ID: 1182211925

View in Genome Browser
Species Human (GRCh38)
Location 22:28684051-28684073
Sequence AAACATGAACAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182211925_1182211929 5 Left 1182211925 22:28684051-28684073 CCCAGCTCCATTTGTTCATGTTT No data
Right 1182211929 22:28684079-28684101 TCCTACACCCACCTCTAGCTGGG No data
1182211925_1182211933 8 Left 1182211925 22:28684051-28684073 CCCAGCTCCATTTGTTCATGTTT No data
Right 1182211933 22:28684082-28684104 TACACCCACCTCTAGCTGGGGGG No data
1182211925_1182211932 7 Left 1182211925 22:28684051-28684073 CCCAGCTCCATTTGTTCATGTTT No data
Right 1182211932 22:28684081-28684103 CTACACCCACCTCTAGCTGGGGG No data
1182211925_1182211936 15 Left 1182211925 22:28684051-28684073 CCCAGCTCCATTTGTTCATGTTT No data
Right 1182211936 22:28684089-28684111 ACCTCTAGCTGGGGGGCCAGTGG No data
1182211925_1182211938 16 Left 1182211925 22:28684051-28684073 CCCAGCTCCATTTGTTCATGTTT No data
Right 1182211938 22:28684090-28684112 CCTCTAGCTGGGGGGCCAGTGGG No data
1182211925_1182211928 4 Left 1182211925 22:28684051-28684073 CCCAGCTCCATTTGTTCATGTTT No data
Right 1182211928 22:28684078-28684100 GTCCTACACCCACCTCTAGCTGG No data
1182211925_1182211931 6 Left 1182211925 22:28684051-28684073 CCCAGCTCCATTTGTTCATGTTT No data
Right 1182211931 22:28684080-28684102 CCTACACCCACCTCTAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182211925 Original CRISPR AAACATGAACAAATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr