAAGGCCAAGGCGGGTGG + Intergenic
1175366334 20:58458832-58458854 AGAGAGAAGGCCAGTGTGGCCGG + Intergenic
1175432911 20:58919548-58919570 ATTTAGAAGGCAAAGGTGGTAGG + Intergenic
1175865708 20:62175276-62175298 AGTGAGGAGGCCGGTGTGGCGGG + Intronic
1176724269 21:10417030-10417052 ACTGAAAGGGCTAATGTGGCAGG + Intergenic
1177612253 21:23466774-23466796 GTTGAGAAGGCCAAGGTGAAGGG - Intergenic
1178253424 21:31028114-31028136 CTTTGGAAGGCCAATGTGGGAGG - Intergenic
1178606870 21:34045253-34045275 AATAGGAAGGCCAGTGTGGCTGG - Intergenic
1178613262 21:34106604-34106626 AATGGCAAAGCCAATGTGGCAGG - Intronic
1178661389 21:34510418-34510440 ATCGAGAAGGACCCTGTGGCTGG - Intergenic
1178750748 21:35300629-35300651 CATGGGAAGGCCCATGTGGCAGG + Intronic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1178848889 21:36196809-36196831 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
1178884046 21:36471122-36471144 ATTTGGAAGGCCAAGGTGGGAGG + Intronic
1179008159 21:37532438-37532460 CTTTAGGAGGCCAAGGTGGCTGG + Intergenic
1179811515 21:43873619-43873641 TTTTAGAAGGCCAAGGTGGGAGG - Intronic
1182029774 22:27148876-27148898 ATTGAGAAGGTCATGATGGCAGG - Intergenic
1182035168 22:27192681-27192703 ATTAAGCAGGCCCAAGTGGCAGG - Intergenic
1182192511 22:28477442-28477464 ATTGAGAAGGCCAATGTGGCTGG - Intronic
1182201258 22:28572903-28572925 ATTTAGGAGGCCAAAGTGGGAGG + Intronic
1182499711 22:30737570-30737592 ATTTAGGAGGCCAAGGTGGGAGG - Intronic
1182966204 22:34523495-34523517 AAGAAGAAGGCCAGTGTGGCTGG - Intergenic
1183049269 22:35247532-35247554 TTTGGGGAGGCCAAAGTGGCTGG - Intergenic
1183131123 22:35837430-35837452 ATTGAGAAAGCTTATGTGACAGG + Intronic
1183516449 22:38269586-38269608 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1184107434 22:42376294-42376316 ATTTGGGAGGCCAAGGTGGCAGG + Intergenic
1184123508 22:42470066-42470088 ATTGGGGAGGCCAAAGTGGGTGG + Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949644039 3:6072459-6072481 ATTTGGGAGGCCAAGGTGGCAGG + Intergenic
950155141 3:10716355-10716377 AGGGAGGAGGCCAGTGTGGCTGG - Intergenic
950214782 3:11151742-11151764 ATTGGGGAGGCCAAGGTGGGAGG - Intronic
950265570 3:11570397-11570419 ACTGAGAAAGCCAGCGTGGCAGG - Intronic
950557411 3:13703928-13703950 ACTGAGAAGGCCAGTGTGTGAGG + Intergenic
950748170 3:15107528-15107550 AGTGATGAGGCCAGTGTGGCTGG + Intergenic
951603010 3:24397824-24397846 TTTGAGAAGGCCGAGGTGGGTGG - Intronic
952068336 3:29600393-29600415 AGAGAGAAGGTCAAAGTGGCAGG - Intronic
952890031 3:38033720-38033742 GAGGACAAGGCCAATGTGGCTGG + Intergenic
952987484 3:38799076-38799098 ATTAAGAAGGCAAAAGGGGCTGG - Intergenic
953012389 3:39039661-39039683 AGTGAGGAAGCCAATGTGCCTGG + Intergenic
953123890 3:40072448-40072470 CTTTAGGAGGCCAATGTGGTTGG - Intronic
953525503 3:43687110-43687132 ATTGAGAAAGCAAATGTGGCAGG - Intronic
954247753 3:49345082-49345104 ATTAAGTAGGCCAAGGTGGGAGG + Intergenic
954338555 3:49935276-49935298 TTTGGGAAGGCCAAGGTGGGTGG - Intergenic
954519908 3:51215622-51215644 ATAGAGAAGGCCTATGTGGTGGG + Intronic
954644448 3:52122389-52122411 ATGGAGCTGGCCAGTGTGGCTGG + Exonic
954670176 3:52286779-52286801 ATTGGGGAGGCCAAGGTGGGCGG - Intronic
955159894 3:56454604-56454626 AATGAGGAGGCCAAGGTGGGTGG + Intronic
955502214 3:59596795-59596817 ATTGAGACTGGCAATGTGGAAGG + Intergenic
955509551 3:59665665-59665687 AGTGAGGAGTCTAATGTGGCTGG + Intergenic
955721283 3:61883957-61883979 CTTCGGAAGGCCAAGGTGGCAGG - Intronic
955768487 3:62368653-62368675 ATTGAGGGGGCGAGTGTGGCTGG - Intergenic
955886917 3:63609661-63609683 ATTTAGGAGGCCAAGGTGGGAGG + Intronic
956612716 3:71140868-71140890 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
956835519 3:73093205-73093227 ATTCAGGAGGCCAAGGTGGGAGG + Intergenic
956844081 3:73166340-73166362 ATTTGGGAGGCCAAGGTGGCTGG - Intergenic
956897858 3:73682192-73682214 ATTGAGAAGTCCATTGCAGCTGG - Intergenic
957891246 3:86362182-86362204 ATTGAATTGGCCAATGTGGCTGG + Intergenic
958102407 3:89030001-89030023 CTTTGGAAGGCCAATGTGGGTGG - Intergenic
958104388 3:89053786-89053808 TTTGGGAAGGCCAAGGTGGGAGG - Intergenic
959083031 3:101822494-101822516 CTTGAAAAGGCCAATGTGCTTGG + Exonic
959144220 3:102524423-102524445 ATCCAGAAGGCCAATATGGTTGG - Intergenic
960113356 3:113867533-113867555 ATTTGGAAGGCCAAGGTGGGTGG - Intronic
960144979 3:114191424-114191446 TTTGAAAAGGCCAGTGTTGCTGG + Intronic
960285207 3:115820583-115820605 ATGGTGCAGGCTAATGTGGCTGG - Intronic
960602781 3:119474537-119474559 TTTGAAAAGCCAAATGTGGCCGG + Intronic
960946652 3:122971459-122971481 CTTGAGAAGGGAGATGTGGCAGG + Intronic
961657395 3:128450785-128450807 CTGGAGAAGACCACTGTGGCTGG - Intergenic
961846825 3:129772113-129772135 CTTTGGAAGGCCAATGTGGGAGG + Intronic
962065662 3:131977094-131977116 ATTAAGAATGATAATGTGGCTGG - Intronic
963314621 3:143746018-143746040 AGAAAGAAGGCCAGTGTGGCTGG + Intronic
963737197 3:149032664-149032686 ATTAAAAAGGCCATTCTGGCCGG + Intronic
964147429 3:153482385-153482407 AGCAAGAAGGCCAATGTGACTGG + Intergenic
964217674 3:154305474-154305496 TTTGAAAAGGCAAATGTGTCAGG + Intronic
964231072 3:154468759-154468781 AGCAAGGAGGCCAATGTGGCTGG - Intergenic
964288904 3:155153268-155153290 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
964891674 3:161543921-161543943 ATCCAGGAGGCCAGTGTGGCTGG + Intergenic
966379983 3:179335333-179335355 ATTTGGAAGGCCAAGGTGGGAGG - Exonic
966633930 3:182110770-182110792 AGAAAGAAGGCAAATGTGGCTGG - Intergenic
968023536 3:195417838-195417860 ATTGAGGAGGCTAAGGTGGGAGG + Intronic
968483085 4:845500-845522 ATGCAGGAGGCCAGTGTGGCTGG - Intergenic
972039555 4:34575295-34575317 AGCGAGGAGGCCATTGTGGCTGG - Intergenic
972471094 4:39405276-39405298 CTTTAGAAGGCCAAGGTGGGAGG - Intergenic
972580222 4:40388553-40388575 AGAGAGGAGGCCAGTGTGGCTGG + Intergenic
972744468 4:41920113-41920135 ATTGATAATGCCAAGGTAGCAGG + Intergenic
973120470 4:46515567-46515589 ACTGAGGAGGCAAATGTGGGAGG - Intergenic
973139594 4:46750115-46750137 TTTCAGAAGGCCAAAGTGGAAGG + Intronic
973589172 4:52423171-52423193 ATTGAGACGTAAAATGTGGCAGG - Intergenic
975383761 4:73731550-73731572 AGTAAGGAGGCCAGTGTGGCTGG - Intergenic
975654623 4:76629299-76629321 AGCAAGAAGGCCACTGTGGCTGG + Intronic
975665164 4:76727908-76727930 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
975849686 4:78559324-78559346 CTTCCGAAGGCCAATGTGGGTGG - Intronic
975964485 4:79954260-79954282 TTTTAGAAGGCCAAGGTGGGAGG - Intronic
976018118 4:80585141-80585163 ATTTAGAAGGCAAATTTGGCAGG + Intronic
976110389 4:81667198-81667220 AATGAGAAGGCCAGAGAGGCTGG - Intronic
976123755 4:81811065-81811087 AGTAAGGAGGCCAGTGTGGCTGG - Intronic
976652511 4:87451236-87451258 ATTGAGGAGGTCAGTGTGGCTGG + Intronic
976674129 4:87685643-87685665 ATGGAGGAGGCCAGTGAGGCTGG - Intergenic
976732259 4:88275548-88275570 ATTGAGAAGGCCAATGTTTTTGG + Intronic
976842764 4:89451167-89451189 AGCAAGAAGGCCAATATGGCAGG + Intergenic
976883834 4:89962495-89962517 ATTTAGAAGGTCAAGGGGGCTGG + Intergenic
976951950 4:90844445-90844467 AATAAGAAGGCCAATGTGGCTGG - Intronic
977828684 4:101564189-101564211 ATCAAGAAAGCCAGTGTGGCCGG - Intronic
977931810 4:102757913-102757935 AGTCAGCAGGCCAGTGTGGCTGG - Intronic
978555544 4:109976178-109976200 ATTGAAATGGCCAATCTGGATGG + Exonic
979090110 4:116472325-116472347 CTTCAGAAGGCCAAGGTGGGCGG - Intergenic
979165991 4:117532106-117532128 ATTTAGGAGGCCAAGGTGGGAGG - Intergenic
979725435 4:123955644-123955666 AGCAAGAAGGCCAGTGTGGCTGG + Intergenic
979881922 4:125970725-125970747 ATTTACTAGGACAATGTGGCAGG - Intergenic
980034742 4:127870994-127871016 AGTCAGAAGGCCAGTGTGGCTGG + Intergenic
980505930 4:133721089-133721111 CTTTAGAAGGCCAAAGTGGGAGG - Intergenic
982090350 4:151875144-151875166 ACCGAGGAGGCCCATGTGGCTGG + Intergenic
982224195 4:153151344-153151366 CTTGAGAAGGTCAAGGTGGGCGG + Intergenic
982879976 4:160701845-160701867 ATTAAGAAAGCCAGTGTGACTGG - Intergenic
983237318 4:165194173-165194195 AACAAGAAGACCAATGTGGCTGG - Intronic
985296708 4:188443887-188443909 ATTGATAAAGACATTGTGGCCGG - Intergenic
986314524 5:6577659-6577681 ATTCAGAGGGCCCATGGGGCAGG - Intergenic
988091434 5:26545407-26545429 ATTTAGGAGGCCAAGGTGGGTGG - Intergenic
988247873 5:28711809-28711831 CTTTAGAAGGCCAAGGTGGGCGG - Intergenic
988303490 5:29464814-29464836 CTTTAGGAGGCCAAGGTGGCTGG + Intergenic
988526794 5:31994248-31994270 TTTGAGGAGGCCAAGGTGGGGGG - Intronic
989315127 5:40069664-40069686 ACAAAGAAGGCCAAGGTGGCTGG - Intergenic
990649782 5:57885325-57885347 AGTGAGGAGGCCAGTGTGACTGG + Intergenic
990862866 5:60347274-60347296 ACAGAGAGGGCCAGTGTGGCTGG + Intronic
991594391 5:68288205-68288227 AATGAGAAGGCCATTGTGAGGGG - Intronic
992438259 5:76775804-76775826 ATTGAAAAGGTCAGTGTGGCTGG - Intergenic
992504044 5:77367974-77367996 ATTGTCAGGGCCAATGAGGCTGG + Intronic
992712337 5:79471790-79471812 ATCAGGAAGGCCACTGTGGCTGG - Intronic
993067643 5:83119726-83119748 CTTTGGAAGGCCAATGTGGGAGG + Intronic
993126635 5:83843913-83843935 ATTTAGGAGGCCAAAGTGGGTGG - Intergenic
993387379 5:87275862-87275884 ATGAAGAAGGCCAAGCTGGCTGG - Intronic
993767980 5:91886361-91886383 ATTTTGAAGGGCAAAGTGGCGGG - Intergenic
994931219 5:106188069-106188091 ATTGAGGAGGCTGATGTGGGAGG + Intergenic
995569491 5:113464335-113464357 AATAAGCAGGCCAGTGTGGCTGG - Intronic
995856758 5:116600812-116600834 AGAGAAAAGGCCCATGTGGCTGG + Intergenic
996588864 5:125122887-125122909 TTTGAGATGGCCAAGGTGGATGG - Intergenic
997286183 5:132680374-132680396 AGTAGGAAGGCCAGTGTGGCTGG + Intronic
998021032 5:138770514-138770536 AAAGAGAAGGCCAGTGTAGCTGG - Intronic
998663030 5:144262095-144262117 ATGAAGATGGCAAATGTGGCAGG + Intronic
998760703 5:145428907-145428929 AATAAGGAGGCCAGTGTGGCTGG + Intergenic
998970561 5:147586834-147586856 ACTCAGAAGGCTAAGGTGGCAGG - Intronic
999266166 5:150268303-150268325 AGAGAGGAGGCCAGTGTGGCTGG - Intronic
999309177 5:150540570-150540592 CTTTAGGAGGCCAAGGTGGCTGG + Intronic
999709954 5:154309250-154309272 CTTGTGGAGGCCAGTGTGGCTGG + Intronic
1000042428 5:157494747-157494769 TTCGAGAAGGTGAATGTGGCAGG - Exonic
1000126814 5:158253621-158253643 ATTTGGAAGGCCAAGGTGGGAGG - Intergenic
1000778366 5:165447180-165447202 GTTGAGAAGTCTAATGTGTCTGG + Intergenic
1001023129 5:168200535-168200557 AGAGAGAAGGCCAGTGTAGCTGG + Intronic
1001099821 5:168804907-168804929 CTCCAGAAGGCCAGTGTGGCTGG - Intronic
1001164244 5:169349130-169349152 AGAAAGAAGGCCAAAGTGGCTGG - Intergenic
1001815255 5:174663397-174663419 ATTTGGAAGGCCAAGGTGGGAGG - Intergenic
1003095307 6:3138259-3138281 ATTGGGAGGGCCAAGGTGGGCGG - Intronic
1003184307 6:3817481-3817503 ATTCAGGAGGCCAAAGTGGGTGG + Intergenic
1003443011 6:6160578-6160600 CTTTGGAAGGCCAAGGTGGCTGG - Intronic
1004484900 6:16057279-16057301 AGTGAGGAGGCCACTGTGGAAGG - Intergenic
1004994396 6:21174703-21174725 ATTGATAAGGCCATTTTGGAGGG + Intronic
1006081190 6:31567838-31567860 AAACAGAAGGCCAGTGTGGCTGG - Intergenic
1006251467 6:32790624-32790646 AATAAGAAGGCCAGTGAGGCTGG + Intergenic
1006390669 6:33756402-33756424 AGTCAGGAGGCCAGTGTGGCTGG + Intergenic
1006432637 6:34007370-34007392 AGTGAGGAGGCCCAAGTGGCTGG + Intergenic
1006557712 6:34882746-34882768 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1006701016 6:35973352-35973374 GTGGAAAAGGCCAATGTGTCCGG + Intronic
1006931275 6:37690099-37690121 AGTGAGGAGTCCAATGTGGCTGG - Intronic
1006948154 6:37799423-37799445 ATTGAGAAGGCTAAAGTGAGAGG + Intergenic
1007509455 6:42364166-42364188 TTTGAGGAAGCCATTGTGGCTGG - Intronic
1007852758 6:44821092-44821114 CTTTAGAAGGCCAAAGTGGGAGG - Intronic
1007893259 6:45316981-45317003 ATTTAGGAGGCCAAGGTGGGCGG + Intronic
1008436216 6:51479431-51479453 ATTGAGAAACCCAGTTTGGCTGG + Intergenic
1009717618 6:67420450-67420472 CTTTGGAAGGCCAATGTGGGAGG + Intergenic
1010465594 6:76164446-76164468 TGCAAGAAGGCCAATGTGGCTGG + Intergenic
1010494055 6:76512016-76512038 CTTCAGAAGGCCAACGTGGAAGG - Intergenic
1010502365 6:76616217-76616239 AAGGAGGAGGCCAGTGTGGCTGG - Intergenic
1011109904 6:83826182-83826204 TTTGAGGAGGCCAAAGTGGAAGG + Intergenic
1011347230 6:86384488-86384510 TTTCAAAAGGCCACTGTGGCAGG + Intergenic
1011377940 6:86710652-86710674 AGTGAAGAGGCCAGTGTGGCTGG + Intergenic
1011633064 6:89345997-89346019 ATTGGGGAGGCCAAGGTGGGAGG - Intronic
1011918392 6:92539894-92539916 AATTAGAAGCCCAATCTGGCTGG + Intergenic
1013643882 6:112116375-112116397 ACTGTGAAGGCCACTGTGGCTGG + Intronic
1013867538 6:114716873-114716895 ATTGATATTACCAATGTGGCAGG - Intergenic
1014298814 6:119654111-119654133 ATTTAGGAGGCCAAGGTGGGTGG - Intergenic
1014372029 6:120621874-120621896 AATGACAGAGCCAATGTGGCTGG + Intergenic
1014552673 6:122807142-122807164 ATTTGGAAGGCCAATGTGGGAGG - Intronic
1014628597 6:123761048-123761070 AATAAGAAGGCCAGTGGGGCTGG + Intergenic
1015069568 6:129075265-129075287 GGAAAGAAGGCCAATGTGGCTGG + Intronic
1016971404 6:149767695-149767717 ATTTAGAAAGCCAAGGTGGGTGG - Intronic
1017042088 6:150315760-150315782 CTTTAGAAGGCCAAGGTGGGAGG + Intergenic
1017113757 6:150956647-150956669 ATTTAGAAGCCCACTGTGCCTGG - Intronic
1017245393 6:152218749-152218771 ATTGAACAGGCCATGGTGGCAGG + Intronic
1017698875 6:157048156-157048178 GTTGAGAATGTCAACGTGGCTGG + Intronic
1018036262 6:159884680-159884702 CTTTAGGAGGCCAAGGTGGCTGG - Intergenic
1018164786 6:161083044-161083066 AGTGAGGAAGCCACTGTGGCTGG - Intronic
1018549234 6:164975955-164975977 ATTGAGAAAGCAAATGAAGCTGG - Intergenic
1019380191 7:717547-717569 ATTCAGGAGGCTAAGGTGGCAGG + Intronic
1019970312 7:4535411-4535433 ATTGAGGTGGCCAAGGTGGGAGG + Intergenic
1019970484 7:4536656-4536678 ATTGAGGAAGCCAAGGTGGGAGG + Intergenic
1020022651 7:4878298-4878320 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1020493576 7:8820011-8820033 ATTGAGAACGTCAATATGTCAGG + Intergenic
1022726961 7:32990073-32990095 CTTCAGAAGGCCAAGGTGGGAGG - Intronic
1023603632 7:41906611-41906633 GCCAAGAAGGCCAATGTGGCTGG - Intergenic
1024788328 7:52933911-52933933 CTTTAGGAGGCCAATGTGGGTGG + Intergenic
1025046620 7:55697560-55697582 CTTCAGAAGGCCAAGGTGGGAGG + Intergenic
1025197521 7:56944307-56944329 CTTGAGGAGCCCAGTGTGGCAGG - Intergenic
1025674426 7:63632632-63632654 CTTGAGGAGCCCAGTGTGGCAGG + Intergenic
1026345852 7:69473564-69473586 ATTTGGAAGGCCAAGGTGGGAGG - Intergenic
1026349154 7:69500585-69500607 CTTTGGAAGGCCAATGTGGGAGG + Intergenic
1026621134 7:71950790-71950812 ATTAAGAAAGCCAGTCTGGCTGG - Intronic
1027217599 7:76194078-76194100 ATTGAGGAGTCCCTTGTGGCAGG - Intergenic
1027855630 7:83507692-83507714 TTTTAGAAGGCCAAGGTGGGAGG + Intronic
1028615843 7:92765989-92766011 AGAAAGAAGGCCACTGTGGCTGG + Intronic
1028915582 7:96255440-96255462 CTTTGGGAGGCCAATGTGGCGGG + Intronic
1028964772 7:96789969-96789991 AGAGAGAAGGCCCATGTGGCTGG - Intergenic
1029581519 7:101439597-101439619 TGTGAGAAGACCAGTGTGGCTGG + Intronic
1030119118 7:106089039-106089061 ACTGAGAAGGCCAAGGTGGGAGG + Intergenic
1031166116 7:118229091-118229113 AGTAAGAAGGCCAGTGTAGCTGG - Intronic
1032189277 7:129754215-129754237 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
1033303155 7:140204265-140204287 TTTGGGAAAGCCAAGGTGGCTGG - Intergenic
1034037098 7:147836360-147836382 AAAGAGAAGACCAGTGTGGCTGG - Intronic
1034130256 7:148709837-148709859 ACTTAGAAGGCCGAGGTGGCCGG + Intronic
1034613542 7:152394387-152394409 ACTGAAAGGGCCAGTGTGGCAGG - Intronic
1034687092 7:152981769-152981791 CTTTGGAAGGCCAAGGTGGCTGG - Intergenic
1036958042 8:13212229-13212251 GCTGAGAAGGCCATCGTGGCTGG - Intronic
1037330625 8:17740354-17740376 ATTGAAAACGCCAAATTGGCTGG + Intronic
1037338474 8:17815102-17815124 ACTCAGAAGGCCAAGGTGGGAGG - Intergenic
1037843548 8:22262869-22262891 ATTGAAGAGGCAAATGGGGCCGG - Intergenic
1038170995 8:25131870-25131892 ATTGCCAAGGTCAGTGTGGCTGG - Intergenic
1039646677 8:39292090-39292112 GTTAAGGAGGCCAGTGTGGCTGG - Intergenic
1040917496 8:52578301-52578323 ATTGAGAAGACCAGTGTAGCTGG - Intergenic
1041154280 8:54968668-54968690 ATTTGGAAGGCCAATGAGGGTGG + Intergenic
1041243109 8:55866027-55866049 CTTTAGAAGGCCAAGGTGGCAGG + Intergenic
1041618323 8:59934422-59934444 CCTGTGAAGGCCAGTGTGGCAGG + Intergenic
1041680955 8:60590392-60590414 ATTGGGAAGGCCAAAGTGGGAGG + Intronic
1041949065 8:63479711-63479733 AACAAGAAGGCCAATGTGGGTGG + Intergenic
1042209032 8:66359357-66359379 ATTGGGGAGGCCAAGGTGGGAGG - Intergenic
1042358344 8:67854294-67854316 TTTGAGGAGGCCAAGGTGGGGGG + Intergenic
1042495360 8:69449750-69449772 ATTGAGAAGGCTGGTGAGGCTGG - Intergenic
1042649892 8:71028015-71028037 CTTTGGAAGGCCAAGGTGGCAGG - Intergenic
1042803325 8:72744791-72744813 AGTAAAAAGGCTAATGTGGCTGG + Intronic
1042856559 8:73273463-73273485 CTGGAGAGGGCCAAGGTGGCAGG - Intergenic
1043404814 8:79919575-79919597 ATTTAGGAGGCCAAGGTGGGAGG - Intronic
1043782954 8:84360114-84360136 CTTTGGAAGGCCAATGTGGGCGG - Intronic
1044063125 8:87664027-87664049 TTTGTGCAGGCCAATGTGGTGGG - Intergenic
1044230625 8:89773430-89773452 AGTGAGAAGGCCTGTGTGGCTGG + Intronic
1044391526 8:91657874-91657896 AGAAAGAAGGCCAGTGTGGCTGG - Intergenic
1044715255 8:95094213-95094235 ATTTGGAAGGCCAAGGTGGGCGG - Intronic
1045028354 8:98111309-98111331 ATTTAGAAGTGAAATGTGGCAGG + Intronic
1045169323 8:99646414-99646436 ATTGAGAAGGCTGAGGTGGGAGG + Intronic
1046521847 8:115335154-115335176 AGGGAGAAAACCAATGTGGCGGG - Intergenic
1047250235 8:123176593-123176615 TTTGAGGAGGCCAAGGTGGGTGG - Intergenic
1047487928 8:125349503-125349525 ATTTGGAAGGCCAAGGTGGAAGG + Intronic
1048044855 8:130764019-130764041 TATGAGGAGGCCCATGTGGCAGG + Intergenic
1048184293 8:132225366-132225388 AGTGAGAAGGAGATTGTGGCTGG + Intronic
1048225493 8:132581351-132581373 ATTAAGAAGGCAAGTCTGGCTGG + Intronic
1049110405 8:140638816-140638838 TTTGAGGAGGCCAAGGTGGGAGG - Intergenic
1049547710 8:143241593-143241615 ATTTGGAAGGCCAAGGTGGGTGG + Intergenic
1049871475 8:144981449-144981471 ATTCAGGAGGCCAAAGTGGATGG + Intergenic
1050470088 9:5979268-5979290 ATTTGGAAGGCCAAGGTGGGAGG + Intronic
1051253623 9:15188775-15188797 AGTGAGGAGGACAATTTGGCTGG + Intronic
1052578201 9:30318331-30318353 ACTCAGAAGGCCAAGGTGGGAGG + Intergenic
1054779471 9:69153337-69153359 ATTTGGGAGGCCAATGTGGAAGG + Intronic
1055220621 9:73926654-73926676 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1055434253 9:76276529-76276551 ATCAAGAAGGCCAGTGGGGCTGG - Intronic
1056273502 9:84970151-84970173 ATTTGGAAGGCCAAGGTGGGTGG + Intronic
1056345847 9:85693993-85694015 AATGAGGTGGCCAGTGTGGCTGG + Intronic
1056699028 9:88887012-88887034 ATAGAGAAGGCCCATCAGGCGGG + Intergenic
1056741455 9:89259363-89259385 ATTCAGAAGGCCGAGGTGGGAGG - Intergenic
1057372559 9:94487323-94487345 CTTCAGAAGGCCAAAGTGGGCGG - Intergenic
1057834791 9:98435661-98435683 TTTGAGAAAGCCAGTGTGGCTGG - Intronic
1058678931 9:107424956-107424978 ATTGGGCAGGCCAGTGTGGGTGG + Intergenic
1058934459 9:109755347-109755369 AGTCTGAAGGCCACTGTGGCTGG - Intronic
1059174615 9:112158065-112158087 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1059983267 9:119796573-119796595 ATTGAGAAACCCAGTTTGGCTGG + Intergenic
1060239532 9:121890921-121890943 AGTGGGCAGGGCAATGTGGCTGG - Intronic
1060371502 9:123077393-123077415 CTTTAGGAGGCCAATGTGGGAGG - Intronic
1060488166 9:124062657-124062679 TCTGAGATTGCCAATGTGGCTGG + Intergenic
1060646799 9:125287529-125287551 AATGGGAAGGCCAGTTTGGCAGG + Intronic
1060926456 9:127458831-127458853 TTTGAGAAGGAAAATGAGGCGGG + Intronic
1061051126 9:128196108-128196130 ATTTAGGAGGCCAAGGTGGGTGG - Intronic
1061104740 9:128521003-128521025 CTTGAGGAGGCCAAAGTGGGAGG - Intronic
1185667406 X:1776931-1776953 ATTTGGGAGGCCAAGGTGGCTGG - Intergenic
1186078076 X:5902278-5902300 ATTCAGAAGGCTGATGTGGGAGG + Intronic
1186249332 X:7649304-7649326 CTTTAGGAGGCCAAGGTGGCTGG + Intergenic
1186664057 X:11700593-11700615 AATGACAAGGTGAATGTGGCTGG - Intergenic
1187056152 X:15743101-15743123 AGTAAGGAGGCCAATATGGCAGG - Intronic
1187106302 X:16245938-16245960 AGAGAGAAGGCCAGTGTGGCTGG + Intergenic
1187440027 X:19309979-19310001 AACAAGAAGGCCAATGTGGGTGG + Intergenic
1187664136 X:21585132-21585154 ACTCAGAAGGCCAAGGTGGGAGG + Intronic
1188028623 X:25238497-25238519 ATTAAGAAGTCCATTGTGGCTGG + Intergenic
1188258930 X:27999552-27999574 GTTGACAAAGCCTATGTGGCAGG + Intergenic
1188323915 X:28775752-28775774 ATAAATAAGGCCAATGTGGTTGG - Intronic
1188847798 X:35095534-35095556 ATTGGGGAGGCCTAGGTGGCAGG + Intergenic
1189273815 X:39770474-39770496 AGCAAAAAGGCCAATGTGGCTGG - Intergenic
1189563372 X:42213983-42214005 ACTGAGGAGGCCAATTTGTCAGG + Intergenic
1190177878 X:48166703-48166725 ATTTAGGAGGCCAAGGTGGGAGG - Intergenic
1190411763 X:50143579-50143601 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1190702110 X:52996834-52996856 AGTGAGGAGGCCAGTGTTGCTGG + Intergenic
1190736714 X:53260325-53260347 AGTGAAGAGGCCAGTGTGGCCGG + Intronic
1192543658 X:71995499-71995521 AGTGAGGAGGCCAGTGTGGCTGG - Intergenic
1192579333 X:72267905-72267927 ATCAAGGAGGCCAGTGTGGCTGG + Intronic
1193127739 X:77887338-77887360 TTTGGGAAGGCCAAAGTGGAAGG - Intronic
1193654436 X:84182726-84182748 ACTGAGAAGGCACCTGTGGCAGG + Intronic
1193971806 X:88064448-88064470 GTTGAGAATGTCAATGTGGTTGG + Intergenic
1194384072 X:93231572-93231594 ATTGAGAAGGCCAGAGGGGTTGG + Intergenic
1194485858 X:94485364-94485386 ATTTGGGAGGCCAATGTGGGCGG + Intergenic
1194713689 X:97265680-97265702 AAAAAGAAGGCCAATATGGCTGG + Intronic
1194908695 X:99611495-99611517 ATTGAGATGGCTGATGTGGTAGG - Intergenic
1195935674 X:110123866-110123888 AGTCAGAAGGCCGATGTGGGAGG + Intronic
1196130485 X:112150076-112150098 AGTGAGGAGGCCAGTGTGGTGGG + Intergenic
1196724366 X:118882979-118883001 CTTCAGAAGGCCAAAGTGGGTGG + Intergenic
1196752042 X:119126825-119126847 ATTTGGAAGGCCAAGGTGGGTGG + Intronic
1196845980 X:119897051-119897073 CTTTGGAAGGCCAATGTGGGAGG - Intronic
1197155486 X:123265748-123265770 ATTTCCAAAGCCAATGTGGCTGG - Intronic
1197963182 X:132028106-132028128 CTTTGGAAGGCCAATGTGGATGG - Intergenic
1199561506 X:149168564-149168586 GTTGAGAAGTCCGATGTGGATGG + Intergenic
1199620459 X:149696362-149696384 TTTAAGAAGCCTAATGTGGCAGG - Intronic
1199790713 X:151152685-151152707 CTTGGGGAGGCCAATGTGGGAGG - Intergenic
1199970302 X:152854774-152854796 ATTTGGAAGGCCAAGGTGGGAGG + Intronic
1200277412 X:154747555-154747577 CTTTAGAAGGCCAAGGTGGAAGG + Intronic
1200783840 Y:7241224-7241246 ATTTAGGAGGCCAAGGTGGGAGG - Intergenic
1200785476 Y:7256913-7256935 ATTTGGAAGGCCAAGGTGGGTGG + Intergenic
1201424546 Y:13833882-13833904 CTTGAAAAGGCCAAGGTGGGAGG - Intergenic
1201477977 Y:14404522-14404544 ATTCAGAAGGCTAATGTAGAAGG + Intergenic
1201485796 Y:14493392-14493414 ATTTGGAAGGCCAAGGTGGGAGG + Intergenic
1201613721 Y:15872015-15872037 TTTTAGAAGGCCAAGGTGGGAGG - Intergenic