ID: 1182202204

View in Genome Browser
Species Human (GRCh38)
Location 22:28585374-28585396
Sequence TATCATAGGGAGCACCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182202199_1182202204 24 Left 1182202199 22:28585327-28585349 CCATCTGGGGGTGATGGGAGACA 0: 430
1: 594
2: 489
3: 304
4: 374
Right 1182202204 22:28585374-28585396 TATCATAGGGAGCACCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1182202198_1182202204 25 Left 1182202198 22:28585326-28585348 CCCATCTGGGGGTGATGGGAGAC 0: 425
1: 610
2: 490
3: 297
4: 337
Right 1182202204 22:28585374-28585396 TATCATAGGGAGCACCAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182202204 Original CRISPR TATCATAGGGAGCACCAACC TGG Intronic
913114091 1:115680846-115680868 AATCAAAGGGAGCCCCATCCTGG + Intronic
923423630 1:233845756-233845778 TATCCTCAGGAGAACCAACCTGG + Intergenic
1071109976 10:82144418-82144440 TATCATAGGCAACACCACCCAGG + Intronic
1074441021 10:113477576-113477598 TCTCATAGGAACCACCAGCCTGG + Intergenic
1079755545 11:24255436-24255458 TATAACATGGAGCACCAACATGG + Intergenic
1086539927 11:87896766-87896788 TATCATAGGTAAGACCAGCCAGG - Intergenic
1099666869 12:85642231-85642253 TATCATAGGGACAGCCAAGCAGG - Intergenic
1112648327 13:101361208-101361230 TATCATGGGGAAAACCAAGCTGG + Intronic
1118702040 14:68442938-68442960 TTTCAGGGGGAGCAACAACCTGG - Intronic
1124911316 15:33923854-33923876 TCTCATAAGGAGTAGCAACCTGG - Intronic
1127808331 15:62541459-62541481 TGTCCTTGGGAGCACCATCCAGG - Intronic
1134508652 16:14828258-14828280 TATCATAGGGTGTACAAACATGG - Intronic
1134696360 16:16227155-16227177 TATCATAGGGTGTACAAACATGG - Intergenic
1134975467 16:18567542-18567564 TATCATAGGGTGTACAAACATGG + Intergenic
1140733028 16:77873570-77873592 TATCATAAGCAGCACAAACATGG + Intronic
1143778954 17:9219415-9219437 GATCATAGGGAGCAGGAAGCAGG + Intronic
1148510628 17:48166388-48166410 TATCATCAGTAGCACCAACTTGG - Intronic
1153908245 18:9682976-9682998 TTTTATAGGCAGGACCAACCAGG + Intergenic
1163217479 19:15891742-15891764 AATCATAGGGAGGAACATCCAGG + Intronic
1167024733 19:46907046-46907068 TATCATACTGGGCTCCAACCTGG + Intergenic
1168063665 19:53907853-53907875 TATCACAGAGGGCACCAACGTGG + Intergenic
1168500564 19:56889456-56889478 TATCATATTGAGGGCCAACCAGG - Intergenic
1168514826 19:57002514-57002536 TCCCCTAGGGAGCACCTACCTGG + Intergenic
929127560 2:38535435-38535457 TAGGAAAGGGAGCACCTACCAGG + Intergenic
931833008 2:66072056-66072078 CAGCATAGGAAACACCAACCTGG + Intergenic
933018025 2:77155663-77155685 TATCAAAGAGAGCACCAAAGTGG + Intronic
933751513 2:85604965-85604987 TGTCATACGGAGCTCCATCCTGG - Intronic
943670913 2:190659472-190659494 TACCAGAGGGATCACCAACATGG + Exonic
944285859 2:197949095-197949117 TATCATACACAGCACCAAGCTGG - Intronic
945160796 2:206888480-206888502 TATAACAGGAAGCCCCAACCTGG + Intergenic
947451523 2:230213010-230213032 ATTCATAGGAAGCACCAACTGGG + Exonic
1182202204 22:28585374-28585396 TATCATAGGGAGCACCAACCTGG + Intronic
1183517663 22:38276482-38276504 TCCCACAGGGAGCACCAACTAGG - Intergenic
1184416544 22:44355216-44355238 TTACATAGGGAGGACCAGCCCGG + Intergenic
951089470 3:18555624-18555646 TATCATAGTTACCACCACCCTGG - Intergenic
953872353 3:46638250-46638272 TCTAATAGGGAACACCACCCAGG + Intergenic
964597450 3:158451528-158451550 TAACATAGAGAGCAAAAACCAGG - Intronic
969475834 4:7422040-7422062 TAGCAAAGGGGGCACCGACCAGG - Intronic
970253549 4:14142623-14142645 TATCATAGGTAGCAACAAGCTGG - Intergenic
971561927 4:28089320-28089342 TTTCATAGGGAACACCAAACTGG - Intergenic
974402602 4:61425619-61425641 AACCATGGGGAGCACCACCCTGG - Intronic
975029181 4:69592731-69592753 TATCATAGGGAAGACTAAACTGG + Intronic
980349902 4:131670827-131670849 TGCCATAGGCAGCACCAACAGGG - Intergenic
985167404 4:187111581-187111603 CAACATACGGAGCACCAGCCAGG - Intergenic
992991746 5:82290838-82290860 TATTTTACTGAGCACCAACCTGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001215090 5:169848565-169848587 TCCCATAGGGAGAATCAACCAGG + Intronic
1002595457 5:180318931-180318953 TATCATAGAGCACACCAACCGGG - Exonic
1010114974 6:72294066-72294088 TATCATAAAAAACACCAACCAGG - Intronic
1012044186 6:94248537-94248559 TGTAATAGGTAGCACCAACAAGG - Intergenic
1013845912 6:114451359-114451381 TATCATATGGAGGAATAACCTGG - Intergenic
1020369174 7:7414120-7414142 GATCAGAGGGTGCACCACCCAGG - Intronic
1034835380 7:154346693-154346715 TATCACTGAGAGCACCAAGCAGG + Intronic
1040378406 8:46848880-46848902 TATCACTGGGACCATCAACCAGG + Intergenic
1042337839 8:67647140-67647162 TATCAGAGGGAGAACCAACAGGG + Intronic
1051028007 9:12637134-12637156 TATCACAGAGAGCACCAAAGTGG - Intergenic
1059949175 9:119444095-119444117 AAACACAGGGAGCACCAACATGG - Intergenic
1202151820 Y:21850584-21850606 TATTATAGGGAGCACCATGTTGG + Intergenic
1202245942 Y:22820325-22820347 TATCACTGGGACCACCACCCTGG + Intergenic
1202252994 Y:22892263-22892285 TATCATTGGGACCATCACCCAGG - Intergenic
1202398930 Y:24454073-24454095 TATCACTGGGACCACCACCCTGG + Intergenic
1202405984 Y:24526012-24526034 TATCATTGGGACCATCACCCAGG - Intergenic
1202464796 Y:25144069-25144091 TATCATTGGGACCATCACCCAGG + Intergenic
1202471850 Y:25216013-25216035 TATCACTGGGACCACCACCCTGG - Intergenic