ID: 1182208591

View in Genome Browser
Species Human (GRCh38)
Location 22:28653838-28653860
Sequence TCTCTTATGTTTACAGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182208591 Original CRISPR TCTCTTATGTTTACAGTCTG GGG (reversed) Intronic
900296094 1:1950973-1950995 TAACTTTTGTTTACAGTGTGAGG + Intronic
903853828 1:26323958-26323980 GCTCTTGTTTTTACAGACTGGGG + Intronic
904821120 1:33245156-33245178 GCTCTGATGTTTAAAGTGTGAGG + Intergenic
910132182 1:83921277-83921299 TCTCTGCTGTTCCCAGTCTGAGG + Exonic
910383457 1:86656899-86656921 TCTCTGATGTTGAGAGTCTGAGG - Intergenic
911420747 1:97637461-97637483 TCTCTTATGTTCAGTGTCTGGGG - Intronic
911933220 1:103931799-103931821 TTTCTTGTGTTTATATTCTGTGG + Intergenic
911974694 1:104477217-104477239 TGTCTCATGTATACAGTCTTAGG - Intergenic
915872572 1:159576688-159576710 TGTTCTATGTTTACAGTTTGAGG - Intergenic
916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG + Intergenic
916907539 1:169303898-169303920 GCTCTTAAGTTTAAAGCCTGTGG - Intronic
917069957 1:171139810-171139832 TCTCTTATTTTAAAAGTCTTAGG - Intronic
917112055 1:171558401-171558423 TCTCATTTGATTACAGTTTGTGG + Intronic
917211048 1:172632284-172632306 TCTTTTAGTTTTACTGTCTGTGG - Intergenic
917348339 1:174051927-174051949 TCTCTTAAGCTTAAAATCTGTGG + Intergenic
919535512 1:198782814-198782836 TCTCTTATATTTACAGTTATGGG - Intergenic
919612804 1:199767002-199767024 TCTCATATGGGTACAGTTTGTGG - Intergenic
921764265 1:218952180-218952202 TCTATTAAGGTTACATTCTGAGG - Intergenic
922138251 1:222854105-222854127 TCCCCTATATTTATAGTCTGTGG - Intergenic
922406806 1:225322849-225322871 CATCTCATATTTACAGTCTGTGG + Intronic
922951872 1:229564828-229564850 TTTCATATGTTAAGAGTCTGAGG + Intergenic
923333197 1:232944848-232944870 TCTATTATATTCACAGTCTTGGG + Intergenic
924096195 1:240553762-240553784 ACTCTTATCTTTACAGACTTTGG + Intronic
1067839776 10:49666341-49666363 TCTCCTATGATCACAGTCTCTGG - Intergenic
1069411361 10:68156906-68156928 TTTTTTATGCTTACAGTCTTTGG + Intronic
1070553696 10:77512163-77512185 TCTCTTTTGTTTAAATTCTCTGG + Intronic
1070606182 10:77899996-77900018 TCTCTTCCTTTTAAAGTCTGGGG - Intronic
1071743540 10:88389337-88389359 TTTCTTTTTTTGACAGTCTGTGG + Intronic
1072786089 10:98283605-98283627 TCTCTTATTTTTAATGTCTTAGG + Intergenic
1073834771 10:107428702-107428724 TTTCTCATGTTTAGATTCTGTGG + Intergenic
1074696249 10:116052238-116052260 CCTCTTCTGTCTTCAGTCTGGGG - Intergenic
1076088838 10:127660875-127660897 TCTCAAATGTTCACAGCCTGTGG + Intergenic
1077120241 11:904070-904092 TCTCTTCTGTCCACACTCTGTGG + Intronic
1077928880 11:6709743-6709765 TCTAATATGTTTACAGAGTGAGG + Intergenic
1078506899 11:11958549-11958571 TCTCTTATCTTTTGAGGCTGAGG + Intronic
1079258940 11:18859039-18859061 TCTATGATTATTACAGTCTGAGG - Intergenic
1080435800 11:32242297-32242319 TCTGTATTGTTTCCAGTCTGGGG - Intergenic
1080588670 11:33702723-33702745 TCTCTTAGGTTCAGAGCCTGGGG - Intronic
1081047943 11:38298917-38298939 TCTCAGTTGTTTACAGTCTTTGG + Intergenic
1081592716 11:44436041-44436063 TCTCTCATGTTAACAGTCCAGGG + Intergenic
1086309299 11:85518808-85518830 CCTCTGTTGTTTACAGTCTAGGG + Intronic
1086463739 11:87032538-87032560 TCTTTTACTTTTACATTCTGTGG + Intergenic
1088175798 11:107051549-107051571 CCTCTGCTGTTTGCAGTCTGGGG + Intergenic
1091257071 11:134198013-134198035 TATTTTTGGTTTACAGTCTGTGG - Intronic
1093331019 12:17839368-17839390 TCTTTTTTGTTTACATTGTGTGG + Intergenic
1095913432 12:47452020-47452042 TCTCTTATGTTTATTGCTTGTGG - Intergenic
1097827551 12:64189688-64189710 TTTCTTATGCTTACTGTCTGTGG - Intronic
1097965685 12:65578096-65578118 TCTTATATCTTTATAGTCTGAGG - Intergenic
1098315376 12:69186875-69186897 TCTTTTCTGTTTACACTCTTGGG - Intergenic
1098610981 12:72457986-72458008 TCTCCTATTTTCAAAGTCTGAGG - Intronic
1099628115 12:85102681-85102703 TCTCTTATTTTTATATTCTCAGG - Intronic
1100255621 12:92880101-92880123 TGTTTTATGTTTACAGCCTAGGG - Intronic
1100360149 12:93870420-93870442 TCCCTTAAGTTCCCAGTCTGGGG + Intronic
1105767441 13:23575683-23575705 TCTCTTTGGTTTACAGTTTCTGG - Intronic
1107831526 13:44377853-44377875 TCTCCTATGTTTAAGTTCTGTGG + Intronic
1108833741 13:54513993-54514015 TTTCTTATTTTTACTTTCTGTGG - Intergenic
1109992079 13:70071895-70071917 TCTCTTCTGTTTCCAGTTTTGGG - Intronic
1110200300 13:72841927-72841949 TCTGTTATGTTGACAGTTTAAGG + Intronic
1111229188 13:85318797-85318819 TGTCTTAAGTTTACATTCAGAGG - Intergenic
1112902958 13:104381123-104381145 TCTTGAATGTTTGCAGTCTGGGG + Intergenic
1115092257 14:29591851-29591873 TCCCTCATGTTTCCAGTGTGTGG - Intronic
1116184820 14:41585414-41585436 TCTCTTATAGTTACAGTAAGTGG - Intergenic
1117694410 14:58344679-58344701 TATTTTATCTTTACAGCCTGAGG + Exonic
1118585587 14:67349358-67349380 TTGCTTATGTTTTCAGTCAGAGG + Intronic
1120254077 14:82096078-82096100 TCACTTACGTTCACAGTCTTTGG - Intergenic
1120692978 14:87614011-87614033 TTTCTTTTGTTCACACTCTGAGG - Intergenic
1122298599 14:100719275-100719297 TTTCTTCTGTTTTCAGTCTGTGG + Intergenic
1125208763 15:37186340-37186362 TCTATGATTTTTATAGTCTGAGG - Intergenic
1125433861 15:39625509-39625531 ACTCTTATGTTTTCATTTTGTGG + Intronic
1126103257 15:45132262-45132284 TCTTTTATTCTTACAGTTTGGGG + Intronic
1126389441 15:48130820-48130842 TCTTTTTTGTTTACACTTTGTGG - Intronic
1126424340 15:48510417-48510439 TCTATTTTGTTTACAGACTTCGG - Intronic
1126563129 15:50066778-50066800 TTTCTTTTTTTTACAGTTTGTGG + Intronic
1126614502 15:50563176-50563198 ACTCATTTGTTCACAGTCTGTGG + Intronic
1127506816 15:59605907-59605929 TTACTTATGTTTATAGTGTGGGG + Intronic
1130047512 15:80457203-80457225 TGTCTTATGTTTACACTGAGAGG + Intronic
1130772025 15:86933991-86934013 TCTCTAATGTTCTCCGTCTGTGG + Intronic
1131919613 15:97309883-97309905 TCTCTGATATTTACTGTGTGGGG + Intergenic
1134814083 16:17191742-17191764 TCTCTCATGTTCTCAGCCTGCGG + Intronic
1139133361 16:64172723-64172745 TCTCTGATCTGTACAGTCTCAGG - Intergenic
1145199708 17:20932372-20932394 TCTTTTCTGTATACAGACTGTGG - Intergenic
1148879625 17:50715891-50715913 TCTCTTTTTTCTAAAGTCTGAGG - Intergenic
1150047377 17:61927055-61927077 TCACTTTTGTTTACATTTTGTGG - Intronic
1150337047 17:64338004-64338026 TCTCTTAGGTTTTCTGACTGGGG - Intronic
1153146623 18:2039837-2039859 TCTCTTCAGTTCACAGTCTTTGG - Intergenic
1153369813 18:4302255-4302277 TCTAGTAGTTTTACAGTCTGGGG + Intronic
1154169855 18:12043549-12043571 CCTCTTATGTTCACTGCCTGGGG - Intergenic
1154285362 18:13050953-13050975 TGTAGTATGTTTACAGTCTTTGG + Intronic
1155196687 18:23481730-23481752 TCAATTATGTTTCCAGACTGTGG + Exonic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1155608818 18:27639294-27639316 TCAGTTATGTTTACAGTTTTTGG + Intergenic
1159541736 18:69786545-69786567 TCTCTTGTGTTTAAGTTCTGAGG - Intronic
1159694242 18:71534672-71534694 TATTTTTTGTTTACAGTCAGGGG + Intergenic
1164585232 19:29465288-29465310 TCTTTTTTTTTTACAGTCAGTGG - Intergenic
926983341 2:18594922-18594944 TCTGTTAGGTTAAAAGTCTGGGG + Intergenic
928031688 2:27785154-27785176 TTGCTTATGTTTTCCGTCTGGGG - Intronic
928431049 2:31218721-31218743 TCTCTGCTGTTTACTGGCTGCGG - Intronic
929409616 2:41683332-41683354 ACTCATATGTTTACAGTATTGGG + Intergenic
929508419 2:42547047-42547069 TCTCTGATGACTACAGTCTATGG + Intronic
929683506 2:44014663-44014685 TCTCTTATGTTTGCTCTCTCAGG + Intergenic
931930424 2:67127604-67127626 TCTGTGATGTTTACTTTCTGTGG + Intergenic
934911361 2:98257967-98257989 TCTAATATGTTTACAGTTTTAGG + Intronic
935475312 2:103513980-103514002 CCTCTTTTGTTTCCAGTCTTGGG - Intergenic
936275250 2:111090574-111090596 GCTCTCCTGTTGACAGTCTGTGG - Intronic
936843016 2:116796540-116796562 TTTGCTATGTTTACAGTCTTAGG + Intergenic
937058287 2:118959016-118959038 TCTATAATGTTTACAGTTTCAGG - Intronic
938045960 2:128120565-128120587 ACTCTTATCTTTAAAATCTGAGG - Intronic
939728259 2:145750617-145750639 TCTCTTATTTTTACTGGCAGAGG - Intergenic
940578907 2:155550764-155550786 TCTCTCAAGTTCAAAGTCTGGGG + Intergenic
941171288 2:162140533-162140555 TCTGTTATGTTTGTAGTATGGGG - Intergenic
943138888 2:183952523-183952545 TCACTCATGTTCACAGTCTATGG + Intergenic
945250687 2:207764188-207764210 TCTCTTATGTGTACAGCTTCAGG - Exonic
945453753 2:210024869-210024891 TCTCTTATGTTGTCAGCCTCAGG - Intronic
1170761777 20:19257441-19257463 TCTCATATCTTTATGGTCTGGGG + Intronic
1171394581 20:24823772-24823794 CCTATTAGGTTTACAGTCTTGGG + Intergenic
1172413947 20:34748971-34748993 TCTCTTAATTTTACAGTGTCGGG - Intronic
1172680797 20:36713022-36713044 TCTCTGATGTTCACAGTATATGG + Intronic
1173117865 20:40263247-40263269 TATCTCATGTTTAAAGTCCGGGG + Intergenic
1174425272 20:50427767-50427789 TCTCTTTTGTCTTCAGTCAGGGG - Intergenic
1174935557 20:54864347-54864369 TCTGTTATATGTACATTCTGTGG + Intergenic
1175740315 20:61415402-61415424 TTTTTTATGTGTACAGTCAGCGG + Intronic
1177439441 21:21101239-21101261 TCTATTATGTTTACAGCTTATGG - Intronic
1178228304 21:30750945-30750967 TTTCTTATGTGTATAGTGTGAGG + Intergenic
1178469474 21:32879324-32879346 TCTCTTGTGTTTTCAGTGTGGGG - Intergenic
1182208591 22:28653838-28653860 TCTCTTATGTTTACAGTCTGGGG - Intronic
1182552878 22:31110477-31110499 TGTCTTAATTTTACGGTCTGGGG + Intronic
1183621327 22:38974568-38974590 TCTCTTATCTTTACTATTTGAGG - Intronic
949150718 3:763744-763766 TCTCTAATGTTTATCATCTGTGG + Intergenic
949621581 3:5818711-5818733 TCACTTGTGTTTTCAGCCTGGGG + Intergenic
949653577 3:6190346-6190368 TCTGATATTTTTACAGTTTGTGG + Intergenic
950333618 3:12176606-12176628 TCTGAAATGTTTCCAGTCTGAGG + Intronic
952975000 3:38686291-38686313 TCTCTTATATTTTGAGACTGGGG + Intergenic
953095683 3:39773405-39773427 TCTCTTATGTTTCTATTTTGGGG - Intergenic
953658330 3:44871668-44871690 TTTCTCATGTTTCCTGTCTGGGG - Intronic
954517551 3:51192193-51192215 TCTATTATGTTTATAGTTTCAGG + Intronic
956942466 3:74179477-74179499 TCTATAATGATTAGAGTCTGAGG - Intergenic
957708704 3:83824400-83824422 TTTCTTATGTTTTCAGACTGAGG - Intergenic
958592939 3:96182784-96182806 ACAACTATGTTTACAGTCTGTGG + Intergenic
958729665 3:97948436-97948458 TCTCTGATGTTAGCATTCTGTGG - Intronic
962564544 3:136644285-136644307 TCCCCTAATTTTACAGTCTGTGG - Intronic
962594861 3:136931520-136931542 TCTCTTCTGTTTACTTTTTGGGG + Intronic
965208437 3:165751811-165751833 TCTCTTAGCTTTGCTGTCTGCGG - Intergenic
965218345 3:165894014-165894036 TCACTTATGTTTTCAGACTATGG + Intergenic
967689128 3:192453508-192453530 TCTAATATCTTTACATTCTGAGG + Intronic
967700085 3:192582249-192582271 TTTTTTATGTTAACAGTCTATGG - Intronic
970371942 4:15416839-15416861 CCTCTTATGTTAAAAGTCAGAGG + Intronic
970573066 4:17401525-17401547 TCTTTTATGTTTCCTGTCTGTGG - Intergenic
970960852 4:21869626-21869648 TCTCTTATGTTTTCACTTTTAGG + Intronic
972525116 4:39902399-39902421 TCTCTTCTGTTTCCAGGTTGTGG + Exonic
975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG + Intergenic
976570405 4:86601426-86601448 TCCCCTATGTTCACAGTTTGTGG + Intronic
980691589 4:136302326-136302348 TGTCTTATGATTAAAGTCAGTGG - Intergenic
984083146 4:175274893-175274915 TCTCTAATGTGTGCAGCCTGGGG + Intergenic
984771338 4:183439063-183439085 TCTCTTGTCTCTACAGTCTCAGG - Intergenic
985472907 5:57017-57039 TCTGTTCTGCTTACAGTCTAGGG - Intergenic
986057636 5:4154335-4154357 TTACTTATGCTCACAGTCTGAGG - Intergenic
986626447 5:9727559-9727581 TCTCTTCTCTCTCCAGTCTGGGG - Intergenic
986976010 5:13394834-13394856 TGTGATATGTTTACAGTTTGGGG - Intergenic
987102615 5:14605317-14605339 CCTCTGCTGTGTACAGTCTGGGG - Intronic
987265795 5:16253653-16253675 TCTCTGAAGTTTACTATCTGGGG - Intergenic
988338559 5:29938490-29938512 TGTATTATTTCTACAGTCTGGGG + Intergenic
989019106 5:36979675-36979697 TCTCTTTAGTTTGCAGTATGAGG + Intronic
990271290 5:54142688-54142710 GCTCTTATGTTAATAGTGTGGGG + Intronic
991095429 5:62734861-62734883 TCTCTTATGTTTAGTGACTGGGG - Intergenic
991662042 5:68960362-68960384 TTTCTGATTTTTAAAGTCTGAGG - Intergenic
992202348 5:74396926-74396948 TCTCTGATGTTTACAGAATATGG + Intergenic
992564493 5:77984651-77984673 TCTGGTTTGTTTACACTCTGCGG + Intergenic
993295422 5:86132816-86132838 TCTAGTATGTATATAGTCTGTGG + Intergenic
995669592 5:114586768-114586790 TTTCTTTTGTCTATAGTCTGTGG - Intergenic
996130317 5:119773608-119773630 ACTCTTAGGTATACAGTTTGTGG + Intergenic
999960554 5:156751495-156751517 TCTTTTATATTTACCATCTGTGG - Intronic
1000147842 5:158470588-158470610 TTTCTGTTGTTTACAGTTTGGGG + Intergenic
1000625493 5:163533618-163533640 TCTTTTCTGTTTAAAGACTGGGG + Intergenic
1004077469 6:12357726-12357748 TTTCTAATGTTTCCAGTCAGTGG - Intergenic
1004444534 6:15685962-15685984 TTTTTTTTGTTTACAGTCTGTGG + Intergenic
1004478604 6:15997954-15997976 TGTCTTAGGGTTACAGTCTTGGG + Intergenic
1004638706 6:17493447-17493469 TCCATTATGGGTACAGTCTGTGG - Intronic
1005110733 6:22279502-22279524 TGTCTTATGTTAAAAGTCTCTGG + Intergenic
1006614510 6:35317409-35317431 TCCATTAAGTTTACATTCTGTGG - Intronic
1007397062 6:41583959-41583981 TCTCTTATGTTTTATGTTTGAGG + Intronic
1008352171 6:50504747-50504769 TCTAGTATTTTTACAGTTTGGGG - Intergenic
1008757470 6:54814464-54814486 TCACTCATGTTTATAGACTGTGG + Intergenic
1009268186 6:61583385-61583407 TCTAGGATGTTTACAGTTTGGGG + Intergenic
1009475386 6:64084623-64084645 TCTTTTATGATTACATTTTGGGG + Intronic
1011576602 6:88807445-88807467 TCTCTTCTGTGTCCAGTCTGTGG - Intronic
1015692361 6:135939316-135939338 TCTCTTATTTTGACTGGCTGAGG + Intronic
1016201043 6:141408856-141408878 TTTCTTATGTTTCAAGACTGGGG - Intergenic
1016531517 6:145063379-145063401 TTACTTATGTATACAGTCTTTGG - Intergenic
1017626398 6:156353193-156353215 CCTATTATGTATAAAGTCTGGGG - Intergenic
1017944787 6:159086791-159086813 TCTAGTATTTTTACAGTTTGGGG - Intergenic
1021257183 7:18406778-18406800 TCTCTTATGATTAGAGTTTTAGG + Intronic
1021513131 7:21455763-21455785 TCTCTTTTGTCTGCAGTCTTGGG + Intronic
1023603115 7:41900150-41900172 TCTCTTTTATTTTCTGTCTGAGG + Intergenic
1027519109 7:79181487-79181509 TCTCTGCTGTGTACAGTCTAGGG - Intronic
1028408625 7:90503708-90503730 TCTCTTATGGGTGCAGTTTGTGG + Intronic
1029933813 7:104401184-104401206 TCTATTGTGTTTAAAGTTTGTGG - Intronic
1029933894 7:104402505-104402527 TCTATTGTGTTTAAAGTTTGTGG + Intronic
1030268378 7:107644279-107644301 TCTCTTAAGGTTACAGTAAGGGG + Intergenic
1030786589 7:113670780-113670802 TCTCTGCTGTATGCAGTCTGGGG + Intergenic
1034391482 7:150791013-150791035 TCTCTTAAGTCTACAGGCCGAGG + Intergenic
1034954586 7:155326761-155326783 TTTCTTATGCTTACAGTGGGGGG + Intergenic
1035950771 8:4018280-4018302 TCTTTTGGGATTACAGTCTGTGG + Intronic
1036586338 8:10127349-10127371 TTTCTTCTTTTTACAGTGTGTGG + Intronic
1037161139 8:15773874-15773896 ACTTTTATGTATACAGTGTGAGG - Intergenic
1037594460 8:20343296-20343318 TCTCTTAGCTCTGCAGTCTGTGG + Intergenic
1038886621 8:31669623-31669645 TCTCCCATGTGGACAGTCTGTGG + Intronic
1039730494 8:40270718-40270740 TTTGTTATATTTTCAGTCTGTGG - Intergenic
1040996113 8:53404349-53404371 TCTTTTCTGTTAAAAGTCTGTGG - Intergenic
1041361755 8:57062273-57062295 TCTCTGGTGCTTACAGTCTTTGG + Intergenic
1042981160 8:74530434-74530456 TCTAGTAGTTTTACAGTCTGAGG - Intergenic
1044277950 8:90323732-90323754 TCTGTTTTCTTTACAGCCTGTGG + Intergenic
1045629229 8:104097390-104097412 TCACTCATGTGCACAGTCTGTGG + Intronic
1046026966 8:108736193-108736215 TTTCTTATGTTAACAGTCAATGG - Intronic
1046478292 8:114778988-114779010 TCTTTTATGAGTACAGTTTGAGG - Intergenic
1047482768 8:125300638-125300660 GCACTGAAGTTTACAGTCTGTGG + Intronic
1047903036 8:129444359-129444381 ATTTTTATGTTTACAATCTGGGG - Intergenic
1050004204 9:1112101-1112123 TCTCTTATGGTTTCTGTTTGCGG + Intergenic
1052310419 9:27061452-27061474 TCTCTTTTGTTTAGAGACAGGGG + Intronic
1054868728 9:70028990-70029012 TCACTTATCTTTAAAATCTGGGG + Intergenic
1055231835 9:74075631-74075653 TCTATGATGTTTACAGTTTTAGG + Intergenic
1056986647 9:91369740-91369762 TCTCTGATTGTTACAGTTTGAGG - Intergenic
1058163819 9:101597620-101597642 ACTCTTGTGTTTACAAACTGTGG + Intronic
1058483796 9:105423083-105423105 ACTCTTATGTTAACAGTGTGAGG + Intronic
1061476558 9:130871343-130871365 CCTCTCATCTTTTCAGTCTGGGG - Intronic
1188117164 X:26258752-26258774 TTTGTTTTGTTTACAGTTTGGGG - Intergenic
1189910092 X:45802016-45802038 ACTATTATCTCTACAGTCTGAGG + Intergenic
1191649923 X:63525679-63525701 TCTCTTTTGAGTACATTCTGTGG - Intergenic
1196558120 X:117115466-117115488 GCTCTTATCTTTACAGTCATGGG + Intergenic
1199234540 X:145475637-145475659 TGTCTTTTGTTTAGAGTCTCTGG - Intergenic
1199479505 X:148282661-148282683 ACTTCAATGTTTACAGTCTGTGG + Intergenic
1200032636 X:153308801-153308823 TCTCCTAAGTTTGCATTCTGTGG - Intergenic
1201605508 Y:15779899-15779921 CCTCTTCTCTTGACAGTCTGTGG + Intergenic