ID: 1182194328

View in Genome Browser
Species Human (GRCh38)
Location 22:28499035-28499057
Sequence CACAGGCGTGTGCCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 188}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182194328_1182194340 9 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194340 22:28499067-28499089 ACTTGGGAGGCTGAGGTTGGGGG 0: 177
1: 9885
2: 27966
3: 78398
4: 171259
1182194328_1182194339 8 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194339 22:28499066-28499088 TACTTGGGAGGCTGAGGTTGGGG 0: 34
1: 550
2: 3192
3: 11124
4: 19227
1182194328_1182194331 -7 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194331 22:28499051-28499073 GCCTGTGGTCCCAGCTACTTGGG 0: 2717
1: 41335
2: 169840
3: 257462
4: 215499
1182194328_1182194337 6 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194337 22:28499064-28499086 GCTACTTGGGAGGCTGAGGTTGG 0: 12612
1: 103254
2: 205356
3: 262421
4: 281961
1182194328_1182194342 25 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194342 22:28499083-28499105 TTGGGGGATTGTTTGAGCCTGGG 0: 1
1: 15
2: 378
3: 4791
4: 22151
1182194328_1182194330 -8 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194330 22:28499050-28499072 CGCCTGTGGTCCCAGCTACTTGG 0: 1698
1: 50471
2: 116116
3: 175602
4: 127583
1182194328_1182194333 -4 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194333 22:28499054-28499076 TGTGGTCCCAGCTACTTGGGAGG 0: 4395
1: 51934
2: 165955
3: 225063
4: 222996
1182194328_1182194338 7 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194338 22:28499065-28499087 CTACTTGGGAGGCTGAGGTTGGG 0: 42
1: 507
2: 3461
3: 6361
4: 8581
1182194328_1182194341 24 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194341 22:28499082-28499104 GTTGGGGGATTGTTTGAGCCTGG 0: 1
1: 16
2: 291
3: 3625
4: 10765
1182194328_1182194335 2 Left 1182194328 22:28499035-28499057 CCAGGTGTAGGCACACGCCTGTG 0: 1
1: 0
2: 2
3: 34
4: 188
Right 1182194335 22:28499060-28499082 CCCAGCTACTTGGGAGGCTGAGG 0: 89011
1: 200457
2: 243521
3: 257984
4: 301655

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182194328 Original CRISPR CACAGGCGTGTGCCTACACC TGG (reversed) Intronic
902252162 1:15161066-15161088 CACAGGCAGTTGCCTCCACCAGG - Intronic
902883792 1:19390588-19390610 CACAGGAGTGTGCCCACCCCAGG + Intronic
903523279 1:23972131-23972153 CACAGGTGTGAGCCACCACCCGG - Intronic
906088595 1:43157608-43157630 TACAGGCGTGAGCCACCACCCGG - Intergenic
906483331 1:46215755-46215777 TACAGGCATGTACCTACACCTGG - Intronic
906539099 1:46571399-46571421 TACAGGTGTGTGCCACCACCTGG - Exonic
906838153 1:49106513-49106535 CACAGCCATGTGCCTACCTCTGG - Intronic
908096629 1:60746358-60746380 CACCGGAGTGTGCTTACAGCTGG - Intergenic
908111429 1:60902477-60902499 CACAGTCATGTGTCCACACCTGG + Intronic
910247842 1:85161448-85161470 TACAGGCGTGAGCCACCACCTGG - Intronic
910943438 1:92561911-92561933 TATAGGCGTGCGCCCACACCTGG + Intronic
914436804 1:147667713-147667735 TACAGGCGTGAGCCAGCACCCGG - Intronic
915616551 1:157043872-157043894 CAGAGGCGTGGGCCTCCACCAGG - Intronic
915648710 1:157292332-157292354 CACAGGGGTGTGCATACAGTGGG - Intergenic
915864426 1:159483621-159483643 CACAGGCGTGCCACCACACCTGG - Intergenic
916583475 1:166129168-166129190 CACAGGAGTGCGCCCACAGCAGG - Intronic
917331978 1:173890137-173890159 TACAGGCGTGTGACCACACCTGG + Exonic
919258850 1:195162793-195162815 CACAAGTGTGTGCCACCACCAGG + Intergenic
920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG + Intronic
923315788 1:232778840-232778862 TACAGGCGTGTGGCACCACCCGG - Intergenic
1065006462 10:21384870-21384892 TACAGGTGTGAGCCTGCACCTGG - Intergenic
1065013178 10:21437781-21437803 TACAGGCGTGAGCCACCACCCGG + Intergenic
1070294202 10:75145218-75145240 TACAGGCGTGAGCCACCACCTGG + Intronic
1070765588 10:79054340-79054362 CACACACGTGTGCATACACGGGG - Intergenic
1072161546 10:92771526-92771548 TACAGGCGTGAGCCATCACCCGG + Intergenic
1074577243 10:114681723-114681745 CCCAGGCTTGTGACCACACCAGG - Intronic
1075026802 10:118991152-118991174 CACAGGTGTGTCGATACACCTGG + Intergenic
1075163621 10:120046274-120046296 TACAGGCGTGAGCCTGCACCTGG + Intergenic
1076158280 10:128220871-128220893 CACTGGCCTGTGCCTACAACAGG + Intergenic
1077145717 11:1043382-1043404 CACAGACGTGGCCCTACAGCCGG + Intergenic
1077243412 11:1523960-1523982 CACAGCCCTGTGCCCACAACAGG + Intergenic
1079036957 11:17028277-17028299 CAGAGGCGTGTCTCTACACTTGG - Intergenic
1080947636 11:36992916-36992938 TACAGGCGTGAGCCACCACCCGG - Intergenic
1081143984 11:39538016-39538038 TACAGGCGTGAGACCACACCTGG + Intergenic
1081508767 11:43746419-43746441 CACTGGCCTGGGCCTACACCAGG + Intronic
1083271758 11:61576348-61576370 CACAGGCTGGTGCCGGCACCTGG + Intronic
1084020891 11:66417312-66417334 CACATGCCTGTGCCCACACCAGG + Intergenic
1084409047 11:68995653-68995675 TACAGGCGTCTGCCACCACCTGG + Intergenic
1090270748 11:125384408-125384430 TACAGGCGTGAGCCACCACCCGG - Intronic
1091563680 12:1632601-1632623 CACAGGCGTATGCTCACTCCTGG + Intronic
1092272126 12:7031489-7031511 CACAGGGTTGTGACAACACCAGG + Intronic
1092278174 12:7078352-7078374 TACAGGCATGTGCCACCACCTGG + Intergenic
1094749661 12:33391210-33391232 TACAGGCGTGAGCCAACGCCTGG + Intronic
1095454344 12:42366500-42366522 TACAGGTGTGAGCCTGCACCTGG + Intronic
1095711985 12:45299709-45299731 TACAGGCGTGCCACTACACCTGG - Intronic
1098913777 12:76236758-76236780 CTCAGGCATGTGGCCACACCTGG + Intergenic
1100466454 12:94849713-94849735 CACAGGCTGCTGCCTGCACCTGG + Intergenic
1101340591 12:103839515-103839537 TACAGGCGTGAGCTCACACCTGG + Intronic
1102041071 12:109801036-109801058 TACAGGCGTGAGCCTGCGCCTGG - Intronic
1102088746 12:110168133-110168155 TACAGGCGTGAGCCTGCGCCTGG + Intronic
1102159641 12:110758080-110758102 TACAGGCGTGAGCCTGCACCTGG - Intergenic
1103140283 12:118542139-118542161 CTCAGTCATGTGCCTACATCTGG + Intergenic
1103645418 12:122388492-122388514 TACAGGCGTGAGCCACCACCCGG + Intronic
1106597408 13:31158273-31158295 TACAGGTGTGAGCCTACGCCTGG - Intronic
1107021314 13:35755368-35755390 CACAGGCATGTTCCTAAACTTGG - Intergenic
1109487608 13:63047896-63047918 CACAGGCTTGTTCCTACTCTAGG - Intergenic
1110454231 13:75672140-75672162 CACAAGAGTGTGCATACAGCCGG - Intronic
1115207953 14:30933136-30933158 CACAGGCGTGTGACCACACCTGG - Intronic
1115211687 14:30972931-30972953 TACAGGCGTGAGCCCGCACCCGG - Intronic
1115251139 14:31349245-31349267 TACAGGCATGTGCCACCACCCGG - Intronic
1116254617 14:42535527-42535549 TACAGGTGTGTGCCAACACCCGG - Intergenic
1116866454 14:50035679-50035701 CAGACGCGTGCCCCTACACCTGG + Intergenic
1117089631 14:52236930-52236952 TACAGGTGTGTGCCCACGCCCGG - Intergenic
1117231556 14:53724581-53724603 TACAGGCATGAGCCTACCCCTGG + Intergenic
1117570576 14:57044964-57044986 TACAGGCGTGAGCCTGCGCCCGG + Intergenic
1119430613 14:74566047-74566069 CACGTGCGTGTGCCTATAGCTGG + Intronic
1121769404 14:96519201-96519223 TACAGGGGTGAGCCCACACCTGG + Intronic
1122370153 14:101225167-101225189 CAGAGGCGTTGGCCTACACAGGG - Intergenic
1122753215 14:103955064-103955086 CACAGGCATGAGCCCACACCCGG + Intronic
1124941357 15:34221472-34221494 TACAGGCATGAGCCCACACCTGG - Intergenic
1125669826 15:41462894-41462916 TATAGGCGTGTGCCACCACCTGG + Intronic
1132488778 16:213040-213062 TACAGGCGTGAGCGCACACCTGG + Intronic
1132549013 16:546724-546746 CACAGACGGGTGCCTTCCCCAGG + Intronic
1132766006 16:1534473-1534495 CACAGTCATGTGCGTCCACCTGG - Exonic
1136489773 16:30599417-30599439 TACAGGTGTGTGCCACCACCTGG + Intergenic
1138454227 16:57112296-57112318 CACAGGCTTGTGGCTCCCCCAGG - Intronic
1138634645 16:58328020-58328042 TAAAGGCGTGTGCCACCACCTGG - Intronic
1139587420 16:67913042-67913064 TACAGGCATGTGCCCACACCTGG - Intronic
1139750075 16:69104569-69104591 TACAGGCGTGAGCCTGCACCCGG + Intergenic
1140051596 16:71486223-71486245 TACAGGCGTGTGCCCACACCTGG - Intronic
1140184215 16:72752244-72752266 TACAGGCGTGAGCCACCACCTGG + Intergenic
1141257149 16:82412972-82412994 CACAGCCATGTGCGTACACATGG + Intergenic
1141981340 16:87552151-87552173 CACAGGAGTCTGGCTACAGCAGG + Intergenic
1142729281 17:1840559-1840581 TACAGGCGTGAGCCACCACCTGG + Intronic
1144466760 17:15503262-15503284 CACAGGCGCGCCACTACACCTGG - Intronic
1144723774 17:17490966-17490988 CACAGGTGTCTCCCTACCCCCGG - Intronic
1146483143 17:33221103-33221125 TCCAGGGGTCTGCCTACACCTGG - Intronic
1146652811 17:34616835-34616857 CACAGGCATGTCCCCACCCCAGG - Intronic
1147737965 17:42653049-42653071 TACAGGCATGTGCCACCACCCGG + Intergenic
1148158385 17:45436328-45436350 CACAGGTGTGTGCCATGACCGGG + Exonic
1148756076 17:49973601-49973623 CCCAGGACTGTGCCTGCACCTGG + Intronic
1150441143 17:65192471-65192493 CACGGGCATGTGCCACCACCTGG - Intronic
1151081043 17:71329098-71329120 CACATGTGTGTGCATACACACGG - Intergenic
1151515660 17:74593546-74593568 TACAGGCGTGTGCCACCACCTGG - Exonic
1151520937 17:74629063-74629085 TACAGGCGTGTGCTACCACCAGG - Intergenic
1153255131 18:3162748-3162770 TACAGGCGTGAGCCCACGCCCGG - Intronic
1154228824 18:12534832-12534854 TACAGGCATGAGCCTGCACCTGG + Intronic
1159108128 18:64026835-64026857 CACTGGCGTGTCCCACCACCTGG + Intergenic
1160911223 19:1474669-1474691 GACAGGCGAGTGCCTGCCCCGGG + Exonic
1160929534 19:1563657-1563679 CACAGGCGTCTCCCTCCAGCCGG - Intronic
1162036040 19:7940090-7940112 CACAGGTGTGTGACTCCACGGGG - Intronic
1162664357 19:12197005-12197027 TACAGGCATGTGCCTCCACACGG + Intergenic
1164508566 19:28879036-28879058 CACAGGCAGGAGCCTGCACCAGG + Intergenic
1165138503 19:33685637-33685659 CACAGGCCTCAGCCTCCACCTGG - Intronic
1165251447 19:34539699-34539721 TGCAGGCATATGCCTACACCTGG + Intergenic
1165275177 19:34744515-34744537 TGCAGATGTGTGCCTACACCTGG - Exonic
1165458232 19:35927509-35927531 CACAGGCGTGAGCCACCACGTGG + Intergenic
1165503410 19:36208340-36208362 CACAGGCATGCCACTACACCTGG + Intronic
1165860185 19:38905321-38905343 CACAGGCGTGTGCCCCCACACGG - Exonic
1166767092 19:45258124-45258146 TACAGGCGTGTGCCAATGCCTGG + Intronic
1168697630 19:58413774-58413796 TACAGGCGTGAGCCACCACCCGG + Intronic
925570279 2:5303172-5303194 TACAGGCATGTGCCACCACCAGG - Intergenic
925979527 2:9165652-9165674 CACAGGCCGCTGGCTACACCAGG - Intergenic
927828627 2:26328592-26328614 CACAGGTGCATGCCCACACCCGG + Intronic
927891513 2:26753265-26753287 CACAGGCGTGTGCCCATGCCTGG + Intergenic
929868428 2:45737572-45737594 CACAGGCGAGAGGATACACCTGG - Intronic
930087432 2:47507733-47507755 TACAGGCGTGAGCCTCCACCTGG + Intronic
931258866 2:60599336-60599358 CACAGGCACCTGCCTGCACCTGG - Intergenic
931803031 2:65777321-65777343 TACAGGCGTGTGCTACCACCTGG + Intergenic
932668313 2:73715670-73715692 TACAGGCATGTGCCACCACCCGG + Intergenic
935547849 2:104419510-104419532 TACAGGCGTGAGCCAACGCCAGG - Intergenic
937122003 2:119446938-119446960 CACAGCTGTGTGCCTACAGGAGG - Intronic
937270251 2:120645355-120645377 TACAGGCTTGAGCCCACACCCGG + Intergenic
938829606 2:135037271-135037293 TACAGGCGTGAGCCATCACCTGG + Intronic
944260246 2:197668550-197668572 CAGAGGCATGTACCTGCACCTGG + Intronic
944852938 2:203738586-203738608 CACAGGCATGTTCCTACCTCAGG + Exonic
945995919 2:216435845-216435867 CAAGGGGGTGTGCCTACATCTGG + Intronic
946210106 2:218140758-218140780 TACAGGCGTGAGCCCACACCTGG - Intergenic
948108562 2:235435367-235435389 CACAGGAAGGTGCCAACACCAGG - Intergenic
1169379245 20:5092573-5092595 TACAGGCATGTGCCACCACCTGG - Intronic
1174410429 20:50331515-50331537 CACAGTCCTGTGGCCACACCCGG + Intergenic
1176122637 20:63461027-63461049 CACAGGCGGGCGCAGACACCTGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1179463710 21:41556565-41556587 CACAGAGCTGTGCCTAAACCAGG + Intergenic
1182147157 22:28003571-28003593 CACAGGCTACTGCCTTCACCAGG + Intronic
1182194328 22:28499035-28499057 CACAGGCGTGTGCCTACACCTGG - Intronic
1182515324 22:30855433-30855455 CACAGGCGTGTGGTTGCCCCAGG + Intronic
1183018224 22:35007251-35007273 CACAGAGGTGGGGCTACACCTGG - Intergenic
1184042109 22:41950420-41950442 TACAGGCGTGAGCCACCACCTGG - Intergenic
1184760870 22:46543399-46543421 TACAGGCGTGAGCCTGCGCCCGG + Intergenic
1185396195 22:50590833-50590855 TACAGGTGTGTGCCACCACCTGG + Intronic
950526526 3:13527443-13527465 TACAGGCGTGAGCCTGCGCCCGG + Intergenic
951339169 3:21463479-21463501 CCCAGGTGTGTGCCTCCACCTGG - Intronic
952142303 3:30493613-30493635 TACAGGCGTGAGCCGCCACCTGG + Intergenic
952309078 3:32170831-32170853 CACAGGTGTGTGCCACCACTGGG - Intergenic
952420234 3:33123768-33123790 TACAAGCATGTGACTACACCTGG + Intronic
953030467 3:39176575-39176597 CACAGGCTAGGCCCTACACCGGG + Intergenic
960315311 3:116168923-116168945 TACAGGCATGTGCCTAGCCCTGG - Intronic
961448006 3:126990093-126990115 CACATGCCTGGTCCTACACCTGG + Intronic
961569188 3:127786004-127786026 CACACAGGTGTGCCTACTCCAGG + Intronic
961826721 3:129603119-129603141 CACTGGCCTGTGCCCACAGCGGG + Intronic
961984952 3:131122372-131122394 ATCAGGAGTGTGCCTACACCTGG - Intronic
965527662 3:169738773-169738795 TACAGGCGTGAGCCACCACCTGG + Intergenic
968192091 3:196675925-196675947 GACAGGCGTGAGCCACCACCTGG + Intronic
969696093 4:8735679-8735701 CACAGAACTGTGCCTACACAGGG + Intergenic
971330669 4:25678654-25678676 CACAGGCGTGAGCCACCACCAGG + Exonic
972624237 4:40780464-40780486 CACAGGTGTGTGCTACCACCTGG - Intronic
974065887 4:57076688-57076710 CACAGGTGTGTCCCCACCCCAGG - Intronic
975659153 4:76671219-76671241 CACAGTCGTGGGAGTACACCTGG - Intronic
982371511 4:154638690-154638712 CACACATGTGTGCCTGCACCAGG - Intronic
983083710 4:163417773-163417795 TACAGGCATGTGACCACACCTGG - Intergenic
983796348 4:171868820-171868842 TACAGGCGTGGGCCCCCACCTGG + Intronic
987671471 5:21015457-21015479 CAAAAGCTTGTACCTACACCCGG - Intergenic
988758207 5:34282768-34282790 TACAGGCGTGAGCCACCACCCGG + Intergenic
990998648 5:61759290-61759312 GACAGGGGTGTGACTACAACAGG - Intergenic
991366624 5:65875138-65875160 CACAGGTGTGCACCCACACCAGG - Intergenic
997118958 5:131154812-131154834 TACAGGCGTGAGCCCACACCTGG + Intergenic
998282534 5:140825563-140825585 TACAGGCATGTGCCCACACCTGG + Intronic
999188799 5:149731475-149731497 CCCAGGCGTGTGCCAGCACCCGG - Intronic
999487572 5:152013861-152013883 TACAGGCGTGAGCCTGCGCCTGG + Intergenic
1000771252 5:165357837-165357859 TACAGGCGTGTGCTACCACCCGG + Intergenic
1001084387 5:168690275-168690297 TGCAGGAGTGTGCCCACACCTGG + Intronic
1001387349 5:171350790-171350812 TACAGGCGTGAGCCACCACCTGG + Intergenic
1002810673 6:625138-625160 CACAGGCCTGTGTCTTCTCCTGG - Intronic
1006697839 6:35946509-35946531 TACAGGCGTGAGGCCACACCTGG + Intronic
1006891766 6:37434749-37434771 TACAGGCATGTGCCACCACCCGG + Intronic
1007574119 6:42913900-42913922 CACAGGCGTGCGCCACCACCTGG - Intergenic
1010872947 6:81064259-81064281 CACAGTCATGTGCCGCCACCAGG + Intergenic
1013061206 6:106635728-106635750 TACAGGCGTGTGCCACCACCTGG - Intronic
1013298220 6:108779184-108779206 TACAGGCGTGAGCCACCACCTGG - Intergenic
1017048056 6:150365489-150365511 CATAGGCCTTTGCCCACACCTGG + Intergenic
1017723356 6:157259622-157259644 CACTGGCGTGTGCACACACATGG + Intergenic
1018273505 6:162105540-162105562 TACAGGCGTGTGCCACCACCTGG + Intronic
1019760048 7:2804400-2804422 CACACGCGTGTACATACACCGGG + Intronic
1020846719 7:13294415-13294437 CACAGTCTTGTGCCTTCCCCAGG - Intergenic
1023285188 7:38611991-38612013 CAGAGGCGTGTCCTTAGACCTGG - Intronic
1023797705 7:43807640-43807662 TACAGGCGCGTGCCTAATCCTGG + Intergenic
1025296406 7:57778395-57778417 TACAGGCGTGAGCCAGCACCTGG - Intergenic
1029479560 7:100804274-100804296 TACAGGCGTGAGCCACCACCTGG + Intronic
1029524654 7:101087564-101087586 CACAGGCCCGGGCCTTCACCAGG - Exonic
1032131719 7:129234516-129234538 TACAGGCGCGAGCCCACACCTGG + Intronic
1032872395 7:136000361-136000383 CACTGGCGTCTGCCTACCCCAGG - Intergenic
1032872404 7:136000439-136000461 CACTGGCGTCTGCCTACCCCAGG - Intergenic
1033200397 7:139363179-139363201 CACAGGCGGTTGCCACCACCAGG - Intronic
1034631716 7:152536174-152536196 TACAGGCGTGAGCCACCACCCGG - Intergenic
1034673761 7:152876792-152876814 CACAGGCATGTGCCTGGGCCGGG + Intergenic
1036475953 8:9093450-9093472 CACAGGTATATGCATACACCTGG + Intronic
1036485443 8:9174848-9174870 TACAGGCGTGAGCCTCAACCCGG + Intergenic
1036958104 8:13213240-13213262 CACAGACGTGTACATATACCTGG + Intronic
1037056823 8:14452822-14452844 TACAGGCGTGAGTCCACACCCGG - Intronic
1038013207 8:23491205-23491227 TACAGGCGAGTGCCAACGCCCGG + Intergenic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1039016657 8:33156989-33157011 CACAGGCATGTGCCACCACCTGG - Intergenic
1039446411 8:37636710-37636732 CACAGGTGTGTGCCACCACGTGG - Intergenic
1041719295 8:60961737-60961759 GACATGTGTGTGCCCACACCTGG + Intergenic
1045461523 8:102429732-102429754 CACAGGTGTGAGCCAACACCCGG + Intergenic
1046627383 8:116589621-116589643 TACAGGCGTGTGCTAACTCCTGG - Intergenic
1047961588 8:130015821-130015843 CACAGGCGGGTGGCTACCCCAGG + Intronic
1049095609 8:140546469-140546491 CACAGGCCTGTGCACACAGCAGG + Intronic
1049642982 8:143723716-143723738 CCCAGGAGTGTGCCTGCACAGGG + Intergenic
1052828596 9:33196343-33196365 TACAGGCGTGAGCCAACACCTGG - Intergenic
1052905314 9:33828527-33828549 TACAGGCATGTGCCACCACCGGG + Intronic
1056129458 9:83569418-83569440 CACAGGCGTCTGCCTGGCCCAGG + Intergenic
1056767666 9:89454871-89454893 CCCAGGCGTGTGCCTAGCACGGG + Intronic
1058050719 9:100403509-100403531 CACAGGTGTGTGCCCATGCCCGG + Intergenic
1058587865 9:106530007-106530029 TACAGGTGTGTGCCACCACCAGG - Intergenic
1061328412 9:129877929-129877951 TACAGGTGTGTGCCACCACCTGG - Intronic
1186009576 X:5114662-5114684 CGCAGGAGTGTGCCTGGACCTGG + Intergenic
1189997643 X:46654245-46654267 CAGATGCGTGTGACCACACCCGG - Intronic
1190315935 X:49151020-49151042 TACAGGCGTGTGCCACCGCCCGG + Intergenic
1190356038 X:49605766-49605788 CACAGGCGCGTGCCACCACAAGG - Intronic
1192926188 X:75757967-75757989 CACAGGCATGTGCAGAGACCAGG + Intergenic
1197945163 X:131830816-131830838 CACGGGCCAGTTCCTACACCTGG + Intergenic
1200410264 Y:2853971-2853993 TACAGGCATGTGCCACCACCCGG + Intronic
1201912236 Y:19144559-19144581 TACAGGCATGTCACTACACCTGG - Intergenic