ID: 1182219138

View in Genome Browser
Species Human (GRCh38)
Location 22:28743957-28743979
Sequence TTTCTTCAGCCAGAGGTCTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182219133_1182219138 7 Left 1182219133 22:28743927-28743949 CCAGCAACTGCAGCGTCTTGTCC 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1182219138 22:28743957-28743979 TTTCTTCAGCCAGAGGTCTCAGG 0: 1
1: 0
2: 2
3: 23
4: 199
1182219132_1182219138 19 Left 1182219132 22:28743915-28743937 CCAGCACAGGTACCAGCAACTGC 0: 1
1: 0
2: 0
3: 18
4: 290
Right 1182219138 22:28743957-28743979 TTTCTTCAGCCAGAGGTCTCAGG 0: 1
1: 0
2: 2
3: 23
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182219138 Original CRISPR TTTCTTCAGCCAGAGGTCTC AGG Exonic
900923670 1:5689726-5689748 TCCCTTCCGCCAGGGGTCTCGGG - Intergenic
901700664 1:11043497-11043519 GGTCTTCACCCAGAGGTCTGGGG - Exonic
902188856 1:14746422-14746444 TTTCTTGAGGGAGAGGTCACTGG + Intronic
902980478 1:20119260-20119282 TAGCTTCAGCCAGAGAGCTCTGG - Intronic
903707617 1:25298448-25298470 TTTCTTCAGCAGGAGGGCCCGGG + Intronic
903719624 1:25394906-25394928 TTTCTTCAGCAGGAGGGCTCGGG - Intronic
905027672 1:34862105-34862127 TTTCTTTAGTCAGAGAACTCTGG - Intergenic
906416201 1:45622755-45622777 TTTCGGCAGCCAGAGTTCCCGGG + Exonic
907761990 1:57369785-57369807 TTTCTTGAGCACTAGGTCTCTGG - Intronic
908653332 1:66360383-66360405 TATGAGCAGCCAGAGGTCTCTGG + Intronic
912551315 1:110487239-110487261 TTTGTACAGCCAGAGTTCACTGG + Intergenic
912746012 1:112246057-112246079 ATTCTTCAGGCAGAGCTCCCTGG - Intergenic
913555553 1:119963080-119963102 TTTCTTCAGTCACTTGTCTCTGG - Intronic
914397805 1:147287622-147287644 TTTCTTCAAACAGATGACTCTGG + Exonic
915303123 1:154962610-154962632 TTTCATCTGCCTCAGGTCTCTGG + Exonic
916243383 1:162661806-162661828 TTTCCTCATCCAGAGTTATCTGG + Intronic
916946387 1:169732756-169732778 CTTCTTCTGTCAGAGGTTTCTGG + Exonic
918780840 1:188697900-188697922 TTTCTTTTGCCTGAGTTCTCTGG + Intergenic
920234806 1:204495462-204495484 TTTCTTCCAGCAGTGGTCTCTGG + Intergenic
921582824 1:216914884-216914906 TTACTCCATCCAGAAGTCTCAGG + Intronic
921588035 1:216971212-216971234 ATTCTTCATCAAGAGTTCTCTGG - Intronic
922095873 1:222442400-222442422 ATTATTCAGCCAGAGGTGTGTGG + Intergenic
1063748891 10:8919678-8919700 TTTCTACAGTAAGAGATCTCAGG + Intergenic
1064720831 10:18227004-18227026 TTTCTTCACCCATAGCTCTGAGG + Intronic
1068459714 10:57311542-57311564 TTTCTTCAGTCAATGGACTCAGG - Intergenic
1068901199 10:62270621-62270643 TTTCATCAGCCAGTTTTCTCTGG + Intergenic
1069021770 10:63496480-63496502 CTTCTTCTTCCAAAGGTCTCTGG + Intergenic
1071266714 10:83971188-83971210 GTTCTTCAGTCAGCGTTCTCTGG + Intergenic
1072276420 10:93827821-93827843 TTGATTCAGCCAGAAGCCTCTGG - Intergenic
1076621115 10:131788830-131788852 TTTCTTTGGGCAGGGGTCTCAGG - Intergenic
1077215961 11:1395232-1395254 TTTCTACAAGCTGAGGTCTCAGG + Intronic
1077509303 11:2947899-2947921 CCTCTTCAGCCATAGGGCTCTGG - Intronic
1080032077 11:27672404-27672426 TGCTTTCAGCCAGATGTCTCTGG + Intronic
1080957228 11:37112692-37112714 TATGCTCAGCCAGAGGTCTAGGG - Intergenic
1081878974 11:46431489-46431511 TGTCTTCAGCCAGATGTTTCTGG + Intronic
1084272562 11:68036999-68037021 GTTCTTCAGCCTGAGGTCTTGGG - Intergenic
1084662955 11:70557863-70557885 TTTCTGCAGCCACAGCTCCCAGG + Intronic
1084768022 11:71325036-71325058 TTTCTTCTCCCAGTGGTCTTAGG - Intergenic
1084955225 11:72687648-72687670 TTTCCTCAGCCTGGGATCTCAGG + Intronic
1085937606 11:81168592-81168614 TCTCTCCAGCAAGAGTTCTCAGG + Intergenic
1090749221 11:129731344-129731366 GTCCTTCTGCCAGAAGTCTCTGG - Intergenic
1092293206 12:7177651-7177673 TGTCTTCAGCCAGAAATGTCTGG - Intergenic
1093016910 12:14164028-14164050 TTTCTTCAGCCAGGGGATTTTGG - Intergenic
1094775409 12:33721237-33721259 TTTCTTCAGACAGAAGTTTAGGG - Intergenic
1097346308 12:58497142-58497164 TTTCTTCATCCAAAGCTTTCTGG - Intergenic
1098397456 12:70036181-70036203 TTTCTTCAGCCAGATGAGCCTGG - Intergenic
1099619017 12:84976499-84976521 CATCACCAGCCAGAGGTCTCTGG + Intergenic
1102183629 12:110931552-110931574 GTTCTTCAGCAAGGGGGCTCTGG - Intergenic
1103635711 12:122303487-122303509 TTTCTGTAGCCAGAGGTTTCTGG + Intronic
1104016883 12:124967529-124967551 TTCCTGCAGCCTCAGGTCTCAGG - Intronic
1104800489 12:131552254-131552276 CATTTTCAGCCAGAGGGCTCAGG + Intergenic
1110465412 13:75794820-75794842 TTTCTTCAGGCAGAGGTTCATGG + Intronic
1110848411 13:80216631-80216653 TTTCCTCAACCACAGGACTCAGG + Intergenic
1111276107 13:85949519-85949541 TTACTTCTGCCAGGGGCCTCAGG - Intergenic
1112956612 13:105066968-105066990 TTGGATCAGCCAGACGTCTCAGG + Intergenic
1113421639 13:110175701-110175723 TCTCATCAGCCAGACGTCACAGG + Intronic
1113560148 13:111272356-111272378 TGGCTACTGCCAGAGGTCTCGGG - Intronic
1113885891 13:113658230-113658252 TTTCCTCTGCCAGAGGTCAAAGG + Intergenic
1114536217 14:23424653-23424675 TTCCTTCAGTCAGAGGACTCTGG - Intronic
1114628186 14:24142921-24142943 TATTTTCATCCAGAGGTCTCAGG - Intergenic
1115490930 14:33957485-33957507 TTTCTACAGCCAGGGGTCTCTGG + Intronic
1116364320 14:44040837-44040859 ATGCTTCAGCCAGAGGGGTCTGG - Intergenic
1117045243 14:51806818-51806840 TTTCTTCAGCCCCAGGGCCCTGG - Intergenic
1117419869 14:55533734-55533756 TTTCAACTGCCAGAGGTCACTGG - Intergenic
1119173156 14:72549880-72549902 TCTCCTCAGTCCGAGGTCTCTGG - Intronic
1119416597 14:74474544-74474566 TTGCTTCAGCCAGAGCAATCAGG + Intergenic
1122282129 14:100629628-100629650 TTTCTGCAGCCAAAGGTGTAGGG + Intergenic
1124915087 15:33962403-33962425 TTACTCAAGCCAGAGTTCTCAGG + Intronic
1127997884 15:64164402-64164424 TTTCTTCACTCACTGGTCTCAGG + Intergenic
1128144343 15:65324238-65324260 GTTCTTCAGCCTGAGGCCTCTGG + Intergenic
1129082246 15:73051966-73051988 TCTCTGCAGCCAGAGGCATCTGG + Intronic
1129653095 15:77505365-77505387 CTTCTTCAGTCAGGGGACTCAGG + Intergenic
1131308443 15:91266342-91266364 TTTCTTCAGCCAAAGGACTGAGG - Intronic
1134677773 16:16102614-16102636 TCTCTTCTGCCAGGGGTCACGGG + Exonic
1137624257 16:49897675-49897697 TTTCTCCAGCCAGAGCTTCCAGG + Intergenic
1138514440 16:57528406-57528428 ATTCTCCACCCTGAGGTCTCTGG + Intronic
1138732534 16:59210872-59210894 TTGCTGCAGCCAGAAGTCTATGG + Intergenic
1139393475 16:66621481-66621503 TTCCTTGAGTCAGAGGTCCCTGG + Intronic
1142247717 16:88977397-88977419 TTCCTTCAGCCTGGGGTATCTGG + Intergenic
1142722515 17:1786128-1786150 TTCCTCCAGCCACAGTTCTCAGG + Intronic
1142829910 17:2541062-2541084 TTTCTTAAGCCCCAGGTCTCTGG + Intergenic
1143364910 17:6400760-6400782 TTTCTTCAGCCTTTGGACTCTGG + Intronic
1146521937 17:33532124-33532146 GTTCTTCAGCCAGAGGGGTGAGG + Intronic
1146929445 17:36767433-36767455 TTCCTCCAGCCACAGGGCTCGGG - Intergenic
1147534893 17:41314183-41314205 TTTCTTCTGCCTGAGTTCTAAGG - Intergenic
1147972555 17:44227277-44227299 TTTCATCTGCCTCAGGTCTCTGG + Intergenic
1149149920 17:53549629-53549651 TTTCTTCAGTTAGTGGTTTCTGG + Intergenic
1150755292 17:67906663-67906685 TTTCTTCAGCCAGACCTTTCTGG + Intronic
1150791346 17:68202118-68202140 TTTCTTCAGCCAGACCTTTCTGG + Intergenic
1152713085 17:81884642-81884664 CGTCTTCAGCCTGAGGTCCCTGG - Intergenic
1156047784 18:32896983-32897005 TTTCTTCCACCAGATGTCCCAGG - Intergenic
1158546552 18:58402857-58402879 ATTCTACAGCCTGAGCTCTCTGG - Intergenic
1159485685 18:69054062-69054084 TCTCTTCATCCAGAGACCTCTGG - Exonic
1162069802 19:8146989-8147011 GTGGTTCAGCCAGAGGTCCCTGG + Intronic
1162474011 19:10889008-10889030 CTTCTTCAGTCAGAGGCCTGGGG - Intronic
1165643716 19:37414327-37414349 TTTCTTCAGTCAGTGTTTTCTGG + Exonic
1168127580 19:54294582-54294604 TTCCTTCACCCTGAGGGCTCAGG + Intergenic
925332504 2:3069688-3069710 TTTCCTGAGCCTGTGGTCTCTGG + Intergenic
926344652 2:11934299-11934321 TTCCTTCAGTAAGAGATCTCAGG + Intergenic
926624657 2:15081110-15081132 TTGCTTGAGCCAGAGGTAACTGG - Intergenic
926937529 2:18101350-18101372 TTTCTGCAGCCACAGTTCTGGGG + Intronic
928392658 2:30921214-30921236 TTTATGCAGCCAAAGGTGTCAGG + Intronic
930495177 2:52132484-52132506 TTTCTTTGGCCAGAGGAATCTGG - Intergenic
931838704 2:66127060-66127082 TTCCTCCAGCCAGGGTTCTCAGG + Intergenic
931906746 2:66850735-66850757 TTGCTGCAGCCCGAGGTCTCAGG - Intergenic
933068786 2:77832931-77832953 TTTCTTCTGCCTGTGGTCTTGGG - Intergenic
934935435 2:98461869-98461891 ATTCTTCAACCAGTGCTCTCTGG + Intronic
935726504 2:106028557-106028579 TTTCTCCAGCCAGAGCACTGGGG - Intergenic
935963601 2:108450243-108450265 TTGCTTAAGCCTGTGGTCTCAGG - Intronic
939000435 2:136728129-136728151 CTGCTTCAGCCAGAAGTCTGTGG - Intergenic
941632588 2:167900960-167900982 TTTTTTCATCCAGGGTTCTCAGG - Intergenic
942449314 2:176099240-176099262 GATCCTCAGGCAGAGGTCTCTGG + Intergenic
942909942 2:181231209-181231231 CTTCTTCATCCAAAGGTCTGAGG - Intergenic
946146649 2:217736040-217736062 ATTCTCCAGCCAGAGGGGTCTGG + Intronic
947827054 2:233113651-233113673 TTACTGCAGCCAGAGATCTAGGG + Intronic
1168894408 20:1313485-1313507 TGTCTGCAGACAGCGGTCTCGGG - Exonic
1169476563 20:5936643-5936665 TTTCTTGAGCAAGGGGTCTGGGG - Intergenic
1173217391 20:41098102-41098124 TTTTTTCAGTCAAAGGTTTCTGG - Intronic
1173402334 20:42736667-42736689 TCTCTCCAGCCATAGTTCTCAGG - Intronic
1173962190 20:47083104-47083126 TTGCTTCAGCCAGGGGTTTGAGG + Intronic
1178996563 21:37406347-37406369 TTTCTTCAGCTAGAGACCCCAGG + Intronic
1179639272 21:42736604-42736626 TTTCTGCAGTCCTAGGTCTCTGG - Intronic
1179825685 21:43964851-43964873 TTTCTGCAGTCAGAGGTATGTGG + Intronic
1180352599 22:11816829-11816851 TCTCTTCACCCCGAGGCCTCAGG - Intergenic
1180385291 22:12173341-12173363 TCTCTTCACCCCGAGGCCTCAGG - Intergenic
1180385655 22:12175528-12175550 TCTCTTCACCCCGAGGCCTCAGG + Intergenic
1180708443 22:17823845-17823867 TTTCTTTAGCGAGAAGTCTGAGG + Intronic
1181581644 22:23832073-23832095 TCTCCTCAGCCTGGGGTCTCAGG - Intronic
1182219138 22:28743957-28743979 TTTCTTCAGCCAGAGGTCTCAGG + Exonic
1182403007 22:30097522-30097544 TTGCTTAAGCCAGAGGTCTGAGG - Intronic
1183330580 22:37218726-37218748 AGTATTCAGCCAGAGTTCTCTGG - Intergenic
1183702697 22:39458702-39458724 TTTCTCTACCCAGAGATCTCTGG - Intronic
950368293 3:12505251-12505273 TTATTTCAGCCATCGGTCTCTGG + Intronic
950615166 3:14152371-14152393 TTTCTTCAGCCACGTGTCCCTGG + Exonic
952045259 3:29311232-29311254 ATTCTCCTGCCAGAGCTCTCCGG - Intronic
952180194 3:30908923-30908945 TTTCATCAGCAAGAGGACCCAGG - Intergenic
952688465 3:36176074-36176096 GTGCTTCAGCCTGAGGTGTCAGG + Intergenic
953135412 3:40177443-40177465 TTTCTTAAGCCAAAGGTGTCTGG - Intronic
953712214 3:45283583-45283605 TCTCTTCAGTCAGTGGTCACAGG + Intergenic
955936384 3:64106830-64106852 GTGCTGCAGCCAGAGTTCTCTGG - Intronic
956337203 3:68177476-68177498 TTACTACAGCTAGAAGTCTCAGG - Intronic
957536277 3:81507886-81507908 TTTCTTCAACAAAAGGTTTCTGG + Intronic
960301931 3:116013119-116013141 TCTCTTCAGGCAGAGTGCTCTGG + Intronic
961436731 3:126924158-126924180 TTTCCCCAACCAGAGGTCTCTGG - Intronic
963011313 3:140773108-140773130 TTGCCTCAGACACAGGTCTCTGG + Intergenic
965315289 3:167183028-167183050 ATTTTTCAGCCAGTGTTCTCTGG + Intergenic
965675605 3:171192415-171192437 TTTGATCACCCAAAGGTCTCTGG - Intronic
966344449 3:178963033-178963055 ATTTTTCAGCCAGAGGTTACTGG - Intergenic
966600687 3:181772391-181772413 TTTATTCAGAAAGATGTCTCAGG + Intergenic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
968736926 4:2302263-2302285 TTCCTTCAGACAGACTTCTCTGG + Intronic
971552088 4:27970169-27970191 TGACTTCAACCAGAGGTATCAGG - Intergenic
973749151 4:53995615-53995637 TTTCTTCAACAAGAGGTTTAAGG - Intronic
975391043 4:73817638-73817660 TTTCTCTAGCAAGAAGTCTCAGG + Intergenic
975487815 4:74953813-74953835 TTCCCTCAGTCAGATGTCTCTGG - Intronic
975673393 4:76803754-76803776 TTTCTTCACCCAGTGGTCACTGG + Intergenic
977141831 4:93383165-93383187 TTACTTCAGCCAGAGGGGTAGGG + Intronic
977253649 4:94716099-94716121 CTCCTTAAGCCAGAAGTCTCTGG + Intergenic
977907413 4:102493927-102493949 TTTCTTCTCCCAGAGCTCCCTGG - Intergenic
979992938 4:127396773-127396795 TTTCTTTACACAGAAGTCTCAGG + Intergenic
983937392 4:173511503-173511525 TTTCTTAAACAAGAGGTCCCTGG + Intergenic
985054004 4:186020309-186020331 CTCCTTCAGCCACAGGCCTCAGG - Intergenic
988422425 5:31022907-31022929 TTTCTTCTGCCAGGGCTCCCGGG - Intergenic
989585564 5:43071685-43071707 CATCGCCAGCCAGAGGTCTCTGG + Intronic
991603128 5:68373239-68373261 TGACGTCAGCCTGAGGTCTCAGG - Intergenic
992299673 5:75365364-75365386 TTTTTCCAGACTGAGGTCTCTGG + Intergenic
996822715 5:127648532-127648554 TTTATTCATCGAGTGGTCTCAGG + Intergenic
997848307 5:137308365-137308387 TTGCTGCAGCCAGAGGTCAAAGG - Intronic
998419013 5:141966858-141966880 TTTCCTCACGAAGAGGTCTCTGG + Intronic
998878119 5:146620625-146620647 TTCCTACAGCCAGTGGGCTCCGG + Intronic
1001953643 5:175833366-175833388 TTTCTTCACCACGAGTTCTCTGG - Intronic
1002195823 5:177500752-177500774 TTTCCACATCCAGATGTCTCTGG - Intergenic
1003532379 6:6948474-6948496 TTTCTCTGGCCACAGGTCTCAGG + Intergenic
1003689397 6:8337680-8337702 TTTCTGGGTCCAGAGGTCTCAGG + Intergenic
1004679591 6:17880254-17880276 TTTCTTCAGTCATCGGTTTCTGG - Intronic
1005391108 6:25334179-25334201 TTTCCTGAGGCAGAGGTATCCGG + Intronic
1006941040 6:37752566-37752588 TTCCTACAGCCCAAGGTCTCTGG - Intergenic
1007660483 6:43482378-43482400 TTCCTTCACCCAGAGGTCGTTGG - Intronic
1008602761 6:53111977-53111999 TTTCTACAGCCTGCTGTCTCTGG + Intergenic
1008740018 6:54595381-54595403 TTTGTTCAGCCTAAGGACTCTGG - Intergenic
1009650089 6:66464796-66464818 TCTCTTCAGTCAGAGATCTATGG - Intergenic
1012126703 6:95438351-95438373 ATTCTTCAGCCAGTTGTTTCTGG + Intergenic
1016354664 6:143205018-143205040 TGTCTTCAGACAGAAGTCTGTGG - Intronic
1016942433 6:149494014-149494036 TTTCAGGAGCCAGAGGTCACTGG + Intergenic
1017544684 6:155438342-155438364 CTCTTTCAGCTAGAGGTCTCTGG - Intronic
1018224394 6:161614139-161614161 TCTCTTCAGCCACATCTCTCTGG + Intronic
1018922910 6:168188258-168188280 TTTCTGCAGCCACAGGGCCCAGG - Intergenic
1021461665 7:20894341-20894363 TTTCGTCACACAGAGGTCTCAGG - Intergenic
1021958096 7:25846534-25846556 TTTCATCAGCCATATGTGTCTGG - Intergenic
1022106995 7:27203769-27203791 TTTCTTCAGTGAGAGGTTTTTGG - Intergenic
1023464567 7:40439907-40439929 TTACATCAGCAAGAGGTGTCTGG - Intronic
1023902939 7:44497848-44497870 TCTCTTCAGCAAGCAGTCTCTGG + Intergenic
1028707598 7:93868573-93868595 TTTCTGCATCCAAAGTTCTCTGG - Intronic
1028931253 7:96415388-96415410 TTAATTCAGCCAAAGGTGTCAGG - Intergenic
1032238984 7:130146922-130146944 TGTCCTCAGGCAGAGGTCACAGG - Intergenic
1032321667 7:130891390-130891412 TTTGGTCAGCCAGAGGTCACAGG - Intergenic
1034221185 7:149447473-149447495 TTACTTAAGCCAGAGGCCTGGGG + Intronic
1037082051 8:14799458-14799480 TTTCTTTCACCAGAGGTCACTGG - Intronic
1037345604 8:17897511-17897533 TTTTTTCAGCCAGTGATCTCAGG - Intronic
1037426252 8:18757947-18757969 TCTATTCAGCCAGAGGTTTTAGG - Intronic
1037707250 8:21325792-21325814 TTGCTTCAGCTAGAGGTATAGGG - Intergenic
1041151803 8:54943388-54943410 CATCATCAGCCAGAGGTCTCTGG - Intergenic
1041854819 8:62439226-62439248 TTTCCTAATCCAGAGGACTCAGG - Intronic
1043549176 8:81349515-81349537 TTTCCACAGTCAGAGATCTCAGG - Intergenic
1047337437 8:123950291-123950313 CTTTTTCAGCCTGAGGTCACTGG - Intronic
1048335015 8:133496309-133496331 GTTCTGCAGCCACAGGTCTCAGG + Intronic
1048448680 8:134512298-134512320 TTTCTGGAGGCAGAGATCTCTGG + Intronic
1048963404 8:139598048-139598070 CTGGCTCAGCCAGAGGTCTCTGG - Intergenic
1049255984 8:141614165-141614187 TTTGTTGAGCCAGAAATCTCAGG + Intergenic
1051113666 9:13669451-13669473 TCTCTTCAACCAGTGGTCTTGGG + Intergenic
1051604093 9:18903835-18903857 TTTTTTCAACCAAAGGTCTTGGG - Intronic
1052860274 9:33433798-33433820 TCTCTACAGTCAGATGTCTCTGG + Intergenic
1057124741 9:92608158-92608180 TTCCTTAAGCCAGAAGTCTCAGG + Intronic
1058152786 9:101480569-101480591 TTTCTCCAGTCATTGGTCTCAGG - Intronic
1059099358 9:111454882-111454904 TTTGTAGAGACAGAGGTCTCTGG + Intronic
1060159525 9:121348044-121348066 CTTCTGCAGCCATAGCTCTCTGG + Exonic
1185500220 X:591224-591246 TTTCTGCAGCCAGGGGTCTCGGG - Intergenic
1190120881 X:47658571-47658593 TTTCTGGAGCCACAGTTCTCGGG - Intronic
1190414219 X:50165753-50165775 TTTCTTCCTGCAGAGGACTCAGG + Intergenic
1191741064 X:64435341-64435363 TTTCATCTGCCTCAGGTCTCTGG - Intergenic
1193865768 X:86728243-86728265 TTTCTTATGCCAGATATCTCAGG - Intronic
1196909850 X:120474236-120474258 ACTCTTCAGCCAGAGTTCTCTGG + Intergenic
1199871896 X:151905349-151905371 TTTCTTCAACCAGACCACTCTGG - Intergenic
1200412942 Y:2879095-2879117 TTTGTACAGCCAGATTTCTCAGG - Intronic
1201930980 Y:19347279-19347301 TTTCTTTAGCCTGAGTGCTCTGG + Intergenic