ID: 1182192544

View in Genome Browser
Species Human (GRCh38)
Location 22:28477804-28477826
Sequence GGTCTTTGTTCTTTCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 374}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182192542_1182192544 -8 Left 1182192542 22:28477789-28477811 CCCTCTCGTACAACTGGTCTTTG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1182192544 22:28477804-28477826 GGTCTTTGTTCTTTCCCTTCTGG 0: 1
1: 1
2: 1
3: 33
4: 374
1182192541_1182192544 -4 Left 1182192541 22:28477785-28477807 CCTGCCCTCTCGTACAACTGGTC 0: 1
1: 0
2: 0
3: 0
4: 41
Right 1182192544 22:28477804-28477826 GGTCTTTGTTCTTTCCCTTCTGG 0: 1
1: 1
2: 1
3: 33
4: 374
1182192543_1182192544 -9 Left 1182192543 22:28477790-28477812 CCTCTCGTACAACTGGTCTTTGT 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1182192544 22:28477804-28477826 GGTCTTTGTTCTTTCCCTTCTGG 0: 1
1: 1
2: 1
3: 33
4: 374
1182192539_1182192544 -1 Left 1182192539 22:28477782-28477804 CCACCTGCCCTCTCGTACAACTG 0: 1
1: 0
2: 1
3: 4
4: 135
Right 1182192544 22:28477804-28477826 GGTCTTTGTTCTTTCCCTTCTGG 0: 1
1: 1
2: 1
3: 33
4: 374
1182192538_1182192544 0 Left 1182192538 22:28477781-28477803 CCCACCTGCCCTCTCGTACAACT 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1182192544 22:28477804-28477826 GGTCTTTGTTCTTTCCCTTCTGG 0: 1
1: 1
2: 1
3: 33
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182192544 Original CRISPR GGTCTTTGTTCTTTCCCTTC TGG Intronic
900924355 1:5693921-5693943 GGTCTTTGTTTCTTCCCGTTTGG - Intergenic
901001423 1:6150786-6150808 GTTCCTTGTTCTTTCCTTACTGG + Intronic
902395308 1:16129311-16129333 TCTCTTTGTTCTTTCTCTTCTGG - Intronic
904444087 1:30553458-30553480 GGTCTTTGTTTATTTCCTTCAGG + Intergenic
906543404 1:46605105-46605127 CTTCTGTGTTCATTCCCTTCTGG + Intronic
908264193 1:62362274-62362296 AGTCATTGTTATTGCCCTTCAGG + Intergenic
908308282 1:62848049-62848071 GTTCTTTTTTCTTTCCCGTATGG + Intronic
908873453 1:68642222-68642244 GTTCTTATTTCTTTCCATTCTGG - Intergenic
909078883 1:71085576-71085598 CTTCTTTGTTTCTTCCCTTCAGG + Intergenic
910098990 1:83556524-83556546 GGTCCTTATTCTTTTCCTCCTGG + Intergenic
911538623 1:99131016-99131038 TGTCTTTGTGCTTTACATTCTGG + Intergenic
912058606 1:105636079-105636101 GTTTTATGTTCTTTCCCTTTTGG + Intergenic
912313865 1:108648991-108649013 GTGTTTTGTTTTTTCCCTTCAGG - Exonic
912352646 1:109028893-109028915 TGCCTTTCCTCTTTCCCTTCTGG + Intronic
913368914 1:118074636-118074658 TGGCTTTGTTCTTGCCCTGCTGG + Intronic
914424198 1:147559889-147559911 GGTCTTAGTTCCTGGCCTTCAGG - Intronic
915598110 1:156906717-156906739 GGGGTATGTTCTTGCCCTTCTGG + Exonic
915983409 1:160438286-160438308 GGTATTTGTTCTTTCTCCTCTGG - Intergenic
916451731 1:164927555-164927577 GGTCTTTGTACTTTCCTGACAGG + Intergenic
916451734 1:164927586-164927608 TGTTTTTGTTTCTTCCCTTCAGG + Intergenic
917630919 1:176890633-176890655 GGTATTTGTCCTTTCTCTTTTGG - Intronic
917933217 1:179838638-179838660 ATTCTGTGTTCTTTGCCTTCAGG + Intergenic
918066015 1:181102195-181102217 GGTCTTTGTTCCTTCCCAGTAGG - Intergenic
919725086 1:200876721-200876743 GGACATTGTTGTTTCCTTTCAGG - Intergenic
920249091 1:204610637-204610659 GGTCTTTCTTCCTTCCTTGCAGG + Intergenic
920433733 1:205935273-205935295 GTTCTTTGTCCTTTCCCTCCCGG - Intronic
920942331 1:210495400-210495422 GGTCTTAGTTCTTTAACTTTAGG + Intronic
922222451 1:223618856-223618878 GGACTTTGTTCTTTGACTTCTGG - Intronic
923866482 1:237945148-237945170 GTTCTTTCATCTTTCCCTTATGG + Exonic
924008182 1:239635440-239635462 TCTCTTTGTTCTTTGCCCTCAGG + Intronic
1065076533 10:22085199-22085221 TTTCTTTATTCTTTTCCTTCTGG + Intergenic
1065505709 10:26428276-26428298 GGTCTTCATCCTTTCCTTTCTGG + Intergenic
1067209228 10:44244725-44244747 GGTCTTTCTTCTGTGCCCTCTGG - Intergenic
1068290757 10:54999435-54999457 GGTTTTTGATCTTTTCCTTTAGG + Intronic
1068792567 10:61043277-61043299 GGTCCATGTTCATTCCCTTTGGG + Intergenic
1069315872 10:67101223-67101245 GGTCTTTGGTTTTTTCCTTGGGG - Intronic
1071174559 10:82909496-82909518 GGTCTTTTTTTTTCCCCTTGGGG - Intronic
1071439552 10:85678312-85678334 AGCCTTTGGTCTTTTCCTTCAGG - Intronic
1071945920 10:90644870-90644892 GATATTTGTTCTGTCCATTCCGG - Intergenic
1075290796 10:121228885-121228907 GGTCTTTGATCCTTGCATTCTGG - Intergenic
1075642641 10:124075805-124075827 ACTCTTTGTTCCTTCCCTGCAGG - Intronic
1079029185 11:16973244-16973266 GGCCTGTGTTCTTGCCCATCTGG - Intronic
1080213603 11:29816669-29816691 GGTCTGTGTTCTTTCCTTCAGGG + Intergenic
1080903400 11:36516691-36516713 TCTCTTTGTACCTTCCCTTCTGG + Intronic
1081073641 11:38641921-38641943 AGTCTTGTGTCTTTCCCTTCAGG + Intergenic
1081679904 11:44994846-44994868 GGACACTGGTCTTTCCCTTCAGG - Intergenic
1083101776 11:60314940-60314962 GTTCTTTGTGGTTTCCCCTCTGG + Intergenic
1083287691 11:61670978-61671000 GTGCTCTGTTCTTTTCCTTCAGG - Intergenic
1083318344 11:61829593-61829615 TGCCTCTGTTCTTTTCCTTCTGG - Intronic
1084461809 11:69300378-69300400 GGTCTTTGTTCCTCACCTGCTGG - Intronic
1085235249 11:75009622-75009644 GGCCTCTGTTCTTTGCCCTCAGG + Exonic
1085851268 11:80123211-80123233 GGTCTTTGATCTTTCCTGTTAGG - Intergenic
1085955912 11:81394757-81394779 GGCATTTCTTCTTTCCATTCTGG + Intergenic
1086150754 11:83607857-83607879 AGTCTTTGTTCTTTCATGTCTGG - Intronic
1086272202 11:85081125-85081147 GGTCTTTATTTTTTCCTTTTTGG - Intronic
1087880494 11:103409899-103409921 GTTCTTTCATCTTTCCCTTATGG + Intronic
1089807704 11:121106302-121106324 TATCATTTTTCTTTCCCTTCTGG + Intronic
1089847963 11:121473216-121473238 TGTTTAGGTTCTTTCCCTTCTGG - Intronic
1090307347 11:125702727-125702749 AGTGTTTGTTATTTCCCTTCTGG - Intergenic
1090861702 11:130659256-130659278 GATCTTTATTATTTCCCTTCAGG - Intergenic
1091438697 12:495670-495692 TGTCTTTGTGCCTTCCCCTCAGG - Intronic
1091988895 12:4938374-4938396 TGCCTTTGTTCTTTTCCTTCTGG + Intergenic
1092202916 12:6597979-6598001 GGTCCTTGTTCTTTCGCTTTCGG + Exonic
1092336822 12:7640688-7640710 GGGCTTTGTTCTTTCGCTCTTGG + Intergenic
1092719971 12:11431883-11431905 GGTTTTTGTTTTTTGCTTTCAGG - Intronic
1092968300 12:13667008-13667030 GGGCATTGCTCTCTCCCTTCTGG + Intronic
1092988367 12:13869694-13869716 AGCCCTTGCTCTTTCCCTTCTGG + Intronic
1093571154 12:20667710-20667732 CATCTTTGTTCTTTTCGTTCAGG + Intronic
1094616165 12:32038283-32038305 CTTCTTTCTTCCTTCCCTTCAGG + Intergenic
1095264068 12:40133071-40133093 GGTCTATGTTGTTTGCTTTCTGG - Intergenic
1095274357 12:40262647-40262669 AGTCTTTGTTCTATCACTTGAGG - Intronic
1095387253 12:41665668-41665690 GGTGTGTGTTATTCCCCTTCTGG - Intergenic
1095588540 12:43876146-43876168 TGACTTTGTCCTTTCCTTTCCGG + Intronic
1096484647 12:51970580-51970602 GGTCTTTGTTCTATCCGTACTGG + Intronic
1096799939 12:54103783-54103805 CTACTTTGTTCTTGCCCTTCTGG + Intergenic
1097849585 12:64398410-64398432 GGCCTTTGTTCTTAGCCATCTGG - Intergenic
1098068114 12:66641935-66641957 GATCTTTATTTTTTCCATTCAGG - Intronic
1098630473 12:72715781-72715803 TGGCTTTGTGCTTTCCCTTTGGG - Intergenic
1099166819 12:79317243-79317265 GGTCATTCTACTTTGCCTTCGGG - Intronic
1099392352 12:82097378-82097400 AGTGATTGTTTTTTCCCTTCTGG + Intergenic
1099651608 12:85435277-85435299 GCTCTCTCTTCTTTCTCTTCTGG - Intergenic
1099736179 12:86568626-86568648 GAGCTTTGTTCTTTCTGTTCAGG - Intronic
1099803546 12:87488246-87488268 GGTGATTGTTATTTCTCTTCTGG + Intergenic
1100500000 12:95165067-95165089 AGTTTTTGGTCTTTCCTTTCAGG - Intronic
1100659812 12:96684945-96684967 GGTGTATTTGCTTTCCCTTCTGG + Intronic
1101330117 12:103750781-103750803 TGTTTTTCTTCTTTCCCTTGAGG - Intronic
1101696784 12:107134612-107134634 GGTCTTTGGTCTTCCACTCCAGG - Intergenic
1101704844 12:107211970-107211992 TGTCTTTGTTTATTTCCTTCTGG - Intergenic
1102277714 12:111596784-111596806 GGTCTTTTTTCTGTTCCTTGAGG - Intronic
1102531635 12:113551005-113551027 TGGCTTTGTTCTTTCACATCTGG + Intergenic
1104939022 12:132386263-132386285 GGTCTTTGATCTCTGCGTTCTGG - Intergenic
1105218511 13:18304524-18304546 GCTCTTTATTCTTTCGCCTCTGG + Intergenic
1105514854 13:21080022-21080044 GGAATTTGCTCTTTCACTTCAGG + Intergenic
1105588747 13:21771006-21771028 GGTTTTTTTTCTTTCCCCTGTGG + Intergenic
1105598786 13:21866703-21866725 GGTGATTGTTATTGCCCTTCTGG + Intergenic
1105721962 13:23125559-23125581 TGTTTTTGTTTTTTCTCTTCTGG + Intergenic
1106887840 13:34209019-34209041 TCTTTTTGTTCTTTCTCTTCTGG - Intergenic
1107577421 13:41741922-41741944 GGACTCTGTTCTTTTCCATCAGG - Intronic
1108890803 13:55256710-55256732 GTTCTCTGTTCTAGCCCTTCAGG - Intergenic
1109075577 13:57830984-57831006 GTTTTTTTTTCTTTTCCTTCTGG + Intergenic
1109484650 13:63002450-63002472 AGTGGTTGTTATTTCCCTTCTGG - Intergenic
1110186595 13:72682362-72682384 GGACTTTGTTCTTTTTCTTATGG - Intergenic
1110730174 13:78871225-78871247 GGTCTTTGGACTCTGCCTTCTGG + Intergenic
1110886011 13:80636649-80636671 AGTCTTGTGTCTTTCCCTTCAGG + Intergenic
1111607371 13:90558478-90558500 AGTCTTTCCTCTTTCTCTTCAGG - Intergenic
1112082308 13:95985997-95986019 AGTGTTTTTTCTTTCCCTTATGG - Intronic
1112175619 13:97020697-97020719 AGCCATTGTTCTTTCCCTTAGGG - Intergenic
1112481715 13:99782120-99782142 GGTCAGTTTTCTTTCTCTTCAGG + Intronic
1114194544 14:20465667-20465689 GTTCTTTGCTCTTTCCTTTAGGG + Intergenic
1114652094 14:24291705-24291727 GGTCTTTGGTCTTTTTCTCCTGG - Intronic
1115286447 14:31718428-31718450 GGCCTTTATTTTTTGCCTTCTGG + Intronic
1115780757 14:36765489-36765511 GGTACTTGTACTTTTCCTTCAGG - Intronic
1116323709 14:43502946-43502968 GGTTTTTGTTCTTGCCCTGTAGG - Intergenic
1116633652 14:47365204-47365226 GTTCGTTTTTCTTCCCCTTCTGG + Intronic
1116841562 14:49823640-49823662 TTTCTTTTTTCTTTTCCTTCTGG - Intronic
1117615324 14:57528411-57528433 GGTCTTTCCTCTGACCCTTCAGG - Intergenic
1118177905 14:63461187-63461209 GGCCTCGGTTCTTTCCCTCCTGG - Intronic
1118458143 14:65963373-65963395 AGTCTTTGACCTTGCCCTTCAGG + Intronic
1119221318 14:72910128-72910150 GGTATTTGTTTTTTTCCTTGCGG - Intergenic
1120562346 14:86010743-86010765 GGTCTATGTTCTTTCCCTGCTGG - Intergenic
1120963535 14:90147433-90147455 GATCTTCTTTCTTTCCCTCCTGG + Intronic
1121287986 14:92751458-92751480 GGAGTTTGTTCCTTCCCCTCAGG + Intergenic
1122030681 14:98909237-98909259 GCTCCGTGTTCTTTCCCTTTTGG - Intergenic
1123045199 14:105508931-105508953 GGTCTTCCTTCTTTCCCTTTGGG + Intergenic
1123104153 14:105830144-105830166 GGTGATTGTTATTTCTCTTCTGG + Intergenic
1123973703 15:25532639-25532661 GGACTTTTTTCTTTTCCTTTAGG + Intergenic
1124450060 15:29779986-29780008 GGTTTTTTTTTTTTTCCTTCGGG - Intronic
1124809318 15:32918806-32918828 TTTCTTTGTACTTTACCTTCAGG - Intronic
1126448252 15:48775190-48775212 TGTCTTTGTTCTCTCCTTTTGGG - Intronic
1127779570 15:62299360-62299382 ACTCTTTTCTCTTTCCCTTCTGG - Intergenic
1129137419 15:73566974-73566996 TGTCTTTTTTCTTTACCTACTGG - Intronic
1131670418 15:94614141-94614163 GGGCTCTTTGCTTTCCCTTCAGG - Intergenic
1131735228 15:95325004-95325026 GGCCTTTGTTCATCCCCTTCAGG - Intergenic
1131787346 15:95927246-95927268 GGGCTTTATTCTGTCTCTTCTGG + Intergenic
1131791479 15:95970481-95970503 AGTCTTGGGTCTTTCCCTTAAGG + Intergenic
1132778058 16:1607297-1607319 GGTCATTTTTTTTTCCCTGCAGG - Exonic
1133411384 16:5572081-5572103 GGTGTTTGCTCTTTCCCTTGTGG + Intergenic
1135283131 16:21170415-21170437 GCTCTTTGTCCTTTGCCTACAGG + Exonic
1136686805 16:31999907-31999929 TCTCTTTCTTGTTTCCCTTCTGG + Intergenic
1136882362 16:33910336-33910358 TCTCTTTCTTGTTTCCCTTCTGG - Intergenic
1137385617 16:48039999-48040021 GTTCTTTTTTCTTTCTCTTTGGG + Intergenic
1138790226 16:59895285-59895307 GGAATTGGTTATTTCCCTTCTGG + Intergenic
1139607038 16:68026532-68026554 GCTCTTTGTTTTTTACCCTCTGG + Intronic
1140044708 16:71432723-71432745 GGGCATTGCTCTTTCCCTGCAGG - Intergenic
1140637246 16:76929559-76929581 GGTCTGTGTTCTTTCTCTCCGGG - Intergenic
1140740109 16:77933975-77933997 GGTCTGTGTTCTTTTTCTTAAGG + Intronic
1141634704 16:85307997-85308019 GGGCTTGGTTATTTCCCTCCGGG + Intergenic
1203089647 16_KI270728v1_random:1205120-1205142 TCTCTTTCTTGTTTCCCTTCTGG + Intergenic
1143044086 17:4062711-4062733 GATCTTTGCTGTTTTCCTTCTGG + Intronic
1143056492 17:4166250-4166272 GTTCTTTGTTCATTCTTTTCTGG - Exonic
1143555564 17:7657609-7657631 GATCTGTGTTTCTTCCCTTCGGG + Exonic
1143939514 17:10525457-10525479 AGTTTTTGTTCTCTCGCTTCAGG + Exonic
1145044185 17:19599771-19599793 GTTCTTTCATCTTTCCCTTATGG - Intergenic
1147147769 17:38495577-38495599 TCTCTTTCTTCTTTCCCTTCTGG + Intronic
1147810214 17:43163588-43163610 TGTCTTTCTTTTTTTCCTTCTGG + Intergenic
1149354573 17:55826782-55826804 GCTCTTTCTTCTTTCCCCTGAGG + Intronic
1150917482 17:69451511-69451533 TGTTTTTGGTCTTGCCCTTCAGG + Intronic
1151270029 17:72986893-72986915 TGCTTTTATTCTTTCCCTTCTGG - Intronic
1151914450 17:77107157-77107179 GCTCTTTGTTCTTTCCCCTGTGG - Intronic
1153507537 18:5816984-5817006 GGTCTTCATTTTTTCCCTTCAGG - Intergenic
1154187192 18:12195522-12195544 TGTCTTTGTTTTTTTCCTTTTGG + Intergenic
1155501362 18:26490428-26490450 GTTCATTGCTCTTTCCCTCCAGG + Intronic
1156715799 18:40008525-40008547 AGTCTTTCTTCTTTCTCTTTGGG - Intergenic
1157911822 18:51623557-51623579 GGTATTTTCTCTTTCTCTTCTGG + Intergenic
1158312865 18:56177486-56177508 GGTCCTGATTTTTTCCCTTCTGG - Intergenic
1159102005 18:63968339-63968361 GGTGTTTCTTCGTTCCCTTGTGG - Intronic
1159992212 18:74922084-74922106 GGTCTCTGCTCATTCCCTTTTGG + Intronic
1161385482 19:3989832-3989854 GGCCTTTTTTCTTTCTTTTCAGG - Intergenic
1161678175 19:5664902-5664924 GGTCTGTGCTCATTCTCTTCGGG + Intronic
1164468885 19:28511807-28511829 GTTCTTTGGACTGTCCCTTCTGG - Intergenic
1165377889 19:35456092-35456114 GGTCTTTGTTCTGTCCTGTGTGG - Intergenic
1166150724 19:40873264-40873286 GGTTTTTGTTCTTCCCTTTGGGG - Intronic
925269615 2:2593298-2593320 TTTCTTTGTTCTTTACCTTTGGG - Intergenic
926602117 2:14855850-14855872 GGCCTGTGTTCTTTCCTTTAGGG - Intergenic
926808153 2:16731924-16731946 AGTCTTTCTTCTTTCTCCTCTGG + Intergenic
927996302 2:27489229-27489251 GGTCTTTGCACTCCCCCTTCAGG + Intronic
928063840 2:28142950-28142972 GGTCTTTGTTATTTCCACCCTGG + Intronic
928739459 2:34332906-34332928 GGTTTTTTTTTTTTCCCCTCTGG + Intergenic
928889129 2:36181518-36181540 GTTCTTTGTTCTTTAGTTTCAGG - Intergenic
930251661 2:49041626-49041648 GGTCTTGGGTCTTTCAATTCTGG + Intronic
931108395 2:59083147-59083169 CATCTCTCTTCTTTCCCTTCTGG - Intergenic
931592904 2:63905544-63905566 GGTCTTTGTTCTTACTTTACAGG - Intronic
932987447 2:76743459-76743481 GGTCTTTCTTTCTTCCCTTCCGG + Intergenic
934295796 2:91742105-91742127 GCTCTTTATTCTTTCGCCTCTGG - Intergenic
934908174 2:98224261-98224283 GCTCTTTCTTCTTTTCTTTCTGG - Intronic
935025012 2:99268578-99268600 AGTGATTGTTATTTCCCTTCTGG + Intronic
936110415 2:109660020-109660042 GGCCTTAGTTCTTTGCCTCCAGG - Intergenic
936655811 2:114485650-114485672 GGTCTTTATTGTGTCTCTTCTGG + Intronic
936861177 2:117022396-117022418 GTTCTTTCATCTTTCCCTTATGG - Intergenic
937158440 2:119738193-119738215 GATGTTTTTTCTTTCCCTTTTGG - Intergenic
937269678 2:120640998-120641020 TGCATTTGTTCTTTCCCATCAGG + Intergenic
937374500 2:121326459-121326481 GATTTTTGCTCTTGCCCTTCTGG - Intergenic
937963115 2:127478546-127478568 GGCTTTTTTTCTTCCCCTTCCGG - Intronic
938118787 2:128619768-128619790 GGTCTTTCTCCATTCCCTTACGG - Intergenic
939141454 2:138359139-138359161 GGACATTGTTCTTGGCCTTCAGG + Intergenic
939264747 2:139856725-139856747 GGTGGTTTTTCTCTCCCTTCAGG + Intergenic
939293321 2:140222971-140222993 GTTCTTTCCTCTTTCCCTTATGG + Intergenic
941499656 2:166256169-166256191 GGCCTTTATTTTTTTCCTTCTGG + Intronic
941959729 2:171241704-171241726 GCTCTTTCTTCTTTCTGTTCAGG + Intergenic
943484640 2:188464571-188464593 GGCCTGTGTTCTTTCCTTTAGGG + Intronic
943797920 2:192021511-192021533 GGTCTCTGTTCTTTCAGTTTGGG - Intronic
944075574 2:195726827-195726849 GGGCTTGTTTCTTTCCCTTAAGG - Intronic
945858854 2:215097808-215097830 GGTCCCTGTTATTTACCTTCTGG + Intronic
946336543 2:219041286-219041308 GCTGTTTCTTCTTTCTCTTCGGG + Intronic
946820408 2:223622884-223622906 GGTCTTTGGACTTCCTCTTCTGG + Intergenic
947145830 2:227064434-227064456 GTTCTTTTTTCTTTTCCCTCAGG - Intronic
949023342 2:241753513-241753535 ACTCTGTGGTCTTTCCCTTCTGG + Intronic
1171779493 20:29406148-29406170 GGCCTGTGTTCTTTCCTTTAGGG - Intergenic
1171822944 20:29871866-29871888 GGCCTGTGTTCTTTCCTTTAGGG - Intergenic
1171851735 20:30313610-30313632 CTACTTTGTTCTTGCCCTTCTGG + Intergenic
1171897173 20:30818450-30818472 GGCCTGTGTTCTTTCCTTTAGGG + Intergenic
1172297818 20:33826047-33826069 GGTCATAGTTCTTACCCTCCAGG + Intronic
1172879074 20:38186636-38186658 GGTTTTATTTCTTTCCCATCTGG + Intergenic
1173236326 20:41249320-41249342 GGTCAATGTTGTTTCCCTTTTGG - Intronic
1174788017 20:53450966-53450988 GGTCTTTTTTTTTTCCCTCTGGG - Intronic
1175335575 20:58193730-58193752 GGACTAAGTTCTTTCCCCTCTGG - Intergenic
1177064053 21:16407509-16407531 CCTCTTTTTTCTTTCCCTCCAGG - Intergenic
1177522672 21:22248720-22248742 TTTCTTTGTTCTTTCCCCTAAGG + Intergenic
1178373299 21:32045736-32045758 AGTTCTTGTTCTTTTCCTTCAGG - Intergenic
1178672736 21:34606160-34606182 GTTCATTGTTCTCTCCCATCTGG - Intronic
1179405161 21:41119772-41119794 AGCATTTGTCCTTTCCCTTCTGG + Intergenic
1180105717 21:45616983-45617005 GGTCTCTGCCCTTTCCCATCAGG + Intergenic
1180909205 22:19436947-19436969 GCTCCTTGGTCTTTCCCATCAGG - Intronic
1181751467 22:24991950-24991972 GGGCTTTGCTCTGTCCCCTCCGG + Intronic
1182192544 22:28477804-28477826 GGTCTTTGTTCTTTCCCTTCTGG + Intronic
1185014587 22:48335539-48335561 AGTCTTGTTTCTTTCCCTCCAGG - Intergenic
949471004 3:4396506-4396528 GGGCTCTATCCTTTCCCTTCTGG + Intronic
949821801 3:8123838-8123860 GGTCTCTGCTCTCTGCCTTCTGG - Intergenic
950168552 3:10819904-10819926 GGGGTTTGTTCATGCCCTTCAGG + Intronic
951248457 3:20367368-20367390 TGTCTTATTTTTTTCCCTTCTGG + Intergenic
951778452 3:26336395-26336417 GCTCTGTGGTCTTTCCCTCCAGG - Intergenic
952522330 3:34174251-34174273 AGTGTTTGTTATTTCTCTTCTGG + Intergenic
953143643 3:40252514-40252536 GTTCTTTCATCTTTCCCTTACGG - Intronic
953665366 3:44922333-44922355 ACTCTTTTCTCTTTCCCTTCCGG + Intronic
953811103 3:46113588-46113610 GGTCTTTTTCCTCTCTCTTCTGG + Intergenic
954886415 3:53878442-53878464 TGTCTTTGTTCATTACTTTCTGG + Exonic
955450676 3:59064086-59064108 AGTGATTGTTATTTCCCTTCTGG + Intergenic
956067317 3:65411018-65411040 GGTTCTTTTTCTTTCCTTTCTGG - Intronic
957085652 3:75674504-75674526 GGCCTGTGTTCTTTCCTTTAGGG + Intergenic
957681493 3:83441231-83441253 GGACTTTGTTCTTTTTTTTCTGG - Intergenic
957976098 3:87447346-87447368 AGTACTGGTTCTTTCCCTTCAGG + Intergenic
958502618 3:94934535-94934557 AGTCTGTGTCCTTTCCCTTAAGG - Intergenic
959362845 3:105416129-105416151 TGACTTTGTTCTTTCTCTTAAGG + Intronic
959685842 3:109145368-109145390 AGTATTTGTTCTTTTCCGTCTGG - Intergenic
961233926 3:125347177-125347199 GGTCTTTGTTAATTTCTTTCAGG - Intronic
961239366 3:125397101-125397123 GGTCTGTGCTCTTTGCCATCAGG + Intergenic
962060220 3:131918558-131918580 GTTATTTGTTTTTTCCTTTCCGG - Intronic
962445857 3:135464064-135464086 GGTCTTTTTTTTTTTTCTTCTGG - Intergenic
962870821 3:139491561-139491583 GGCCTGAGCTCTTTCCCTTCAGG + Intergenic
962896967 3:139724279-139724301 GCCCTCTTTTCTTTCCCTTCTGG + Intergenic
963662146 3:148140619-148140641 TGTCTTTGTACTATCCCTGCTGG - Intergenic
963942981 3:151113745-151113767 GTTCCATGTTCTTTTCCTTCTGG + Intronic
964033901 3:152172204-152172226 GGTGTTTATTTTTTTCCTTCAGG - Intergenic
964368391 3:155973104-155973126 GCTTTTTCTTCTTTCACTTCTGG + Intergenic
964376019 3:156049920-156049942 GGTCTTTGTTGTTTCACTCATGG + Intronic
964496370 3:157295019-157295041 GATTTTTGTTCTCTCCTTTCAGG + Intronic
966187289 3:177239208-177239230 GTTCATTTTTCTTTCCCTTAGGG - Intergenic
966234544 3:177686292-177686314 CTCCTTTGTTCTTTCCTTTCAGG + Intergenic
968293810 3:197558031-197558053 GATCTATGTTTTTTCCCTTGGGG - Intronic
969442725 4:7226850-7226872 TGTTTTTGTTTTTTCCCTTCTGG + Intronic
969453335 4:7287200-7287222 GGTCCTTGATCTTTCTCATCTGG - Intronic
969547833 4:7843474-7843496 TGTTTTTGTTTTTTCCCTTAAGG - Intronic
970816588 4:20163114-20163136 GGTCATGGTTCTTTACCTGCTGG - Intergenic
971462250 4:26912851-26912873 GGTGTTTCTTCTTTCCATTGGGG + Intronic
971482639 4:27127954-27127976 GCTCTTTGTCCTTTTCCATCTGG + Intergenic
971967213 4:33575750-33575772 GGTTTATTTTCTTTCTCTTCTGG + Intergenic
972103070 4:35446610-35446632 TGTCTTTATTCTTTCCATTTTGG - Intergenic
972655245 4:41057784-41057806 TGTGTTTCTCCTTTCCCTTCTGG + Intronic
973156543 4:46962038-46962060 TGTCTTAGATCTATCCCTTCAGG + Intronic
973706511 4:53586130-53586152 GGCCTTTTTTTTTTCCCTTGAGG - Intronic
974094782 4:57351279-57351301 GCTCTTTGTTCCTTCCCTAAGGG + Intergenic
975335298 4:73169465-73169487 AGACTTTTTTTTTTCCCTTCAGG - Intronic
975956282 4:79844164-79844186 GGTATTTGTTCCTCCCCTCCAGG + Intergenic
976183744 4:82424383-82424405 GAACAATGTTCTTTCCCTTCTGG - Exonic
977218982 4:94316403-94316425 GGTCTCTCTTCTTTGCCATCTGG + Intronic
978783684 4:112584174-112584196 GATCTTTTTTCTTTCCCCTTAGG - Exonic
979435354 4:120681940-120681962 TGTCTTTCTTCTTTTCGTTCTGG - Intergenic
979486622 4:121278001-121278023 GGTCATTGCACTTTCCCTTAAGG + Intergenic
980964496 4:139507754-139507776 TTTCTTTTATCTTTCCCTTCAGG - Exonic
981762757 4:148211933-148211955 GCTCATTCTTCTTTCCCTTCTGG + Intronic
981989987 4:150907075-150907097 GATCTTTTTCCTTTCCTTTCCGG - Intronic
982292672 4:153794033-153794055 GGTTTTTGCTGTTTCCATTCAGG - Intergenic
982321133 4:154078436-154078458 GGTTTATTTTCTTCCCCTTCTGG - Intergenic
982443681 4:155465320-155465342 GTTCTTTCATCTTTCCCTTATGG + Intergenic
985257003 4:188080379-188080401 GATCTTTGTTTTGTTCCTTCAGG + Intergenic
985444361 4:190013021-190013043 GGCCTGTGTTCTTTCCTTTAGGG - Intergenic
985790588 5:1925095-1925117 GGTCTTTGTAAATTCCCTTGTGG - Intergenic
986228301 5:5838022-5838044 TGACTTTCTTCTTTCTCTTCTGG - Intergenic
986841692 5:11705067-11705089 GCTATTTTTTCTTTCCCTTCTGG - Intronic
987200987 5:15577981-15578003 GGGCTTTGTTCTTTGGATTCTGG + Intronic
988189539 5:27910618-27910640 TGTTTCTGTTCTTTCTCTTCGGG + Intergenic
991730851 5:69586611-69586633 GGCTTTTTTTCTTTTCCTTCTGG - Intronic
991807287 5:70441773-70441795 GGCTTTTTTTCTTTTCCTTCTGG - Intergenic
991864099 5:71041245-71041267 GGCTTTTTTTCTTTTCCTTCTGG + Intronic
992285887 5:75235584-75235606 GGGCTTTGTCCTATACCTTCTGG - Intronic
993369433 5:87074180-87074202 AGTTTTTTTTCTTGCCCTTCCGG + Intergenic
995154018 5:108889031-108889053 GGTCTTTTTTATTCCCCTTCAGG - Intronic
996606406 5:125328594-125328616 GGTCCATGTTTTTTCCTTTCAGG + Intergenic
997255374 5:132424224-132424246 AGTCATTCCTCTTTCCCTTCAGG - Intronic
998158153 5:139797574-139797596 TATCTTTGCTCTCTCCCTTCAGG - Intronic
998269680 5:140695395-140695417 GGTCCTTGTTCTTACCCTAGTGG + Intronic
998919951 5:147057112-147057134 TGACTTTGTTTTTTCCCTCCTGG - Intronic
1001387773 5:171354009-171354031 TGAATTTGTTCTTTCTCTTCTGG - Intergenic
1003297406 6:4844081-4844103 GGTGATTGTTTTTTCTCTTCCGG + Intronic
1003806309 6:9729139-9729161 GTTCTTTTTTCTTTTCCATCAGG + Intronic
1005470710 6:26159589-26159611 AGTATTTGTTCCTTTCCTTCTGG - Intronic
1005991242 6:30903789-30903811 GCTCTCTGTTCTTTCTCTCCAGG + Intergenic
1007917899 6:45578044-45578066 GCTCTTTGTTCTGTCTCCTCTGG - Intronic
1008622340 6:53282862-53282884 GGTTGTTTTTCTTTCCCTTCAGG - Intronic
1008940602 6:57041423-57041445 AGTCTTGTTTCCTTCCCTTCAGG - Intergenic
1008957494 6:57231846-57231868 GGTTTTTTTTTTTTCCCTTAGGG - Intergenic
1009202911 6:60767574-60767596 TGTCTTTGTTCCTTTCCTCCAGG - Intergenic
1009335872 6:62490870-62490892 GATCTTTGATTTTGCCCTTCAGG + Intergenic
1009948715 6:70369604-70369626 CTTCTCTGTTCTTTCCCTTTTGG + Intergenic
1010862967 6:80937023-80937045 AGTCATTGTTATTTCTCTTCTGG + Intergenic
1010942443 6:81934475-81934497 GCTCGCTGTTCTGTCCCTTCTGG + Intergenic
1012445949 6:99307376-99307398 GCTCATTGTTCTCTCCATTCGGG - Intronic
1013412926 6:109897790-109897812 GTTCATTGTTCTTTCCCATCTGG + Intergenic
1013913689 6:115309764-115309786 AGTGATTGTTATTTCCCTTCTGG + Intergenic
1014028184 6:116672590-116672612 TCTCTTTGCTCTCTCCCTTCTGG + Intergenic
1014720408 6:124911274-124911296 GGTCTTTGCCCTCTCCCTTGTGG - Intergenic
1014822770 6:126011231-126011253 CTTCCTTTTTCTTTCCCTTCAGG + Exonic
1016803294 6:148188393-148188415 GATCTTTCTCCTTTTCCTTCAGG + Intergenic
1018427901 6:163699951-163699973 GGTTTTTCTTTTTTTCCTTCTGG + Intergenic
1019393247 7:801887-801909 GGTCTCTGGTCCTTCTCTTCTGG + Intergenic
1021525823 7:21586661-21586683 GGGCTTTGTTCTTTTTCTTAAGG - Intronic
1022203250 7:28138172-28138194 GATCTGTGTTTATTCCCTTCTGG - Intronic
1022970551 7:35513079-35513101 GGCTTTTATTCTTTCCCATCGGG - Intergenic
1023703496 7:42915205-42915227 GGTTTTTTTTTTTTTCCTTCAGG + Intronic
1024548448 7:50541017-50541039 GGACTTTATTCTGTTCCTTCAGG - Intronic
1025585431 7:62779029-62779051 GGTATTTCTTTTTTCACTTCAGG - Intergenic
1025969079 7:66305346-66305368 GGTCTTTGTTCTTTGCCTGGTGG + Intronic
1026358647 7:69582421-69582443 GGTCCTTGTTCTTTCTCATGAGG - Intergenic
1028595215 7:92541080-92541102 GGTCCTTGTTTTTTCACTTCTGG + Intergenic
1028821302 7:95214859-95214881 CGTCTGTGTTCCTTACCTTCAGG - Intronic
1029622720 7:101700023-101700045 GGTCTTTGTTCTCCACCTTCCGG - Intergenic
1031060781 7:117049098-117049120 GGTGTTTATCTTTTCCCTTCAGG + Intronic
1031489004 7:122364809-122364831 AGTCTTAGATCTTTCCCTTTGGG + Intronic
1031698792 7:124897212-124897234 GTTCTTTCTTTTTTTCCTTCAGG - Exonic
1031801160 7:126247924-126247946 TGGCTTTGTTCTTTTCCCTCAGG + Intergenic
1032587705 7:133162990-133163012 GGTTTTTGTTCTTTGACTACTGG + Intergenic
1033529482 7:142247816-142247838 ATGCTTTGTGCTTTCCCTTCCGG + Intergenic
1033714531 7:143986021-143986043 TGCCTTCCTTCTTTCCCTTCTGG + Intergenic
1034134999 7:148758951-148758973 GGTCTTGGTTCATTTCCTTTTGG + Intronic
1035609649 8:951995-952017 GGACTTTGTCCTTGCCCTCCCGG + Intergenic
1036112940 8:5925689-5925711 TGTCTTTGTTTTTTCATTTCTGG - Intergenic
1036650916 8:10643424-10643446 AGTGTTAGTTCTTCCCCTTCTGG + Intronic
1037372667 8:18196647-18196669 AGTATTTTTTCTCTCCCTTCTGG + Intronic
1037806240 8:22059206-22059228 TGTCTTTCTGCTTTCTCTTCTGG - Exonic
1037906296 8:22717799-22717821 AGTTTTTGTTTTTTCTCTTCAGG - Intronic
1038051154 8:23813503-23813525 TGTTTTTGTTCTTTCCAATCTGG + Intergenic
1039003935 8:33012602-33012624 GTTCTTTCATCTTTCCCTTACGG - Intergenic
1039612175 8:38928750-38928772 TGTATTTAATCTTTCCCTTCAGG - Intronic
1040376473 8:46829907-46829929 GTTCTTTCATCTTTCCCTTAGGG + Intergenic
1041076314 8:54173284-54173306 GGTCTTTGCTCTGTGCCATCAGG - Intergenic
1041995271 8:64048265-64048287 AGTCTATCTTCTTTCACTTCTGG + Intergenic
1042119266 8:65466830-65466852 GGTGTTTGTTGTTCCCCTTCTGG - Intergenic
1043257819 8:78157985-78158007 TGTCTTTGTCCTTTCCCTAATGG - Intergenic
1043615801 8:82123729-82123751 GTTCTTTGTTCTTTTCCTGTGGG + Intergenic
1047191855 8:122685569-122685591 GCTGTTTCTTCTTGCCCTTCTGG - Intergenic
1047364849 8:124202291-124202313 GGTCTTTGTTCTGTTGCCTCTGG - Intergenic
1047517643 8:125569050-125569072 GGTCTTTGGTTTTTCTCTACAGG + Intergenic
1047685265 8:127298828-127298850 GGTGTTTTTTTTTTCCCTTTTGG - Intergenic
1048620243 8:136124578-136124600 GGTCTTTGTTCTTTCCCTTTTGG + Intergenic
1050386093 9:5092593-5092615 GTTCTTTCATCTTTCCCTTACGG - Intronic
1051735500 9:20194203-20194225 GGTCTTTATTCTTTGATTTCTGG - Intergenic
1052833650 9:33234675-33234697 CTTCCTTGTTCTTTCCATTCTGG + Intronic
1053185888 9:36016088-36016110 GCCCTTTCTTCTTCCCCTTCTGG - Intergenic
1053596625 9:39568712-39568734 GGTCTTTATTTTTTTCCTCCAGG + Intergenic
1053749739 9:41240270-41240292 GGCCTGTGTTCTTTCCTTTAGGG + Intergenic
1053789515 9:41676863-41676885 CTACTTTGTTCTTGCCCTTCTGG + Intergenic
1054155626 9:61637889-61637911 CTACTTTGTTCTTGCCCTTCTGG - Intergenic
1054255241 9:62804610-62804632 GGCCTGTGTTCTTTCCTTTAGGG + Intergenic
1054336067 9:63811001-63811023 GGCCTGTGTTCTTTCCTTTAGGG - Intergenic
1054475395 9:65568899-65568921 CTACTTTGTTCTTGCCCTTCTGG - Intergenic
1054569631 9:66796290-66796312 GGTCTTTATTTTTTTCCTCCAGG - Intergenic
1054659676 9:67692270-67692292 CTACTTTGTTCTTGCCCTTCTGG - Intergenic
1054938898 9:70718253-70718275 AGTCATTGTTATTTCTCTTCTGG - Intronic
1054940589 9:70736246-70736268 AGTCATTGTTATTTCTCTTCTGG - Intronic
1055569912 9:77606209-77606231 TGGCTTTTTTCTTTCCCTTTTGG - Intronic
1055662750 9:78521551-78521573 AGTTTTTGTTCTTTCTCTTCTGG - Intergenic
1055983382 9:82029538-82029560 GGCATTTGATGTTTCCCTTCAGG - Intergenic
1057433131 9:95013837-95013859 GGTCTCATTTCTTTCCCTTGGGG + Intronic
1058365901 9:104207936-104207958 GGTTTTTTTTTTTTTCCTTCTGG - Intergenic
1059090589 9:111353810-111353832 GATCTTTGTTTCCTCCCTTCAGG + Intergenic
1059339815 9:113591374-113591396 GGTTTTTGCTCTTTCTCTTCCGG - Exonic
1059735916 9:117099458-117099480 AGACTTTATTCTTTCCCTACTGG + Intronic
1060357191 9:122920655-122920677 GTTCTTTGTCCTGTCCATTCTGG + Intronic
1060792172 9:126493689-126493711 GGTCTTGGTCCTTTCTCTTTAGG + Intronic
1060891424 9:127191645-127191667 TGTCTTTTTTCTTTTCCATCAGG + Intronic
1203372338 Un_KI270442v1:320228-320250 GGCCTGTGTTCTTTCCTTTAGGG - Intergenic
1203375998 Un_KI270442v1:378415-378437 GGCCTGTGTTCTTTCCTTTAGGG - Intergenic
1185567375 X:1105759-1105781 GTTCTGTGTTCTTTTCCTTGTGG - Intergenic
1186932644 X:14411801-14411823 GGTCTGTGTTCTTTCTCTATGGG - Intergenic
1188685785 X:33068094-33068116 GGTCTTTGTTATTCCCATTCTGG - Intronic
1189079934 X:37960054-37960076 GGTCTCTGTTCCTTGCATTCTGG - Intronic
1189849726 X:45166340-45166362 AGTCTTTGTTCTTTGTCTCCAGG + Intronic
1191639326 X:63413312-63413334 TGTCTTATTTCTTTTCCTTCTGG - Intergenic
1192249196 X:69397090-69397112 GGCCTTTGTTCTCCCCTTTCAGG + Intergenic
1192364055 X:70455995-70456017 GCTCTCTCTTCTTTCCCTTCAGG - Intronic
1192688617 X:73334685-73334707 GGTGATTGTTATTTCTCTTCTGG + Intergenic
1194214353 X:91110367-91110389 GGTGATTGTTATTGCCCTTCTGG + Intergenic
1196095857 X:111799224-111799246 GGGCTTTATTTTTTTCCTTCAGG - Intronic
1196368466 X:114948582-114948604 GGTCTTTTTTTTTTCTCTTAAGG - Intergenic
1197171718 X:123442410-123442432 GATCTTTGTTCTGTCCCTTGGGG - Intronic
1198773636 X:140156411-140156433 GGTTTTTTTTCCTTCACTTCAGG - Intergenic
1199412653 X:147542584-147542606 GATCTTTGTCCTTGCCCTTGAGG - Intergenic
1199766552 X:150945708-150945730 GGTGCCTGTTCTTTCGCTTCAGG + Intergenic
1200765773 Y:7079505-7079527 GGGTCTTGTTCTCTCCCTTCTGG - Intronic
1201405210 Y:13643009-13643031 GGTCTGTGTTCTCTCCTTTAGGG - Intergenic