ID: 1182192539

View in Genome Browser
Species Human (GRCh38)
Location 22:28477782-28477804
Sequence CAGTTGTACGAGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182192539_1182192544 -1 Left 1182192539 22:28477782-28477804 CCACCTGCCCTCTCGTACAACTG 0: 1
1: 0
2: 1
3: 4
4: 135
Right 1182192544 22:28477804-28477826 GGTCTTTGTTCTTTCCCTTCTGG 0: 1
1: 1
2: 1
3: 33
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182192539 Original CRISPR CAGTTGTACGAGAGGGCAGG TGG (reversed) Intronic
900991546 1:6100468-6100490 CAATGGTGCCAGAGGGCAGGTGG + Exonic
902550756 1:17218181-17218203 CAGTTGCAAGAGAGGGCATCTGG + Intronic
903867584 1:26410553-26410575 CAGTTGTGCGTGTGGGGAGGGGG + Intergenic
904925964 1:34048496-34048518 CAGCTGTCCGAGGGGGTAGGTGG - Intronic
905447516 1:38036689-38036711 GAGTTAAAGGAGAGGGCAGGGGG + Intergenic
906491360 1:46271309-46271331 CAGTTGTTGGGAAGGGCAGGAGG - Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
910280472 1:85495037-85495059 CAGTTCCAGCAGAGGGCAGGCGG + Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
1067714560 10:48679675-48679697 CAGTTGTTCAAGTTGGCAGGTGG - Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1073399411 10:103244537-103244559 AAGTTGTAGTAGAGGGCACGAGG + Intergenic
1075571955 10:123552630-123552652 CAGTTGTATGAGGAGGCTGGGGG + Intergenic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1075760083 10:124849050-124849072 CAGCTGTAAGAGGAGGCAGGAGG - Intergenic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1078846433 11:15122970-15122992 GAGATGTAGGAGAGGGCAGCAGG - Intronic
1079152987 11:17918189-17918211 CACTTGTACCAGCAGGCAGGTGG - Intronic
1083966418 11:66046589-66046611 CAGGAGTAAGAGAGGGGAGGAGG + Intronic
1086989741 11:93289925-93289947 CAGTTATATCAAAGGGCAGGAGG + Intergenic
1087617318 11:100502763-100502785 CAGTTTTACATGAGTGCAGGGGG + Intergenic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090012512 11:123057828-123057850 AAGCTGTACCAGAGTGCAGGAGG - Exonic
1090265551 11:125350987-125351009 CTGTTGTACGTGTGGGGAGGGGG - Intronic
1090941610 11:131392607-131392629 CAGGTTGAAGAGAGGGCAGGAGG + Intronic
1091895433 12:4099407-4099429 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
1099505470 12:83470901-83470923 CAGATGTCTGAGTGGGCAGGAGG - Intergenic
1101198447 12:102409565-102409587 CACTTGTATGAGATGGCAGGGGG - Intronic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1108910838 13:55549862-55549884 AAGTTGTAGGAGAGGCCTGGTGG + Intergenic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1117196679 14:53346809-53346831 CAGTTGTCCCTGAGGGCATGGGG + Intergenic
1117888268 14:60388557-60388579 CAGGAGCAAGAGAGGGCAGGAGG - Intergenic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1119599646 14:75966926-75966948 CAGGTGTAGGAGAGGTCATGGGG + Intronic
1119763915 14:77175998-77176020 CAGGGGTAAGAGAGGGCAGAGGG + Intronic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1125205675 15:37151368-37151390 CAGAAGTAAGAGAGGCCAGGTGG + Intergenic
1127143302 15:55998941-55998963 AAGTTGTAGGAATGGGCAGGGGG - Intergenic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1129203282 15:74019052-74019074 CAGTCTTACCAGAGGGCTGGGGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1137351661 16:47718747-47718769 CAGCTGTGCAAGAAGGCAGGAGG + Intergenic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1141382369 16:83588021-83588043 CAGGTGTACGGGATGGAAGGAGG - Intronic
1142656878 17:1400230-1400252 CAGTTGTCCGCGTGCGCAGGCGG - Exonic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1152138100 17:78517787-78517809 CAGTTGTAAGAGAGAGAAGCTGG - Intronic
1157110250 18:44813901-44813923 GAGTTGTAGGAGAGTGCTGGAGG + Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1162807973 19:13148776-13148798 CTGTTGCAGGAGAGGGCTGGGGG - Intronic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167572574 19:50298280-50298302 CAGGTGAAAGAGGGGGCAGGAGG + Intronic
1167584112 19:50363634-50363656 CAGTAGTTCGAGGGGGCAGTGGG - Intronic
1168635236 19:57991029-57991051 CAGTGGGACGAGGGTGCAGGAGG - Intronic
926657588 2:15425722-15425744 CAGATGTAAGAGATGCCAGGAGG - Intronic
929520817 2:42649073-42649095 GAGTGGTACTAGAGGCCAGGGGG - Intronic
931496155 2:62809353-62809375 CAGTTGGGGGAGAGGGGAGGAGG - Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934922939 2:98360185-98360207 CATTTGTAAGAGAGGGAGGGGGG + Intronic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
945119106 2:206440577-206440599 CAGTCGTAGGTGAAGGCAGGTGG - Intergenic
948693930 2:239723256-239723278 CAGTTCTAGGACAGAGCAGGAGG - Intergenic
1170226979 20:14001784-14001806 CAGTAGCACGAGAGGGTTGGGGG + Intronic
1170780072 20:19417430-19417452 CAGTTGTACAAGATGTCAAGTGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1176249361 20:64112921-64112943 GAGATGTAGGAGAGGGCTGGAGG + Intergenic
1176869704 21:14075040-14075062 CTGTTGTAGCAGAGGGCATGGGG + Intergenic
1179101770 21:38360652-38360674 ATGTTGTGGGAGAGGGCAGGTGG + Intergenic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1180032264 21:45220575-45220597 CACTTGTCTGACAGGGCAGGTGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183264010 22:36814681-36814703 CACTAGTACCAGAGGGCTGGGGG + Intronic
1183360921 22:37383086-37383108 CAGCTGTACCCAAGGGCAGGAGG - Intronic
1184981534 22:48099281-48099303 CAGTTCTGGGAGAGGGCAGGTGG - Intergenic
1185415337 22:50706227-50706249 AGGTGGTACGGGAGGGCAGGCGG + Intergenic
949948301 3:9207774-9207796 CAATTCTCCAAGAGGGCAGGCGG + Intronic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
954042849 3:47902706-47902728 CAGTTGAATCAGAGGGCAAGTGG + Intronic
959860282 3:111208210-111208232 CAGGTGTACGAGAAGTGAGGGGG - Intronic
962621967 3:137189445-137189467 AAGTTGGGTGAGAGGGCAGGAGG - Intergenic
962689724 3:137882121-137882143 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG + Intronic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
966230077 3:177642104-177642126 CAGGTGAACGACAGGGCGGGAGG + Intergenic
967273459 3:187750262-187750284 CAGGTGTACAAGAGGGCGGTGGG - Intergenic
979541612 4:121890150-121890172 CAGAAGTTGGAGAGGGCAGGGGG + Intronic
986454971 5:7909059-7909081 CAGTAGTATGAGAAGGCTGGGGG + Intergenic
986480764 5:8184685-8184707 CACTTGGATGAGAGGGCTGGTGG - Intergenic
986876890 5:12122271-12122293 CAGTTGTCCTAAAGGGCATGAGG - Intergenic
987289417 5:16494541-16494563 CAGGAGTAAGAGAGAGCAGGGGG - Intronic
990535317 5:56715928-56715950 CTGTTGTAAGAGAGGAAAGGAGG + Intergenic
991592350 5:68266157-68266179 TAGTATTAGGAGAGGGCAGGGGG - Intronic
992973193 5:82083589-82083611 CAGTTGTATGAGGGGTCAGTTGG - Intronic
996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG + Intergenic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1011806804 6:91081192-91081214 AAGAAGTACAAGAGGGCAGGTGG - Intergenic
1020014905 7:4825184-4825206 CAGTTCTAGAAGAGGGCAGAGGG + Intronic
1020895060 7:13929600-13929622 CAGTTGTTCGTGAAGGCATGAGG - Intronic
1025152469 7:56569383-56569405 CAGTTGTCCGCGTGCGCAGGTGG - Intergenic
1025602166 7:63011273-63011295 TTGTTGCACGAGGGGGCAGGTGG + Intergenic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG + Intergenic
1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG + Intronic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1052409101 9:28099843-28099865 GAGTTGAACAAGAGGACAGGAGG - Intronic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1060371983 9:123082417-123082439 CAGTTGTATGAAAGGGCTGTGGG - Intronic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1188071007 X:25718276-25718298 CAGATGTACAAGTGGGCAAGTGG + Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1193371045 X:80697550-80697572 CATTTGTAAGAGAGGGCGTGTGG + Intronic
1196980081 X:121203173-121203195 AAGCTGTACCAGAGTGCAGGAGG - Intergenic
1197249890 X:124204588-124204610 AAGCTGTACCAGAGTGCAGGAGG - Intronic
1201864760 Y:18637886-18637908 CAGTTATAGGAGAAGGCTGGAGG - Intergenic
1201868562 Y:18682492-18682514 CAGTTATAGGAGAAGGCTGGAGG + Intergenic